The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022598	Mycoplasma bovis strain NADC70 chromosome, complete genome	1103068	3422	95775	1103068	transposase,tRNA	Bodo_saltans_virus(18.18%)	66	NA	NA
WP_115265524.1|3422_4667_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	5.3e-09
WP_014829846.1|4669_5989_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_013954491.1|6259_7045_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013954492.1|7046_7838_+	alpha/beta hydrolase	NA	G9E3U1	Emiliania_huxleyi_virus	19.7	7.8e-06
WP_115265595.1|7889_9071_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_115276487.1|9063_10110_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	26.2	1.2e-14
WP_013456070.1|10179_11217_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	25.9	9.2e-15
WP_013456410.1|11194_12064_-	deacetylase SIR2	NA	NA	NA	NA	NA
WP_013954496.1|12065_12410_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_013456398.1|12393_13395_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013456108.1|13579_14383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013455936.1|14433_15840_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013456171.1|15966_16419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456518.1|16527_18132_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	26.4	1.2e-10
WP_013954498.1|18124_20113_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013456299.1|20112_21090_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013456248.1|21367_22030_+	deoxyguanosine kinase	NA	Q5ULP7	Lactobacillus_virus	27.6	2.9e-06
WP_013456161.1|22031_22685_+	deoxyguanosine kinase	NA	Q5ULP7	Lactobacillus_virus	26.2	1.9e-05
WP_013456349.1|24864_25770_-	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_013456608.1|25772_26672_-	sugar kinase	NA	NA	NA	NA	NA
WP_078086163.1|26979_28008_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013456023.1|28369_29200_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_115276488.1|29233_31210_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013954500.1|31209_32232_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	3.6e-27
WP_013456151.1|32338_32686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954501.1|32660_34082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101456648.1|34428_35862_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013456564.1|36235_37570_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	30.7	4.5e-06
WP_013456445.1|37562_39182_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	6.0e-13
WP_013456184.1|39189_40203_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013954502.1|40204_41290_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013954503.1|41298_44250_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_115276489.1|44263_54244_-	PDxFFG protein	NA	NA	NA	NA	NA
WP_013954506.1|55978_57220_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	30.9	5.3e-41
WP_013954507.1|57266_57968_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_013954508.1|57957_58542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456379.1|58597_58747_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_014829857.1|58746_58983_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_013456192.1|58988_59588_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_013955088.1|60181_61855_+|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_013954511.1|62082_64293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954512.1|64450_65485_+	membrane protein	NA	NA	NA	NA	NA
WP_013954513.1|65676_66399_+	UMP kinase	NA	NA	NA	NA	NA
WP_013954514.1|66398_66950_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_013954515.1|67218_68454_-	competence protein ComEC	NA	NA	NA	NA	NA
WP_013954516.1|68531_69044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101456642.1|69138_70137_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_101456643.1|70151_70940_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	E4ZFQ0	Streptococcus_phage	25.2	2.0e-09
WP_075270978.1|70932_71694_-	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
WP_075270979.1|71703_73041_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_013456626.1|73168_73843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456534.1|73874_74885_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_115276490.1|77414_78683_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.2	2.0e-80
WP_075270981.1|78716_79748_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_004024238.1|80058_80208_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_013456053.1|80221_80545_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_075270982.1|80558_82724_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_013954527.1|82879_83860_+	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	27.1	3.9e-15
WP_075270983.1|83863_84685_+	alpha/beta hydrolase	NA	G9E3U1	Emiliania_huxleyi_virus	32.5	3.0e-08
WP_078086171.1|85072_86101_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.0	5.0e-21
WP_041309069.1|86303_87068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954530.1|87060_88041_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	40.6	8.1e-53
WP_013954531.1|88165_92542_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	31.8	6.2e-12
WP_013954532.1|92947_94171_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	35.1	1.5e-61
WP_013456569.1|94160_95126_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	40.9	3.6e-29
WP_013954533.1|95115_95775_+	uracil-DNA glycosylase	NA	A0A068EP41	Falconid_herpesvirus	36.4	1.6e-28
>prophage 2
