The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	7691	58652	4915452	transposase,protease	Ralstonia_phage(50.0%)	43	NA	NA
WP_011407164.1|7691_8528_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011407165.1|8714_9521_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9797_10991_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011257014.1|11144_11816_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|11900_12662_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12708_13131_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13134_13548_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011407166.1|13843_14611_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14621_14891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407167.1|14965_16426_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|17072_18083_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18354_19557_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19698_21837_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|22047_22341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296734.1|22372_22870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407171.1|23116_24097_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	9.1e-89
WP_011257025.1|24144_25311_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_069959658.1|25457_26024_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_069959660.1|27498_28707_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|29334_30357_-	sugar kinase	NA	NA	NA	NA	NA
WP_069964474.1|31179_32148_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407176.1|32635_33772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|33966_34935_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_113085383.1|35045_35636_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_012443646.1|36237_37614_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	4.1e-79
WP_012443643.1|40626_40869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443642.1|40810_41134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257128.1|41599_42580_-|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
WP_011407184.1|43198_44488_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
WP_011407185.1|44927_45263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407187.1|45537_45969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155296471.1|46130_46283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|46317_47727_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041181902.1|48004_48220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|49044_49305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|49321_49654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080256644.1|49653_50112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258803.1|50519_51488_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011407913.1|51631_52846_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187731.1|53366_54164_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182053.1|55879_56845_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_125168734.1|56841_57120_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_109182054.1|57263_58652_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	124068	170957	4915452	transposase	Ralstonia_phage(14.29%)	34	NA	NA
WP_069959667.1|124068_125019_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	4.4e-96
WP_143699970.1|125132_125342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407230.1|125409_125670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257048.1|125722_126004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959669.1|126142_127201_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.5	4.9e-72
WP_115801863.1|127341_128289_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.4	7.3e-43
WP_011407233.1|128543_128855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|130321_130792_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011257042.1|130961_131654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257041.1|131745_132144_+	host attachment protein	NA	NA	NA	NA	NA
WP_011407237.1|132945_133902_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_044756192.1|133876_134347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756194.1|134538_135792_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_069960122.1|136137_136827_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	3.7e-36
WP_011257145.1|136839_137997_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_011257146.1|138009_139320_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_027703668.1|141195_141447_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_075239626.1|141899_142301_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011407243.1|142324_142555_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011407244.1|142621_143284_-	hemolysin III	NA	NA	NA	NA	NA
WP_011407245.1|143461_145957_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	36.0	1.5e-07
WP_042464339.1|145953_147780_+	ribonuclease H-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407248.1|148268_150413_-	avirulence protein	NA	NA	NA	NA	NA
WP_011407249.1|150603_151761_-	ROK family protein	NA	NA	NA	NA	NA
WP_042464342.1|151933_154522_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257157.1|154532_155318_+	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_042465397.1|155631_156822_-	saccharopine dehydrogenase	NA	NA	NA	NA	NA
WP_011407253.1|157921_158227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042464345.1|158479_159733_-	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.2	1.9e-38
WP_011257161.1|159789_160170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257162.1|160371_164844_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_011257163.1|165038_166520_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_109182058.1|167757_168723_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187801.1|170158_170957_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	218477	360822	4915452	holin,tRNA,transposase	Bacillus_phage(21.43%)	90	NA	NA
WP_012443704.1|218477_220382_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_075239321.1|220642_220822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756221.1|220955_221423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257199.1|221580_222540_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_044756223.1|222524_223142_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011257200.1|223184_223604_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_012443706.1|223856_224762_-	lipid A hydroxylase LpxO	NA	S4VR59	Pandoravirus	39.5	2.6e-37
WP_011257202.1|225010_225895_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011257203.1|225958_226741_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407292.1|226785_227547_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_011257206.1|227710_228040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407293.1|228358_229450_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_011407294.1|229518_231117_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_011407295.1|231281_232526_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_011257210.1|232977_233607_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	3.3e-52
WP_011257211.1|233813_235790_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
WP_011407298.1|237176_237842_-	YceH family protein	NA	NA	NA	NA	NA
WP_011257214.1|238128_239139_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_011257215.1|239135_239867_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_011257216.1|240220_241750_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.0e-46
WP_011407300.1|241859_244892_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257218.1|245190_248229_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257219.1|248393_249446_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_075240491.1|249614_249860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407301.1|249858_250824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257221.1|250823_253484_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_008573820.1|255302_255506_-	YdcH family protein	NA	NA	NA	NA	NA
WP_011257226.1|259146_259791_-	DUF4375 domain-containing protein	NA	NA	NA	NA	NA
WP_011257227.1|259931_260822_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_011407307.1|260949_261432_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257232.1|264467_265001_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_011407313.1|267816_268875_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
WP_011257237.1|269182_270256_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257238.1|271018_272071_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257239.1|272718_273849_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257241.1|275172_275562_+	YchJ family protein	NA	NA	NA	NA	NA
WP_011407316.1|275769_275976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964474.1|276207_277176_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011257243.1|277429_279592_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407318.1|280139_281444_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011407319.1|281503_282106_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011257245.1|282102_284007_+	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407325.1|293326_294142_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_041182297.1|294488_295451_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182012.1|295555_296318_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257253.1|298117_299176_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011257254.1|299186_299477_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257255.1|299466_300129_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_012446379.1|300125_300677_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257257.1|300688_301438_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407332.1|301437_302232_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257259.1|302616_302904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703982.1|302922_303480_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_115801864.1|303497_304463_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_069959685.1|305307_306264_+|transposase	IS30-like element IS1112 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.9e-41
