The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031332	Neisseria meningitidis strain M22814 chromosome, complete genome	2190201	53371	103969	2190201	protease,transposase,tRNA	Staphylococcus_phage(57.14%)	47	NA	NA
WP_002216779.1|53371_54424_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_002216777.1|55270_55834_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002212800.1|56695_57031_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002216775.1|57159_58065_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002231880.1|58126_58615_-	lipoprotein	NA	NA	NA	NA	NA
WP_002212796.1|58761_59664_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002216773.1|59704_60835_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002247261.1|61085_63710_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.2	1.2e-79
WP_002216744.1|64999_65965_-|transposase	IS30-like element IS1655 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	8.0e-37
WP_002216764.1|68914_69859_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_002216763.1|69932_70616_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002216762.1|70918_73216_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.4	1.2e-86
WP_002216761.1|73236_74754_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002212784.1|74805_75273_+	response regulator	NA	NA	NA	NA	NA
WP_002216760.1|75376_76129_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002212781.1|77314_77521_-	DUF2788 domain-containing protein	NA	NA	NA	NA	NA
WP_002245656.1|77615_78785_-	O-succinylhomoserine sulfhydrylase	NA	NA	NA	NA	NA
WP_002247262.1|78929_79691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002234140.1|79790_80042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216753.1|80093_80900_+	basic amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002216752.1|81206_82730_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_002216751.1|82827_84240_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_002216749.1|85629_86436_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_002216748.1|86485_87355_-	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_002216746.1|87467_87905_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	53.6	4.2e-38
WP_002217824.1|88567_89533_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	4.7e-37
WP_002216744.1|89875_90841_-|transposase	IS30-like element IS1655 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	8.0e-37
WP_002218363.1|90974_91244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002218140.1|91274_91952_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_002218361.1|92002_92671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002218360.1|92804_93221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002218357.1|94008_94407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079885025.1|94409_94601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002218355.1|94627_95017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002245660.1|95208_95664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002233526.1|95873_96155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002245661.1|96132_96807_-	pretoxin HINT domain protein	NA	NA	NA	NA	NA
WP_002220318.1|96955_97186_-	MafI family immunity protein	NA	NA	NA	NA	NA
WP_002247325.1|97200_98691_-	polymorphic toxin MafB class 1	NA	NA	NA	NA	NA
WP_002245504.1|98841_99240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079885727.1|99242_99488_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_002245503.1|99555_99945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002245502.1|100066_100453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033910277.1|100455_100701_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_002247232.1|100778_101021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002245501.1|101017_102688_-	MafB family polymorphic toxin	NA	NA	NA	NA	NA
WP_002217985.1|103003_103969_+|transposase	IS30-like element IS1655 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	4.7e-37
>prophage 2
NZ_CP031332	Neisseria meningitidis strain M22814 chromosome, complete genome	2190201	1476755	1517860	2190201	protease,transposase,tRNA	Synechococcus_phage(15.38%)	41	NA	NA
WP_002217551.1|1476755_1477595_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_002213936.1|1477809_1478457_+	adenylate kinase	NA	NA	NA	NA	NA
WP_002241369.1|1478982_1479714_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_002241370.1|1479809_1480202_+	DUF2185 domain-containing protein	NA	NA	NA	NA	NA
WP_002241371.1|1480306_1481278_+	ADP-heptose synthase	NA	M4QF80	Synechococcus_phage	29.6	6.6e-15
WP_002217545.1|1481314_1482550_+	DNA (cytosine-5-)-methyltransferase	NA	Q6DMX0	Streptococcus_phage	31.2	2.9e-47