NZ_CP022598	Mycoplasma bovis strain NADC70 chromosome, complete genome	1103068	143273	226690	1103068	transposase,tRNA	Mycoplasma_phage(25.0%)	53	NA	NA
WP_078086163.1|143273_144302_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013456546.1|144819_145266_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_075271210.1|145421_147479_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	29.0	7.2e-11
WP_013456267.1|147456_147843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456026.1|147871_148330_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_013455912.1|148332_148728_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_013456544.1|148739_149612_+	GTPase Era	NA	NA	NA	NA	NA
WP_013456097.1|149645_150695_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_013456141.1|150812_152249_+|tRNA	proline--tRNA ligase	tRNA	A0A1V0SJ28	Klosneuvirus	37.9	1.1e-93
WP_013456293.1|152308_152677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271211.1|152792_154610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456555.1|154705_155404_+	LemA family protein	NA	NA	NA	NA	NA
WP_101456649.1|155586_157974_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_101456650.1|158032_159874_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	19.1	2.1e-17
WP_041309079.1|159865_160111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456016.1|160136_161549_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	68.7	1.2e-81
WP_013456380.1|161532_162369_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	62.0	2.5e-87
WP_115287296.1|162361_163255_+	ABC transporter permease	NA	Q6GZ01	Mycoplasma_phage	61.9	3.6e-92
WP_013455994.1|163241_165143_+	membrane protein	NA	Q6GZ00	Mycoplasma_phage	34.2	3.9e-80
WP_013456051.1|165367_165568_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_075271213.1|165631_167260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271214.1|167261_168398_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_013455960.1|168441_168720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115287297.1|168761_170204_-	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_081375324.1|170472_171822_-	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_075271216.1|172569_175005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271217.1|175156_177646_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	39.9	5.8e-140
WP_075271218.1|177648_178509_+	bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.6	1.3e-33
WP_013954592.1|178608_179565_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_013954593.1|179568_180762_+	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_101456651.1|180777_181200_+	pantetheine-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_101456652.1|181199_181781_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_101456653.1|181808_183305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101456654.1|183441_184878_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_101456655.1|184946_185927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101456656.1|186177_187971_+	molecular chaperone DnaK	NA	A0A0G2YAL1	Acanthamoeba_polyphaga_mimivirus	45.8	2.5e-129
WP_101456658.1|191412_192696_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_013954601.1|192854_193238_+	membrane protein	NA	NA	NA	NA	NA
WP_013954602.1|193375_194365_-	lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.9	1.8e-39
WP_075271077.1|194774_195575_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013954606.1|196028_196481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115276493.1|196648_199072_-	type III restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_115287298.1|202569_204216_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	28.6	4.0e-28
WP_013954611.1|204343_205849_-	trigger factor	NA	NA	NA	NA	NA
WP_013954613.1|206502_207912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101456648.1|209234_210668_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_115265597.1|210686_211676_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.8	2.8e-21
WP_115276495.1|213825_215814_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013955088.1|216668_218342_+|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_101456648.1|218659_220093_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954619.1|220413_221331_-	5'-3' exonuclease	NA	A0A0N7ACJ6	Bacillus_phage	31.1	1.3e-31
WP_013954620.1|221332_224266_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	34.4	1.0e-87
WP_014829941.1|225016_226690_+|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP022598	Mycoplasma bovis strain NADC70 chromosome, complete genome	1103068	235114	310870	1103068	transposase,tRNA	Enterobacteria_phage(11.76%)	56	NA	NA
WP_078086163.1|235114_236143_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013954995.1|236793_238038_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_014829881.1|241121_242555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014829883.1|243192_244524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041323925.1|244517_246833_-	membrane protein	NA	NA	NA	NA	NA
WP_013954624.1|247007_247457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954625.1|247778_249620_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_013954626.1|249606_250059_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_049773792.1|250169_251885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954628.1|252028_253048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954629.1|253048_253597_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_013455969.1|253664_254225_+	peptide deformylase	NA	NA	NA	NA	NA
