The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022597	Mycoplasma bovis strain NADC68 chromosome, complete genome	1107634	80715	244309	1107634	transposase,tRNA	Faecalibacterium_phage(17.14%)	112	NA	NA
WP_078086171.1|80715_81744_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.0	5.0e-21
WP_041309069.1|81946_82711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954530.1|82703_83684_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	40.6	8.1e-53
WP_115265526.1|83808_88185_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	31.8	6.2e-12
WP_013954532.1|88590_89814_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	35.1	1.5e-61
WP_013456569.1|89803_90769_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	40.9	3.6e-29
WP_115265527.1|90758_91418_+	uracil-DNA glycosylase	NA	A0A068EP41	Falconid_herpesvirus	36.4	1.6e-28
WP_013954534.1|91419_93606_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_115265528.1|93615_94881_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	50.8	6.2e-98
WP_013954536.1|94890_95862_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_013954537.1|95854_97015_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_014829859.1|97004_97433_+	iron-sulfur cluster assembly scaffold protein	NA	NA	NA	NA	NA
WP_013954539.1|97422_98670_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_013954540.1|98675_99770_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_013954541.1|99757_100525_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_013954542.1|100506_101700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954543.1|101736_101997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954544.1|101999_102875_+	class II fructose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_115265530.1|102955_103528_+	nuclease	NA	NA	NA	NA	NA
WP_115265531.1|103568_104813_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.3	1.4e-09
WP_013456528.1|104987_105458_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_013954546.1|105457_106153_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_014829861.1|106199_106658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075271140.1|106644_108012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954549.1|108002_108761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954550.1|108981_109515_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_115265532.1|109499_110231_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_014829862.1|110238_110472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954553.1|110471_111332_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_013954554.1|111359_111749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954555.1|111886_112849_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_013954556.1|112841_113825_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_013954557.1|113826_114750_+	FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	41.2	1.5e-61
WP_075271137.1|114854_115544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013455974.1|115763_116855_+	pyruvate dehydrogenase E1 subunit alpha	NA	NA	NA	NA	NA
WP_013954559.1|116891_117878_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_013456556.1|118014_118239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954560.1|118238_118973_+	dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_013455917.1|118974_120588_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	7.8e-37
WP_078086165.1|120857_121886_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_004024280.1|122305_122512_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_013456035.1|122566_123112_-	DJ-1 family protein	NA	NA	NA	NA	NA
WP_115265533.1|123128_124037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115265596.1|124495_125524_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.0	5.0e-21
WP_101456646.1|126082_128968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013455934.1|128999_130121_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013456209.1|130120_131389_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013456492.1|131403_132552_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.0	4.1e-08
WP_013456036.1|132541_134944_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.6	2.2e-11
WP_075270998.1|134956_135940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954660.1|136218_137607_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013456113.1|137640_138132_+	membrane protein	NA	NA	NA	NA	NA
WP_013456012.1|138218_139436_+	YitT family protein	NA	NA	NA	NA	NA
WP_115265534.1|139473_141414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078086163.1|143424_144453_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013954995.1|144717_145962_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_013456546.1|146313_146760_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_075271210.1|146915_148973_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	29.0	7.2e-11
WP_013456267.1|148950_149337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456026.1|149365_149824_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_013455912.1|149826_150222_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_013456544.1|150233_151106_+	GTPase Era	NA	NA	NA	NA	NA
WP_013456097.1|151139_152189_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_013456141.1|152306_153743_+|tRNA	proline--tRNA ligase	tRNA	A0A1V0SJ28	Klosneuvirus	37.9	1.1e-93
WP_013456293.1|153802_154171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271211.1|154286_156104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456555.1|156199_156898_+	LemA family protein	NA	NA	NA	NA	NA
WP_101456649.1|157080_159468_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_101456650.1|159526_161368_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	19.1	2.1e-17
WP_041309079.1|161359_161605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456016.1|161630_163043_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	68.7	1.2e-81
WP_013456380.1|163026_163863_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	62.0	2.5e-87
WP_013456215.1|163855_164749_+	spermidine/putrescine ABC transporter permease	NA	Q6GZ01	Mycoplasma_phage	62.3	2.1e-92
WP_013455994.1|164735_166637_+	membrane protein	NA	Q6GZ00	Mycoplasma_phage	34.2	3.9e-80