WP_002217543.1|1482551_1483583_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_002217542.1|1483711_1484716_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	33.6	6.6e-26
WP_002245531.1|1484792_1486313_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.0	2.0e-95
WP_002213929.1|1486329_1487340_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	40.9	6.4e-53
WP_002244073.1|1487505_1487994_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_100198967.1|1488061_1488667_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_002217540.1|1488724_1489867_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002244075.1|1489863_1490250_+	type I restriction endonuclease	NA	NA	NA	NA	NA
WP_002218255.1|1490238_1490832_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.7	1.2e-27
WP_162818780.1|1490853_1494045_+	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
WP_002217535.1|1494252_1496517_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.7e-167
WP_002217534.1|1496518_1496821_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_002217533.1|1497063_1497267_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	78.8	3.4e-22
WP_002217529.1|1497563_1498895_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_162467413.1|1499041_1499554_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_002217527.1|1499600_1500314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002217526.1|1500382_1502083_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.6	7.4e-70
WP_002245533.1|1502443_1503805_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.7	1.3e-24
WP_002236499.1|1503951_1504275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002219479.1|1504397_1505351_-	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	47.3	2.1e-45
WP_002245535.1|1506167_1506551_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002245536.1|1507024_1507729_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_002224592.1|1507793_1508360_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	71.1	1.6e-74
WP_002222687.1|1508425_1508842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002217521.1|1508903_1509803_-	recombination-associated protein RdgC	NA	L7TP07	Pseudomonas_virus	35.5	1.5e-45
WP_002217520.1|1509833_1511291_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_002217518.1|1511440_1512070_-	YfgM family protein	NA	NA	NA	NA	NA
WP_002217516.1|1512070_1513366_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014575276.1|1513459_1514116_-	peptidase C39	NA	NA	NA	NA	NA
WP_002217512.1|1514173_1514365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002217511.1|1514397_1514865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002217508.1|1515416_1515836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213898.1|1515893_1516259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213897.1|1516240_1516786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002218140.1|1517182_1517860_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP031332	Neisseria meningitidis strain M22814 chromosome, complete genome	2190201	1559345	1578655	2190201	transposase,capsid,tail,portal	Pseudomonas_phage(21.43%)	23	NA	NA
WP_002220694.1|1559345_1559705_-	hypothetical protein	NA	I6XKT1	Burkholderia_virus	32.6	1.7e-05
WP_002219431.1|1559772_1559973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002220695.1|1560216_1560642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002220696.1|1560744_1561461_-	helix-turn-helix transcriptional regulator	NA	E5AGE6	Erwinia_phage	37.8	1.0e-33
WP_002220698.1|1561860_1562208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002245548.1|1562322_1565169_+	poxvirus D5 -like family protein	NA	A0A0R6PCH4	Moraxella_phage	26.1	7.0e-73
WP_002220700.1|1565185_1565395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220701.1|1565397_1565784_+	DUF3310 domain-containing protein	NA	A0A161C2E9	Gordonia_phage	60.4	4.3e-10
WP_002220702.1|1565770_1566025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002245549.1|1566033_1567596_+|portal	phage portal protein	portal	Q6R4V2	Vibrio_virus	40.3	2.4e-91
WP_002245550.1|1567576_1569469_+|capsid	phage major capsid protein	capsid	Q6R4V3	Vibrio_virus	39.1	9.0e-117
WP_002245551.1|1569526_1569754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002244523.1|1569746_1570049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002245552.1|1570029_1570449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002217468.1|1570480_1571122_+|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	45.1	4.6e-49
WP_002217467.1|1571185_1571497_+	hypothetical protein	NA	A0A0S2SYT8	Pseudomonas_phage	33.7	2.5e-08
WP_002217466.1|1571544_1571817_+	hypothetical protein	NA	A0A0H5ARS5	Pseudomonas_phage	42.3	1.5e-12