WP_013954630.1|254237_255635_+	CvpA family protein	NA	NA	NA	NA	NA
WP_013954631.1|255748_257665_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.9	5.7e-119
WP_013954632.1|257678_260264_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	29.6	9.8e-90
WP_013954633.1|260405_261335_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_075271093.1|261336_262053_+	ribonuclease HIII	NA	NA	NA	NA	NA
WP_013954635.1|262240_263215_+	DNA (cytosine-5-)-methyltransferase	NA	R4TMW4	Halovirus	38.4	1.6e-48
WP_013954636.1|263207_263915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456076.1|264384_264714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954638.1|264956_265652_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_014829885.1|265635_266622_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	35.7	2.2e-42
WP_013954642.1|266839_267562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038582854.1|269509_270277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954646.1|270962_271907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954647.1|272005_273952_+	transketolase	NA	NA	NA	NA	NA
WP_013455927.1|274115_275132_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.6	8.4e-37
WP_101456648.1|275358_276792_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954648.1|277100_277655_-	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	2.1e-21
WP_013456603.1|277733_278003_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_013954649.1|278116_278704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954650.1|278797_280966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954651.1|280977_282360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954652.1|282359_282695_+	HIT family protein	NA	B5LJ12	Mycobacterium_phage	33.8	3.6e-05
WP_013954653.1|282813_283512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004024364.1|283565_283718_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_013456491.1|284183_284669_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_013456378.1|284706_284943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954655.1|284932_285997_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_013954656.1|286065_286350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014829889.1|286371_287922_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	35.7	1.9e-80
WP_013954658.1|287924_288731_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_013456627.1|288730_290920_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	1.0e-71
WP_013456572.1|290922_291165_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_013456283.1|291507_292095_+	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	38.6	1.2e-08
WP_013456579.1|292100_292853_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_013456514.1|292870_293869_+	serine/threonine protein kinase	NA	Q85453	Moloney_murine_sarcoma_virus	32.2	4.3e-17
WP_013456585.1|293880_294726_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_013455939.1|294712_295375_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_115265540.1|296237_298463_-	recombinase RecD	NA	A0A2K9V9X6	Bandra_megavirus	26.7	2.3e-31
WP_013456112.1|298608_300042_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954662.1|300514_301558_+	AAA family ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	29.0	9.9e-09
WP_013954663.1|301559_303830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115265541.1|304059_307194_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	24.8	2.3e-24
WP_013954995.1|307219_308464_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_014829941.1|309196_310870_+|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP022598	Mycoplasma bovis strain NADC70 chromosome, complete genome	1103068	376292	509392	1103068	transposase,tRNA	Tupanvirus(18.18%)	79	NA	NA
WP_013954703.1|376292_377966_-|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_013954704.1|378279_379644_-	NADH oxidase	NA	NA	NA	NA	NA
WP_115276498.1|380026_381700_+|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_013954705.1|381829_382615_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_013954706.1|382619_384149_-	RNA polymerase sigma factor	NA	G8CLC7	Synechococcus_phage	33.7	2.0e-29
WP_101456689.1|384141_386082_-	DNA primase	NA	A0A1S5RFD7	Helicobacter_phage	35.3	5.7e-42
WP_013954708.1|386123_387500_-|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	32.0	3.9e-53
WP_013954709.1|387611_389399_-	membrane protein	NA	NA	NA	NA	NA
WP_013954710.1|389849_391205_+	alkylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013456298.1|391207_392140_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.0	1.3e-07
WP_013456124.1|392103_393855_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_115276499.1|393961_394207_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_013954711.1|394287_396807_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_038582866.1|397043_398090_+	alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	26.9	1.0e-13
WP_013954712.1|398238_400077_-	type I DNA topoisomerase	NA	A0A2P1ELA0	Moumouvirus	32.1	4.8e-75
WP_013456432.1|400456_400894_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_013456362.1|400935_401334_+	single-stranded DNA-binding protein	NA	A0A0H3U4B5	Staphylococcus_phage	30.3	9.3e-08
WP_115265550.1|401353_401680_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_013954713.1|401814_403143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078086163.1|403381_404410_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013456295.1|404753_405209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954715.1|405259_406930_-	amino acid permease	NA	NA	NA	NA	NA