WP_013456051.1|166861_167062_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_075271213.1|167125_168754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271214.1|168755_169892_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_013455960.1|169934_170213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075271220.1|170254_171697_-	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_081375324.1|171968_173318_-	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_075271216.1|174067_176503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271217.1|176654_179144_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	39.9	5.8e-140
WP_075271218.1|179146_180007_+	bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.6	1.3e-33
WP_013954592.1|180106_181063_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_013954593.1|181066_182260_+	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_101456651.1|182275_182698_+	pantetheine-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_101456652.1|182697_183279_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_101456653.1|183306_184803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101456654.1|184939_186376_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_101456655.1|186444_187425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101456656.1|187675_189469_+	molecular chaperone DnaK	NA	A0A0G2YAL1	Acanthamoeba_polyphaga_mimivirus	45.8	2.5e-129
WP_101456657.1|191003_192677_-|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_013954995.1|192915_194160_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_101456658.1|194253_195537_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_013954601.1|195695_196079_+	membrane protein	NA	NA	NA	NA	NA
WP_013954602.1|196216_197206_-	lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.9	1.8e-39
WP_075271077.1|197615_198416_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013954606.1|198869_199322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101456648.1|201042_202476_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954995.1|207670_208915_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_013954611.1|210213_211719_-	trigger factor	NA	NA	NA	NA	NA
WP_013954995.1|213279_214524_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_101456648.1|216447_217881_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_115265597.1|217899_218889_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.8	2.8e-21
WP_115276495.1|221039_223028_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_101456648.1|223713_225147_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954619.1|225466_226384_-	5'-3' exonuclease	NA	A0A0N7ACJ6	Bacillus_phage	31.1	1.3e-31
WP_013954620.1|226385_229319_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	34.4	1.0e-87
WP_115265598.1|233851_235183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041323931.1|235176_237504_-	membrane protein	NA	NA	NA	NA	NA
WP_078086163.1|240165_241194_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013954995.1|243064_244309_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
>prophage 2
NZ_CP022597	Mycoplasma bovis strain NADC68 chromosome, complete genome	1107634	299517	473227	1107634	transposase,tRNA,integrase	Tupanvirus(13.33%)	104	304814:304862	318694:318742
WP_013456112.1|299517_300951_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954662.1|301423_302467_+	AAA family ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	29.0	9.9e-09
WP_013954663.1|302468_304739_+	hypothetical protein	NA	NA	NA	NA	NA
304814:304862	attL	ATAATTATGTTTTCTTGTTTTATGCTTAAACTGGGAAACGTAGGAAAAT	NA	NA	NA	NA
WP_115265541.1|304968_308103_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	24.8	2.3e-24
WP_115265543.1|313168_314800_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_013954666.1|314786_315338_+	C-terminal truncated type I restriction modification DNA specificity domain-containing protein	NA	NA	NA	NA	NA
WP_115303269.1|316154_317381_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013954669.1|317454_318423_+|integrase	integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.2	3.8e-31
WP_081375155.1|320909_321389_+	hypothetical protein	NA	NA	NA	NA	NA
318694:318742	attR	ATTTTCCTACGTTTCCCAGTTTAAGCATAAAACAAGAAAACATAATTAT	NA	NA	NA	NA
WP_013954672.1|321683_322841_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013954673.1|323786_325406_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	39.8	5.9e-109
WP_115265544.1|325645_328327_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	27.2	1.5e-80
WP_075271156.1|328328_329039_+	signal peptidase II	NA	NA	NA	NA	NA
WP_014829941.1|329231_330905_-|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_101456675.1|331129_332989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101456676.1|333939_334536_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_075271197.1|334516_335479_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	26.5	1.9e-06
WP_075271196.1|335515_337882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954995.1|337957_339202_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_075271195.1|339295_340162_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_075271194.1|340154_340997_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_075271193.1|341028_341916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456065.1|342006_342273_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_075271192.1|342426_343218_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_115265545.1|343343_344561_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	32.5	2.7e-13
WP_115265546.1|344626_345601_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013456634.1|345587_346412_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075271187.1|346560_348330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954682.1|348368_349436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075271184.1|349725_351726_+	phosphoesterase	NA	NA	NA	NA	NA
WP_013456489.1|351706_352162_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_013954685.1|352151_353627_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	33.5	6.0e-52
WP_101456679.1|353626_354919_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_101456680.1|355277_356300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101456681.1|356707_357082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101456682.1|358380_358680_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_101456683.1|361888_362746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115265547.1|363174_364524_+	NADH oxidase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.8	1.9e-12
