The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030910	Pseudomonas aeruginosa strain Y31 chromosome, complete genome	6831076	650232	713096	6831076	plate,integrase,tRNA,tail	Pseudomonas_phage(23.33%)	61	645182:645196	681573:681587
645182:645196	attL	TGCGGTGGCAGGGCT	NA	NA	NA	NA
WP_023090301.1|650232_651309_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	38.3	2.8e-46
WP_115759282.1|651528_655266_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	35.4	4.8e-13
WP_003085035.1|655372_657226_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.8	1.2e-36
WP_023910070.1|657305_659300_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.7	3.8e-73
WP_115759283.1|659382_659832_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.8	2.9e-18
WP_003085057.1|659901_660117_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003129196.1|660317_661343_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_003085061.1|661421_661991_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|662074_662428_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003099585.1|662418_662961_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_016252918.1|662933_664166_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_017148719.1|664209_664716_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|664809_666363_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|666359_667631_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|667731_669654_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|669932_670265_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|670308_671160_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|671159_671540_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003161932.1|671576_672383_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003109023.1|672498_673485_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|673481_674774_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_012613530.1|674754_677544_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_010793494.1|677670_678687_+	phosphotransferase	NA	NA	NA	NA	NA
WP_114231335.1|678683_679358_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003099547.1|679359_680118_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_009875782.1|680118_681180_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_033993763.1|681331_683725_+	PAS domain S-box protein	NA	NA	NA	NA	NA
681573:681587	attR	TGCGGTGGCAGGGCT	NA	NA	NA	NA
WP_003099542.1|683773_684403_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_052148737.1|684531_685566_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|685799_686909_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003099539.1|686964_688011_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010793491.1|688124_689372_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_033998967.1|689477_690308_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|690431_691106_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|691105_691924_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085126.1|691996_693475_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003113203.1|693792_694107_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_034037257.1|694206_694977_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	2.3e-71
WP_003085132.1|695434_695635_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003085135.1|695682_696042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118908.1|696404_696854_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003085139.1|696875_697391_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	42.9	4.1e-32
WP_003085141.1|697387_697945_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
WP_003113199.1|698097_698424_+	bacteriophage protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	2.4e-30
WP_003085151.1|698420_699308_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_003118911.1|699300_699834_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	3.9e-62
WP_042931843.1|699835_701941_+|tail	phage tail fiber protein	tail	Q9ZXK6	Pseudomonas_virus	52.7	5.1e-222
WP_062877420.1|701948_702389_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_019681189.1|702431_703592_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.2	2.0e-188
WP_003085175.1|703604_704108_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|704122_704467_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_115759284.1|704636_706874_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_003113194.1|706883_707756_+	hypothetical protein	NA	A0A2H4J875	uncultured_Caudovirales_phage	51.4	2.5e-74
WP_003101635.1|707730_707937_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003113193.1|707994_708984_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	7.5e-107
WP_003113192.1|709016_709646_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	1.6e-86
WP_003121852.1|709642_710005_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	4.2e-15
WP_003118919.1|710001_710259_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_023098405.1|710606_711212_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	6.0e-75
WP_003085203.1|711213_712263_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|712259_713096_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 2
NZ_CP030910	Pseudomonas aeruginosa strain Y31 chromosome, complete genome	6831076	796738	804017	6831076	integrase	Pseudomonas_phage(100.0%)	10	792435:792456	804343:804364
792435:792456	attL	GATCTGGAGCGGGCGAAGGGAA	NA	NA	NA	NA
WP_057386198.1|796738_797029_+	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	90.5	1.3e-48
WP_057386199.1|797032_797410_+	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	98.4	4.0e-61
WP_003115097.1|797544_797979_+	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	98.6	1.2e-61
WP_003115130.1|797995_798088_+	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_003124954.1|798099_798351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023082694.1|798364_798583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115759290.1|799856_800207_+	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	40.2	6.0e-19
WP_057392841.1|800208_801471_+	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	56.9	3.7e-119
WP_003115206.1|801729_803022_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	94.2	2.8e-247
WP_003454974.1|803021_804017_+|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	52.6	3.6e-93
804343:804364	attR	GATCTGGAGCGGGCGAAGGGAA	NA	NA	NA	NA
>prophage 3
NZ_CP030910	Pseudomonas aeruginosa strain Y31 chromosome, complete genome	6831076	883112	935605	6831076	integrase,transposase,protease	Salmonella_phage(22.22%)	48	885048:885063	902251:902266
WP_162830792.1|883112_883418_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_115759312.1|884703_887670_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	96.3	0.0e+00
885048:885063	attL	CGCGGCGGCGCAGCTC	NA	NA	NA	NA
WP_051497089.1|887673_888246_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.2e-59
WP_011078029.1|888471_890130_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.4	5.6e-22
WP_115759313.1|890399_891425_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011078030.1|891720_892971_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	2.2e-47
WP_009397186.1|894129_895560_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_064481792.1|895860_897714_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	51.0	6.5e-104
WP_003085447.1|898155_899058_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003114158.1|899509_900247_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_003098363.1|900326_901370_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003114159.1|901505_902198_-	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