WP_013954716.1|407168_408485_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	25.1	2.7e-11
WP_013456122.1|408553_410257_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	23.1	2.0e-14
WP_013456084.1|411680_412472_-	aquaporin family protein	NA	M1HQW3	Paramecium_bursaria_Chlorella_virus	27.5	7.3e-12
WP_013954718.1|412480_413989_-	glycerol kinase	NA	NA	NA	NA	NA
WP_013456345.1|414278_415670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456049.1|415802_416804_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_013456401.1|416805_417774_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_013456470.1|417887_418631_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_013456409.1|418810_419095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115276501.1|419087_420734_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_013456463.1|420740_421745_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_013456004.1|421737_422412_+	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	31.9	1.2e-18
WP_115265551.1|422484_425463_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_013954721.1|425515_426868_-	YitT family protein	NA	NA	NA	NA	NA
WP_013954722.1|426962_427799_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_013954723.1|427785_428517_-	DNA processing protein DprA	NA	NA	NA	NA	NA
WP_013455919.1|428874_430308_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_038582875.1|430400_431441_+	zinc-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	29.7	5.2e-34
WP_013954995.1|432001_433246_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_013954726.1|434388_437190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115287300.1|437418_444450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038582704.1|447018_447927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078086171.1|448265_449294_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.0	5.0e-21
WP_101456648.1|451671_453105_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014829914.1|455304_456354_+	zinc-dependent alcohol dehydrogenase	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	29.2	8.1e-35
WP_013954740.1|456397_457645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075271400.1|457629_458427_-	DNA (cytosine-5-)-methyltransferase	NA	A0A140HLV8	Bacillus_phage	40.5	9.8e-25
WP_013954742.1|458353_458836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101456648.1|461708_463142_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_115276529.1|463354_464383_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	32.6	1.1e-20
WP_101456648.1|466373_467807_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954754.1|469797_470526_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_013954755.1|470695_471820_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_013954756.1|471830_474473_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	36.1	6.5e-65
WP_013954757.1|474465_474906_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_013954758.1|474895_475624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954760.1|478216_478939_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	33.8	1.4e-06
WP_101456648.1|479143_480577_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954761.1|480921_481374_+	DUF4065 domain-containing protein	NA	A0A0N9SGM1	Paenibacillus_phage	41.0	2.0e-22
WP_013954765.1|482481_483333_+	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_014829922.1|483551_483821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014829924.1|484971_486333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038582722.1|486333_488343_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_013456441.1|488400_488667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954770.1|488659_489511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954771.1|489503_489728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954772.1|489747_490179_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_013954773.1|490191_490845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115276503.1|491072_492593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038582726.1|492839_493037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456404.1|493060_493366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101456648.1|497996_499430_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954780.1|500196_500784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954781.1|500786_505310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954782.1|505644_506289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115276504.1|506452_507691_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	3.1e-09
WP_101456648.1|507958_509392_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP022598	Mycoplasma bovis strain NADC70 chromosome, complete genome	1103068	662405	744466	1103068	transposase,tRNA	Staphylococcus_phage(25.0%)	57	NA	NA
WP_013455919.1|662405_663839_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075271115.1|664692_667302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075271152.1|667334_669545_-	putative immunoglobulin-blocking virulence protein	NA	NA	NA	NA	NA
WP_013455970.1|669730_671695_-	DNA ligase (NAD(+)) LigA	NA	Q332J4	Clostridium_botulinum_C_phage	31.7	3.9e-83
WP_013456498.1|671830_673078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456083.1|673211_674399_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_013456339.1|674487_675309_+	DNA-binding protein WhiA	NA	NA	NA	NA	NA