WP_101456685.1|364516_366127_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_101456686.1|366192_367632_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_101456687.1|369083_371180_-	peptidase S41	NA	NA	NA	NA	NA
WP_075271013.1|371143_372985_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_075271012.1|372987_375297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075271011.1|375321_375615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075271010.1|375615_376977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954698.1|377496_378330_+	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	45.7	3.6e-54
WP_013954699.1|378636_379590_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_013954700.1|379639_380536_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_115265548.1|380569_382444_-	peptidase S41	NA	NA	NA	NA	NA
WP_013954995.1|382549_383794_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_115265549.1|383819_384314_-	hypothetical protein	NA	S6AVW3	Thermus_phage	33.1	3.2e-10
WP_048349614.1|384616_386290_-|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_013954704.1|386672_388037_+	NADH oxidase	NA	NA	NA	NA	NA
WP_013954703.1|388350_390024_+|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_013954705.1|390153_390939_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_013954706.1|390943_392473_-	RNA polymerase sigma factor	NA	G8CLC7	Synechococcus_phage	33.7	2.0e-29
WP_101456689.1|392465_394406_-	DNA primase	NA	A0A1S5RFD7	Helicobacter_phage	35.3	5.7e-42
WP_013954708.1|394447_395824_-|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	32.0	3.9e-53
WP_013954660.1|397669_399058_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954710.1|399803_401159_+	alkylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013456298.1|401161_402094_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.0	1.3e-07
WP_013456124.1|402057_403809_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013456114.1|403915_404161_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_013954711.1|404241_406761_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_038582866.1|406997_408044_+	alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	26.9	1.0e-13
WP_013954712.1|408192_410031_-	type I DNA topoisomerase	NA	A0A2P1ELA0	Moumouvirus	32.1	4.8e-75
WP_013456432.1|410410_410848_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_013456362.1|410889_411288_+	single-stranded DNA-binding protein	NA	A0A0H3U4B5	Staphylococcus_phage	30.3	9.3e-08
WP_115265550.1|411307_411634_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_013954713.1|411768_413097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078086163.1|413335_414364_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013456295.1|414707_415163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954715.1|415213_416884_-	amino acid permease	NA	NA	NA	NA	NA
WP_013954716.1|417122_418439_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	25.1	2.7e-11
WP_013456122.1|418507_420211_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	23.1	2.0e-14
WP_013954691.1|420294_421539_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	5.3e-09
WP_013456084.1|421636_422428_-	aquaporin family protein	NA	M1HQW3	Paramecium_bursaria_Chlorella_virus	27.5	7.3e-12
WP_013954718.1|422436_423945_-	glycerol kinase	NA	NA	NA	NA	NA
WP_013456345.1|424234_425626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456049.1|425758_426760_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_013456401.1|426761_427730_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_013456470.1|427843_428587_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_013456409.1|428766_429051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456558.1|429043_430690_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_013456463.1|430696_431701_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_013456004.1|431693_432368_+	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	31.9	1.2e-18
WP_115265551.1|432440_435419_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_013954721.1|435471_436824_-	YitT family protein	NA	NA	NA	NA	NA
WP_013954722.1|436918_437755_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_013954723.1|437741_438473_-	DNA processing protein DprA	NA	NA	NA	NA	NA
WP_038582875.1|442012_443053_+	zinc-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	29.7	5.2e-34
WP_013954726.1|446027_448829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954727.1|449057_456089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038582704.1|458655_459564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115265596.1|459902_460931_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.0	5.0e-21
WP_115265552.1|461414_462275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954754.1|462448_463177_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_013954755.1|463346_464471_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_013954756.1|464481_467124_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	36.1	6.5e-65
WP_013954757.1|467116_467557_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_013954758.1|467546_468275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954759.1|468556_470692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954760.1|470866_471589_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	33.8	1.4e-06
WP_101456648.1|471793_473227_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP022597	Mycoplasma bovis strain NADC68 chromosome, complete genome	1107634	488584	563611	1107634	transposase,tRNA	Enterobacteria_phage(18.18%)	55	NA	NA
WP_101456648.1|488584_490018_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_101456648.1|493635_495069_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954780.1|495835_496423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954995.1|499168_500413_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_013954782.1|502626_503271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954783.1|504777_506010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013455996.1|506922_507414_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_013456577.1|507403_507955_+	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_013456513.1|508056_508536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456428.1|508738_509842_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_013954784.1|509882_510692_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_101456693.1|510663_511350_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_013954786.1|511365_514197_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	52.6	1.7e-276