WP_003120794.1|902197_902470_-	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
902251:902266	attR	CGCGGCGGCGCAGCTC	NA	NA	NA	NA
WP_003098357.1|902490_903306_-	DUF4824 family protein	NA	NA	NA	NA	NA
WP_003098356.1|903302_904379_-	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_003098355.1|904611_904791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003114164.1|904886_905342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085479.1|905458_905704_+	DUF1145 domain-containing protein	NA	NA	NA	NA	NA
WP_003098351.1|905826_906015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073654782.1|906018_906933_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004348205.1|907035_909012_+	alkyl/aryl-sulfatase	NA	M1I0S7	Paramecium_bursaria_Chlorella_virus	44.8	2.4e-160
WP_003110820.1|909046_909688_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023104852.1|909803_910448_-	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_003116513.1|910504_911401_-	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003114169.1|911512_912616_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003085498.1|912674_913493_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003085499.1|913558_914722_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_015648163.1|914733_916242_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003106441.1|916374_917256_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003114171.1|917312_918134_+	VanW family protein	NA	NA	NA	NA	NA
WP_003106436.1|918233_918929_+	uracil-DNA glycosylase	NA	A0A0A7D9F8	Equid_alphaherpesvirus	45.2	1.0e-49
WP_003114172.1|919055_920093_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_003116509.1|920085_921603_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_003101933.1|921613_922084_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_003085519.1|922132_923116_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003116508.1|923145_924429_-	OprD family porin	NA	NA	NA	NA	NA
WP_003085524.1|924639_925311_+	response regulator	NA	NA	NA	NA	NA
WP_010793854.1|925303_926686_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003114179.1|926694_927531_-	HDOD domain-containing protein	NA	A0A1C3NFB0	Phage_NCTB	36.6	2.5e-26
WP_003101947.1|927631_928576_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003085532.1|928848_929103_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_003454678.1|929086_929539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003101954.1|929507_931124_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_003085543.1|931532_932114_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_003101958.1|932145_932730_+	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_003101960.1|932738_933689_+	sigma factor AlgU regulatory protein MucB	NA	NA	NA	NA	NA
WP_003110245.1|933685_934141_+	positive regulator for alginate biosynthesis MucC	NA	NA	NA	NA	NA
WP_003101964.1|934180_935605_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	32.0	3.4e-28
>prophage 4
NZ_CP030910	Pseudomonas aeruginosa strain Y31 chromosome, complete genome	6831076	2310790	2319819	6831076		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|2310790_2311426_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_003143263.1|2311471_2312365_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|2312469_2313474_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|2313900_2314224_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003113873.1|2314290_2316858_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003092265.1|2316983_2317991_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|2318138_2318645_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|2318778_2319819_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 5
NZ_CP030910	Pseudomonas aeruginosa strain Y31 chromosome, complete genome	6831076	3550532	3557426	6831076	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_025271136.1|3550532_3551813_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.2	4.1e-97
WP_003113366.1|3551814_3553212_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|3553216_3554191_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003160436.1|3554278_3555262_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	1.6e-141
WP_003119979.1|3555258_3555594_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.5e-38
WP_003090391.1|3555590_3555896_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|3555895_3556255_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_115759569.1|3556251_3556647_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	71.3	4.5e-47
WP_115759571.1|3556757_3557426_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.5	5.1e-91
>prophage 6
NZ_CP030910	Pseudomonas aeruginosa strain Y31 chromosome, complete genome	6831076	5360244	5368937	6831076	integrase,tRNA	Pseudomonas_phage(90.0%)	13	5352666:5352682	5371745:5371761
5352666:5352682	attL	GCCGCTGTTCATCGCCG	NA	NA	NA	NA
WP_003082462.1|5360244_5361069_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	73.7	1.4e-106
WP_012614375.1|5361174_5362191_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	99.7	5.0e-191
WP_115759763.1|5362190_5363489_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	99.5	6.5e-260
WP_058836834.1|5363746_5365009_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	57.0	7.5e-120
WP_003159569.1|5365010_5365361_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	41.1	5.5e-20
WP_003163345.1|5366634_5366853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003124954.1|5366866_5367118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115130.1|5367129_5367222_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_003140508.1|5367238_5367673_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	100.0	3.8e-63
WP_034003557.1|5367875_5368208_-	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	100.0	2.0e-40
WP_079382556.1|5368211_5368499_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	91.5	4.1e-50
WP_034018385.1|5368497_5368716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033977997.1|5368721_5368937_-	hypothetical protein	NA	Q56VP9	Pseudomonas_phage	94.4	8.2e-35
5371745:5371761	attR	GCCGCTGTTCATCGCCG	NA	NA	NA	NA
>prophage 7
NZ_CP030910	Pseudomonas aeruginosa strain Y31 chromosome, complete genome	6831076	5757436	5764718	6831076	integrase	Pseudomonas_phage(87.5%)	10	5756861:5756920	5768779:5768860
5756861:5756920	attL	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGG	NA	NA	NA	NA
WP_016852152.1|5757436_5758438_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	46.5	2.9e-74
WP_019416334.1|5758434_5759727_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	92.0	8.8e-241
WP_057392841.1|5759985_5761248_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	56.9	3.7e-119
WP_115759290.1|5761249_5761600_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	40.2	6.0e-19
WP_023082694.1|5762873_5763092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003124954.1|5763105_5763357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115130.1|5763368_5763461_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_003151275.1|5763477_5763912_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	95.8	4.3e-59
WP_031634253.1|5764046_5764424_-	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	96.8	9.9e-60
WP_023083237.1|5764427_5764718_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	97.9	4.3e-55
5768779:5768860	attR	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGGTTAGCGCAAGCTAACCCCTTTT	NA	NA	NA	NA