WP_115265600.1|675523_676708_-	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_013456160.1|677014_677722_+	MjaI family restriction endonuclease	NA	E3SIW0	Synechococcus_phage	35.1	2.6e-21
WP_013456269.1|677729_678788_-	site-specific DNA-methyltransferase	NA	S4VS49	Pandoravirus	29.4	2.8e-19
WP_013455983.1|678971_679934_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080551570.1|680527_681556_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013456157.1|681988_682423_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_013456078.1|682424_682832_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_013455924.1|683057_683390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456635.1|683391_684279_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	38.4	4.1e-48
WP_115265564.1|684653_687386_+	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.3	5.9e-77
WP_013954870.1|687635_689498_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013954871.1|689500_690205_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.8	1.1e-19
WP_013954872.1|690182_691331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954873.1|691320_692211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954874.1|692197_693085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954875.1|693110_694682_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	33.3	2.0e-69
WP_013954876.1|694726_695692_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_013954877.1|695713_696133_+	transcription antitermination protein NusB	NA	NA	NA	NA	NA
WP_013456406.1|696239_696842_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_013456586.1|697148_697421_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_013954878.1|697447_698383_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013954879.1|698383_699502_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013954880.1|699505_701728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954881.1|701757_702651_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_013954882.1|705431_706100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456602.1|706634_707243_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	37.6	8.6e-13
WP_013456480.1|707223_707412_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004023890.1|707436_707787_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_013954884.1|707858_711278_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_115276515.1|711496_712162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954886.1|712212_712971_-	DUF1679 domain-containing protein	NA	NA	NA	NA	NA
WP_013954887.1|713047_714841_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.1	5.7e-20
WP_013954888.1|714916_716368_+	kinase	NA	NA	NA	NA	NA
WP_013954889.1|716451_717183_+	nitroreductase	NA	NA	NA	NA	NA
WP_013954890.1|717255_718050_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_115276530.1|718091_718292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013455927.1|720147_721164_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.6	8.4e-37
WP_101456648.1|724454_725888_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954894.1|727870_729442_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014829956.1|729504_731124_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013954896.1|731236_732481_-	malate transporter	NA	NA	NA	NA	NA
WP_013954897.1|732711_733683_-	lactate dehydrogenase	NA	NA	NA	NA	NA
WP_004023902.1|733889_734126_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_013954898.1|734442_735417_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_013954899.1|735436_736639_+	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_013954900.1|736647_737553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954901.1|737609_739874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954902.1|740171_741638_+	MFS transporter	NA	NA	NA	NA	NA
WP_013455927.1|741789_742806_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.6	8.4e-37
WP_101456648.1|743032_744466_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP022598	Mycoplasma bovis strain NADC70 chromosome, complete genome	1103068	816843	874229	1103068	integrase,transposase,tRNA	Staphylococcus_phage(28.57%)	36	822183:822209	880166:880192
WP_013954691.1|816843_818088_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	5.3e-09
WP_115276531.1|818878_820006_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_075271129.1|820129_821431_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_115287306.1|821807_822845_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
822183:822209	attL	TTAATAACCCTTCATCAGCGTAAGCTT	NA	NA	NA	NA
WP_075270949.1|822859_823780_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	48.3	1.6e-79
WP_013954950.1|823825_827023_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_115287307.1|827031_828294_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	25.9	8.6e-07
WP_013954952.1|828298_830977_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	39.6	7.0e-91
WP_115265601.1|833000_833741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954954.1|833797_834286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954957.1|835412_835967_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_013954958.1|835975_837910_-	peptidase S41	NA	NA	NA	NA	NA
WP_115276518.1|837936_839979_-	peptidase S41	NA	NA	NA	NA	NA
WP_075271178.1|840266_841658_+|tRNA	glutamate--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	25.2	6.6e-08