WP_013954787.1|514198_516208_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_013954788.1|516327_517275_+	DNA (cytosine-5-)-methyltransferase	NA	V5URQ5	Oenococcus_phage	63.3	2.4e-110
WP_014829932.1|517542_517995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954789.1|518006_519566_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_075271036.1|520044_520905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271035.1|520912_521416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101456695.1|521461_524467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954794.1|524741_525410_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_013456303.1|525617_526046_+	transcriptional regulator MraZ	NA	NA	NA	NA	NA
WP_013954796.1|526047_526950_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_013954797.1|526990_528208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271135.1|528244_529387_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_013954799.1|529448_529826_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
WP_013954800.1|530104_530788_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_013954801.1|530797_532744_+	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.7	1.3e-70
WP_115265553.1|532753_533314_+	single-stranded DNA-binding protein	NA	B8R683	Lactobacillus_phage	41.0	5.0e-15
WP_013456196.1|533434_534061_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_038582742.1|534029_534758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954804.1|534778_537118_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	33.7	2.6e-110
WP_013954805.1|537195_540327_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.0	7.1e-135
WP_013455922.1|540427_541144_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_013456007.1|541332_541839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115265554.1|542040_543033_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.6	1.1e-36
WP_013954995.1|543058_544303_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_101456648.1|544613_546047_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013456419.1|546353_547265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456542.1|547400_547814_-	ATP synthase F1 subunit epsilon	NA	NA	NA	NA	NA
WP_013456276.1|547829_549293_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_013456581.1|549345_550209_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_115265555.1|550201_551788_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_013954808.1|551780_552341_-	ATP synthase F1 subunit delta	NA	NA	NA	NA	NA
WP_013954809.1|552343_552916_-	ATP synthase F0 subunit B	NA	NA	NA	NA	NA
WP_013456149.1|552920_553148_-	ATP synthase subunit C	NA	NA	NA	NA	NA
WP_013456258.1|553163_553982_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_013954810.1|553982_554420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954811.1|554619_556293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954812.1|556555_557359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078086173.1|557833_558862_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	32.9	1.1e-20
WP_014829937.1|559113_559815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014829938.1|560426_560867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954815.1|560859_562608_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.9e-101
WP_014829939.1|562615_563611_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP022597	Mycoplasma bovis strain NADC68 chromosome, complete genome	1107634	830570	927808	1107634	transposase,tRNA,integrase	Staphylococcus_phage(15.0%)	52	827085:827111	895893:895919
827085:827111	attL	TTAATAACCCTTCATCAGCGTAAGCTT	NA	NA	NA	NA
WP_075270949.1|830570_831491_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	48.3	1.6e-79
WP_013954950.1|831536_834734_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_115304821.1|834742_836005_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	22.9	1.7e-10
WP_013954952.1|836009_838688_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	39.6	7.0e-91
WP_014829966.1|839190_840603_+|transposase	IS1634-like element ISMbov2 family transposase	transposase	NA	NA	NA	NA
WP_115265601.1|840712_841453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954954.1|841509_841998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115265602.1|842295_842649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954957.1|843278_843833_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_013954958.1|843841_845776_-	peptidase S41	NA	NA	NA	NA	NA
WP_115265577.1|845939_847844_-	peptidase S41	NA	NA	NA	NA	NA
WP_075271178.1|848131_849523_+|tRNA	glutamate--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	25.2	6.6e-08
WP_013456580.1|849513_849915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456621.1|850177_851326_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	52.4	3.8e-102
WP_115265578.1|851542_852508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456411.1|852524_853883_-	signal recognition particle protein	NA	D6PHS7	uncultured_phage	29.0	8.7e-05
WP_013456099.1|853901_854726_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013456213.1|854797_855037_-	hypothetical protein	NA	A0A172JI00	Bacillus_phage	40.9	4.6e-10
WP_013954995.1|855346_856591_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_075271002.1|861313_862315_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	23.1	1.7e-10
WP_075271001.1|862531_863716_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_013456619.1|864095_865400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271000.1|865399_866296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954995.1|868286_869531_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_013456433.1|870085_871447_-	peptidase M17	NA	Q6GYZ8	Mycoplasma_phage	56.4	3.1e-103