WP_002217464.1|1571809_1575028_+|tail	phage tail protein	tail	A0A1V0E821	Vibrio_phage	24.7	2.6e-52
WP_002245553.1|1575057_1576023_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	8.8e-36
WP_002217457.1|1576132_1576402_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002217456.1|1576461_1577184_+|tail	phage minor tail protein L	tail	Q9FZU6	Neisseria_meningitidis_phage	100.0	1.3e-108
WP_002217454.1|1577180_1577936_+	alkaline phosphatase	NA	Q9FZU5	Neisseria_meningitidis_phage	98.8	5.1e-148
WP_002217452.1|1577932_1578655_+|tail	tail assembly protein	tail	Q9FZU4	Neisseria_meningitidis_phage	97.1	4.0e-126
>prophage 4
NZ_CP031332	Neisseria meningitidis strain M22814 chromosome, complete genome	2190201	1659536	1700174	2190201	transposase,tRNA,integrase	Acinetobacter_phage(20.0%)	37	1663147:1663206	1704336:1704491
WP_002217336.1|1659536_1660544_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002217334.1|1660877_1661423_+	N-acetylmuramoyl-L-alanine amidase	NA	U5PZX6	Acinetobacter_phage	50.3	1.8e-38
WP_002217333.1|1661419_1661626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002242606.1|1661655_1661793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002245569.1|1661795_1662032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002247455.1|1662003_1662408_+	hypothetical protein	NA	NA	NA	NA	NA
1663147:1663206	attL	GTATAGTGGATTAACAAAAATCAGGACAAGGCGACGAAGCCGCAGACAGTACAAATAGTA	NA	NA	NA	NA
WP_002217327.1|1663739_1665518_-	adhesin	NA	NA	NA	NA	NA
WP_002217325.1|1668086_1669178_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_002245572.1|1669312_1669861_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002213703.1|1670015_1670387_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_002217322.1|1670681_1672373_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002217321.1|1672897_1676731_+	FAD/FMN-binding oxidoreductase	NA	NA	NA	NA	NA
WP_002217319.1|1676960_1677962_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_002217317.1|1678023_1678206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002245573.1|1678392_1679400_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002245574.1|1679664_1679868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002234829.1|1679879_1680161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002234830.1|1680198_1680402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079885761.1|1680481_1681054_-|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	36.2	6.4e-10
WP_002233797.1|1681946_1682141_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002217311.1|1682164_1682725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050580028.1|1683018_1683525_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	62.8	1.9e-50
WP_002217309.1|1683636_1683975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002241502.1|1683967_1684378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002217306.1|1684382_1685132_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.2	1.2e-51
WP_002221065.1|1685874_1686480_-	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_002245577.1|1688368_1689424_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002213671.1|1689529_1690012_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002217298.1|1690058_1691195_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_002217297.1|1691191_1691737_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_002217296.1|1691733_1693209_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_002213667.1|1693320_1693686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002217295.1|1693706_1695617_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.1	1.8e-56
WP_002213665.1|1695635_1696280_-	DedA family protein	NA	NA	NA	NA	NA
WP_002232366.1|1696443_1697262_-	adhesin Opc	NA	NA	NA	NA	NA
WP_002245573.1|1698568_1699576_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002245579.1|1699487_1700174_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
1704336:1704491	attR	TACTATTTGTACTGTCTGCGGCTTCGTCGCCTTGTCCTGATTTTTGTTAATCCACTATACAGTAGGAAAGGCTGAAAATTTATGCGTAAAGCGTGATATTGTCAACGTTTTTATCAACCGGACGGCGGTGTTAAAAGAAAATTTTGCCGTATCCGA	NA	NA	NA	NA
>prophage 5
NZ_CP031332	Neisseria meningitidis strain M22814 chromosome, complete genome	2190201	1726037	1768111	2190201	transposase,tail,plate,terminase,capsid,integrase	Mannheimia_phage(28.57%)	53	1718358:1718403	1769757:1769802
1718358:1718403	attL	CCGTACTATTTGTACTGTCTGCGGCTTCGTCGCCTTGTCCTGATTT	NA	NA	NA	NA
WP_002245581.1|1726037_1727045_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162818781.1|1726956_1727424_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_002221031.1|1728018_1728732_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002232388.1|1728964_1729216_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002245582.1|1729217_1731191_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0M3LPN5	Mannheimia_phage	41.7	1.2e-116