WP_013456580.1|841648_842050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456621.1|842312_843461_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	52.4	3.8e-102
WP_013456411.1|844661_846020_-	signal recognition particle protein	NA	D6PHS7	uncultured_phage	29.0	8.7e-05
WP_013456099.1|846038_846863_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013456213.1|846934_847174_-	hypothetical protein	NA	A0A172JI00	Bacillus_phage	40.9	4.6e-10
WP_013954995.1|849075_850320_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_101456648.1|850626_852060_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013455927.1|852286_853303_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.6	8.4e-37
WP_075271002.1|853453_854455_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	23.1	1.7e-10
WP_075271001.1|854671_855856_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_013456619.1|856235_857540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271000.1|857539_858436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456433.1|858539_859901_-	peptidase M17	NA	Q6GYZ8	Mycoplasma_phage	56.4	3.1e-103
WP_081375096.1|859975_861244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954974.1|861299_863342_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_013456179.1|863507_865601_-	elongation factor G	NA	A0A1B0RXH7	Streptococcus_phage	25.2	1.8e-54
WP_013456121.1|865630_866101_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_004024001.1|866131_866545_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_013954975.1|866865_868083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014829972.1|868120_869734_+	ABC-F family ATPase	NA	A0A2K9L3Z8	Tupanvirus	29.0	1.1e-54
WP_013456337.1|871508_872363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456540.1|872840_874229_+|transposase	transposase	transposase	NA	NA	NA	NA
880166:880192	attR	AAGCTTACGCTGATGAAGGGTTATTAA	NA	NA	NA	NA
>prophage 7
NZ_CP022598	Mycoplasma bovis strain NADC70 chromosome, complete genome	1103068	913256	982239	1103068	transposase,tRNA	Enterobacteria_phage(23.08%)	58	NA	NA
WP_013954660.1|913256_914645_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013456062.1|915714_916143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075270941.1|916155_916827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115287308.1|916850_917273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115287319.1|917283_917892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271028.1|917940_918618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101456648.1|919119_920553_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013456280.1|923540_923780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013455971.1|923782_924142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456044.1|924146_925220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271025.1|925366_925813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271024.1|925796_928583_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_115265524.1|929755_931000_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	5.3e-09
WP_115287309.1|931248_931746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115287310.1|931901_934382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271022.1|934606_934852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271144.1|934823_936539_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_075271020.1|936642_937095_+	DUF4065 domain-containing protein	NA	A0A0N9SGM1	Paenibacillus_phage	44.3	1.2e-22
WP_078086178.1|937429_938458_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.8	3.8e-21
WP_075271147.1|938908_940489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075271017.1|942102_942456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075271016.1|942535_943375_-	cobalamin biosynthesis protein CobQ	NA	E2ELL2	Clostridium_phage	24.5	2.3e-08
WP_013954997.1|945709_946807_+	DNA methyltransferase	NA	M1HGA9	Paramecium_bursaria_Chlorella_virus	31.6	6.5e-27
WP_014829976.1|946788_947730_+	DNA adenine methylase	NA	A0A1W6JN66	Lactococcus_phage	39.9	6.5e-52
WP_013954999.1|947868_948159_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_013456497.1|948162_948846_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_013456054.1|948835_949186_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_013955000.1|949341_950181_-|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	23.7	9.1e-05
WP_013955001.1|950248_953221_+	phosphoglucomutase	NA	NA	NA	NA	NA
WP_013955002.1|953295_955008_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_013456153.1|955052_955919_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013456195.1|955947_956418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013455914.1|956424_957156_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_013456005.1|957157_958042_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_013456285.1|958016_958670_-	3-dehydro-L-gulonate-6-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_013456314.1|958679_959168_-	PTS sugar transporter subunit IIAB	NA	NA	NA	NA	NA
WP_013456143.1|959167_959452_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_013955003.1|959550_961359_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_013455916.1|961410_962472_-	phosphotriesterase	NA	NA	NA	NA	NA
WP_013955004.1|962817_963675_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_013955005.1|963862_964099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013955006.1|964180_965962_+	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	46.6	9.4e-84