WP_081375096.1|871521_872790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081375096.1|875702_876971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954974.1|877026_879069_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_013456179.1|879234_881328_-	elongation factor G	NA	A0A1B0RXH7	Streptococcus_phage	25.2	1.8e-54
WP_013456121.1|881357_881828_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_004024001.1|881858_882272_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_013954975.1|882592_883810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115265579.1|883847_885461_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.8	1.4e-54
WP_013456337.1|887235_888090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456540.1|888567_889956_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954983.1|890390_892223_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.3	3.4e-28
WP_038582898.1|892233_894018_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.3	1.0e-29
WP_013954985.1|894241_895711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456163.1|895969_896215_-	YneF family protein	NA	NA	NA	NA	NA
895893:895919	attR	AAGCTTACGCTGATGAAGGGTTATTAA	NA	NA	NA	NA
WP_013954986.1|896240_897329_-	M42 family peptidase	NA	NA	NA	NA	NA
WP_075271052.1|898719_906717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954989.1|906872_911309_-	DNA-directed RNA polymerase subunit beta'	NA	A0A076FGB9	Aureococcus_anophage	23.5	3.2e-48
WP_115265580.1|911301_914937_-	DNA-directed RNA polymerase subunit beta	NA	W8W1V4	Invertebrate_iridescent_virus	26.9	2.0e-48
WP_013456028.1|915388_916033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004024017.1|916167_916539_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_101456715.1|916565_917087_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_013456027.1|917551_918277_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_013456485.1|918288_919758_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	36.9	4.0e-80
WP_013954990.1|919911_920802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954991.1|920846_923006_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013954992.1|923152_925321_+	AAA family ATPase	NA	K4FB40	Cronobacter_phage	34.4	1.1e-107
WP_013954995.1|926563_927808_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
>prophage 5
NZ_CP022597	Mycoplasma bovis strain NADC68 chromosome, complete genome	1107634	1034605	1089376	1107634	transposase,tRNA,integrase	Enterobacteria_phage(22.22%)	46	1034272:1034323	1064782:1064833
1034272:1034323	attL	ATATTCATTAACAAAGCAAAAAGCACCACAAGTTAACTTGCGGCGCTTTTTG	NA	NA	NA	NA
WP_078086180.1|1034605_1035634_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_115265587.1|1035844_1036852_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_115276525.1|1037397_1038006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115265588.1|1038276_1038657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115304824.1|1040073_1040664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078086161.1|1042578_1043376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115265590.1|1044079_1044787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115265591.1|1044954_1045638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954995.1|1045759_1047004_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_115304825.1|1047051_1047885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456123.1|1048170_1048920_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_013955063.1|1049318_1051163_+	RNase J family beta-CASP ribonuclease	NA	NA	NA	NA	NA
WP_013955064.1|1051297_1052449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014829996.1|1052638_1055056_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_013955066.1|1055073_1055382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075271049.1|1055679_1057101_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_013955068.1|1057093_1058407_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_013955069.1|1058406_1058712_-|tRNA	glutamyl-tRNA(Gln) amidotransferase	tRNA	NA	NA	NA	NA
WP_013955070.1|1058717_1059572_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_013456616.1|1059583_1060162_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	29.7	1.2e-11
WP_115304826.1|1060151_1060913_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_013456430.1|1060905_1061646_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_013456524.1|1061655_1061970_-	endonuclease	NA	NA	NA	NA	NA
WP_013456382.1|1062143_1063454_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_013456261.1|1063456_1064122_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_014829997.1|1064192_1064654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013955073.1|1064941_1066075_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	32.2	3.0e-27
1064782:1064833	attR	ATATTCATTAACAAAGCAAAAAGCACCACAAGTTAACTTGCGGCGCTTTTTG	NA	NA	NA	NA
WP_013955074.1|1066312_1066654_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_013955075.1|1066827_1068063_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	33.2	3.3e-59
WP_013955076.1|1068073_1068676_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_013456246.1|1068737_1069640_+	DegV domain-containing protein	NA	NA	NA	NA	NA
WP_014829999.1|1069800_1070034_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_013955078.1|1070073_1070796_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_115265592.1|1070795_1071872_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_013955080.1|1071997_1072570_-	cell division protein Fic	NA	NA	NA	NA	NA
WP_013955081.1|1072591_1074013_-	YitT family protein	NA	NA	NA	NA	NA
WP_013955084.1|1077169_1079137_+	type IIA DNA topoisomerase subunit B	NA	G3M9Z3	Bacillus_virus	41.5	8.7e-131
WP_013955085.1|1079259_1079574_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.0	1.7e-12
WP_013955086.1|1079626_1080073_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	37.4	1.8e-12
WP_013954660.1|1080562_1081951_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013955088.1|1082973_1084647_+|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_115265593.1|1084951_1085941_-	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_038582834.1|1086056_1086266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115265606.1|1086402_1087362_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_013955092.1|1087557_1087953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013955093.1|1088131_1089376_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.3	1.1e-09