WP_002217249.1|1731405_1732320_+	ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	42.9	2.0e-58
WP_002217248.1|1732409_1732676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002218403.1|1733181_1733409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002218405.1|1733423_1733942_+	host-nuclease inhibitor protein Gam	NA	F6MIJ0	Haemophilus_phage	47.6	7.1e-32
WP_002217824.1|1734074_1735040_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	4.7e-37
WP_002229440.1|1735185_1735401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002245583.1|1735404_1735653_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002213621.1|1735910_1736096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213617.1|1737057_1737249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213616.1|1737245_1737662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002245584.1|1737838_1738243_+	regulatory protein GemA	NA	L7P7R1	Pseudomonas_phage	41.1	5.3e-19
WP_002245585.1|1738239_1738719_+	membrane protein	NA	A0A0M3VI83	Ralstonia_phage	27.5	2.8e-06
WP_002245586.1|1738881_1739427_+	N-acetylmuramoyl-L-alanine amidase	NA	U5PZX6	Acinetobacter_phage	49.2	1.5e-37
WP_002242606.1|1739626_1739764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002245588.1|1739766_1740003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002245589.1|1739974_1740394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002233783.1|1740413_1740596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215844.1|1740640_1740811_-	YegP family protein	NA	NA	NA	NA	NA
WP_002215845.1|1740823_1741042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002245591.1|1741038_1741377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002222591.1|1741388_1741655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002234862.1|1741651_1741849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002243486.1|1741851_1742358_+	DUF1804 family protein	NA	I6PBD1	Pseudomonas_phage	50.0	2.6e-39
WP_002245593.1|1743177_1744800_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	69.7	3.2e-224
WP_002245595.1|1745260_1746226_-|transposase	IS30-like element IS1655 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.2e-35
WP_002247250.1|1747437_1748763_+|capsid	minor capsid protein	capsid	B7SDN5	Haemophilus_phage	49.9	1.6e-112
WP_002213608.1|1748890_1749307_+	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	48.2	2.4e-30
WP_002245597.1|1749537_1750599_+	hypothetical protein	NA	A0A2D1GNS3	Pseudomonas_phage	43.8	2.5e-60
WP_002213606.1|1750598_1751507_+|tail	tail sheath protein	tail	B7SDP1	Haemophilus_phage	57.3	9.9e-98
WP_002213605.1|1751571_1751970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213604.1|1751969_1752392_+	DUF1320 family protein	NA	A0A2P9JZJ4	Alteromonadaceae_phage	42.5	2.2e-15
WP_002213603.1|1752381_1753032_+	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	38.4	6.8e-32
WP_002213602.1|1753028_1753226_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_033910377.1|1753225_1754638_+|tail	tail sheath protein	tail	B7SDP8	Haemophilus_phage	53.4	1.1e-124
WP_002217235.1|1754702_1755080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002217234.1|1755083_1755449_+	hypothetical protein	NA	F6MIK9	Haemophilus_phage	37.7	5.3e-10
WP_002239789.1|1756438_1758610_+	hypothetical protein	NA	A0A0M3LPB6	Mannheimia_phage	29.8	4.3e-38
WP_002217232.1|1758609_1759941_+	phage morphogeneis protein	NA	A0A0M3LQ21	Mannheimia_phage	35.4	9.5e-65
WP_002217230.1|1761057_1761726_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	52.1	1.8e-59
WP_002217228.1|1761825_1762173_+	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	61.2	9.5e-33
WP_002217226.1|1762186_1763242_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	56.7	5.9e-102
WP_002213590.1|1763238_1763799_+	YmfQ family protein	NA	A0A0M3LQE1	Mannheimia_phage	39.2	3.1e-25
WP_002217224.1|1763809_1765783_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	56.7	4.5e-135
WP_079885772.1|1765779_1766007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213586.1|1766589_1766892_-	BrnA antitoxin family protein	NA	A0A2H4J5Y5	uncultured_Caudovirales_phage	38.8	1.1e-05
WP_002217222.1|1766863_1767151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002217220.1|1767230_1767836_+	hypothetical protein	NA	D0UIH2	Aggregatibacter_phage	41.8	9.2e-15
WP_002217219.1|1767814_1768111_+	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	62.7	8.1e-25
1769757:1769802	attR	CCGTACTATTTGTACTGTCTGCGGCTTCGTCGCCTTGTCCTGATTT	NA	NA	NA	NA