WP_013955007.1|966221_966518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013955008.1|966700_967615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014829978.1|967739_968606_-	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_115287311.1|969073_970063_-	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_078086158.1|970182_970389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038582811.1|970601_970811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075270943.1|970795_971695_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	27.6	1.9e-08
WP_075271516.1|971758_973192_+	site-specific DNA-methyltransferase	NA	I7KLR2	Campylobacter_virus	45.2	3.0e-48
WP_013955016.1|973182_973626_+	site-specific DNA-methyltransferase	NA	A0A1B0XVP8	Campylobacter_phage	70.1	6.7e-23
WP_038582814.1|973667_974912_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	5.3e-09
WP_013955020.1|974937_975672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013955021.1|975956_976454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115276534.1|976509_978363_-	glycerol ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013955023.1|978423_979236_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_013955024.1|979225_980221_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013954995.1|980994_982239_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
>prophage 8
NZ_CP022598	Mycoplasma bovis strain NADC70 chromosome, complete genome	1103068	1030478	1084810	1103068	integrase,transposase,tRNA	Staphylococcus_phage(25.0%)	47	1030145:1030196	1060216:1060267
1030145:1030196	attL	ATATTCATTAACAAAGCAAAAAGCACCACAAGTTAACTTGCGGCGCTTTTTG	NA	NA	NA	NA
WP_078086180.1|1030478_1031507_+|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013955061.1|1031717_1032725_+	membrane protein	NA	NA	NA	NA	NA
WP_115276523.1|1033270_1034122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115287313.1|1034256_1035054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115287314.1|1035142_1035490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101456648.1|1035843_1037277_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_115287315.1|1039388_1039655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115276536.1|1039857_1040268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115287316.1|1041044_1041686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115287317.1|1041861_1042542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115287318.1|1042800_1043319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456123.1|1043604_1044354_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_013955063.1|1044752_1046597_+	RNase J family beta-CASP ribonuclease	NA	NA	NA	NA	NA
WP_013955064.1|1046731_1047883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014829996.1|1048072_1050490_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_013955066.1|1050507_1050816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075271049.1|1051113_1052535_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_013955068.1|1052527_1053841_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_013955069.1|1053840_1054146_-|tRNA	glutamyl-tRNA(Gln) amidotransferase	tRNA	NA	NA	NA	NA
WP_013955070.1|1054151_1055006_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_013456616.1|1055017_1055596_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	29.7	1.2e-11
WP_013955071.1|1055585_1056347_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_013456430.1|1056339_1057080_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_013456524.1|1057089_1057404_-	endonuclease	NA	NA	NA	NA	NA
WP_013456382.1|1057577_1058888_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_013456261.1|1058890_1059556_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_014829997.1|1059626_1060088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013955073.1|1060375_1061509_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	32.2	3.0e-27
1060216:1060267	attR	ATATTCATTAACAAAGCAAAAAGCACCACAAGTTAACTTGCGGCGCTTTTTG	NA	NA	NA	NA
WP_013955074.1|1061746_1062088_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_013955075.1|1062261_1063497_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	33.2	3.3e-59
WP_013955076.1|1063507_1064110_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_013456246.1|1064171_1065074_+	DegV domain-containing protein	NA	NA	NA	NA	NA
WP_014829999.1|1065234_1065468_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_013955078.1|1065507_1066230_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_013456073.1|1066229_1067306_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_013955080.1|1067431_1068004_-	cell division protein Fic	NA	NA	NA	NA	NA
WP_013955081.1|1068025_1069447_-	YitT family protein	NA	NA	NA	NA	NA
WP_013954660.1|1070901_1072290_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013955084.1|1072604_1074572_+	type IIA DNA topoisomerase subunit B	NA	G3M9Z3	Bacillus_virus	41.5	8.7e-131
WP_013955085.1|1074694_1075009_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.0	1.7e-12
WP_013955086.1|1075061_1075508_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	37.4	1.8e-12
WP_115276526.1|1075997_1077386_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_115265593.1|1080385_1081375_-	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_038582834.1|1081490_1081700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013456532.1|1081836_1082796_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_013955092.1|1082991_1083387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013955093.1|1083565_1084810_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.3	1.1e-09