WP_109182012.1|306335_307098_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182062.1|307137_307936_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407338.1|308067_309282_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
WP_109182063.1|309341_310172_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257269.1|310334_311570_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011257271.1|312968_313397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407344.1|313407_313857_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257273.1|313837_314065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407346.1|314372_316127_-	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_109182012.1|317048_317811_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703800.1|317864_318449_-	gluconokinase	NA	NA	NA	NA	NA
WP_011407349.1|318606_319989_+	MFS transporter	NA	NA	NA	NA	NA
WP_044757567.1|319991_322391_+	NdvB protein	NA	NA	NA	NA	NA
WP_011407351.1|322494_325137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257279.1|325884_329334_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011407353.1|329526_330111_-	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011407354.1|330587_331364_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069959686.1|331544_332846_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011257283.1|332848_333208_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_011257284.1|333644_335126_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_109182027.1|335318_336284_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407357.1|337110_339273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042464365.1|339399_341568_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011407359.1|342205_342835_-|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_011407360.1|342837_343269_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011407361.1|343325_343904_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_027703865.1|343999_344752_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_011257292.1|344976_345366_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011257293.1|345479_347153_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_044757204.1|347149_347794_-	sterol-binding protein	NA	NA	NA	NA	NA
WP_011407366.1|351478_351763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115801865.1|352114_352913_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187710.1|352972_353736_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182067.1|357689_358655_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042464374.1|359715_360822_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	771838	808157	4915452	tRNA,transposase	Enterobacteria_phage(36.36%)	32	NA	NA
WP_115801869.1|771838_773158_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407609.1|773473_774658_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_011407610.1|775187_776501_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
WP_011407611.1|776490_777309_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_069959723.1|777531_778473_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011257675.1|778472_779219_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011407612.1|779444_780500_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011407613.1|780555_781443_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407614.1|781439_781997_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
WP_011407615.1|781993_782902_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
WP_011257680.1|783018_784422_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011407616.1|784468_785815_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011407617.1|785948_786680_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_011257683.1|786679_787309_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_011407618.1|787366_789454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446093.1|789450_791100_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_011257686.1|791215_791824_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	31.4	1.8e-23
WP_011257687.1|792374_793019_-	ABC transporter	NA	NA	NA	NA	NA
WP_011257688.1|793015_793942_-	MCE family protein	NA	NA	NA	NA	NA
WP_011257689.1|793944_794787_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	9.1e-13
WP_011407620.1|794872_795985_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257691.1|796154_797414_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_011407621.1|797475_797937_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011257693.1|798079_799774_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011257694.1|799885_800290_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011407623.1|800421_801195_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011257696.1|801205_801673_+	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_011407624.1|801669_802152_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182079.1|802710_804030_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182080.1|804187_805507_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407627.1|805719_806688_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_109182081.1|806837_808157_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	871145	915041	4915452	transposase,protease	Ralstonia_phage(25.0%)	38	NA	NA
WP_069963827.1|871145_872111_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257750.1|872501_873077_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_011407659.1|873189_873699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010368401.1|873797_873992_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011257752.1|874081_875059_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011257753.1|875288_875729_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_011257754.1|876006_876951_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_011407660.1|877033_877777_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
WP_010368407.1|877981_878221_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_011407661.1|878362_879598_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011407662.1|879768_881124_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_011257758.1|881184_882258_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_069959732.1|882254_883214_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_011257760.1|883210_883564_+	type IV fimbriae assembly protein	NA	NA	NA	NA	NA
WP_133261978.1|884266_885049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407665.1|885410_885737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181972.1|885972_887571_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_011257763.1|887716_888613_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_011407667.1|888688_889843_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_069963828.1|890037_892629_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_011407669.1|892951_893089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960159.1|893361_894561_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_011409545.1|895010_895979_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407672.1|896220_898437_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407673.1|898515_899514_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_103057250.1|899623_899806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703870.1|900785_903773_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182786.1|903947_904895_+	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
WP_011407676.1|905394_905931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115801871.1|906001_907390_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182785.1|907664_908627_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	1.5e-43
WP_012446027.1|908760_909321_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011257779.1|909363_909846_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_011407679.1|910008_910485_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257781.1|910895_911795_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011257782.1|912034_912421_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011407680.1|913050_914178_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257784.1|914177_915041_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 7
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	920341	1082144	4915452	integrase,transposase,protease	Ralstonia_phage(22.22%)	116	1014526:1014544	1079255:1079273
WP_011257788.1|920341_921124_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407683.1|921234_922611_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.7e-77
WP_011257791.1|922854_923490_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103057263.1|924116_924650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182079.1|924778_926098_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|926310_927279_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011257793.1|927412_927610_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_011407685.1|927619_928732_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011257795.1|928712_930047_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257796.1|930280_931201_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
WP_011257797.1|931277_932594_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_011257798.1|932866_934246_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011407686.1|934266_934923_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011257800.1|935051_935705_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407687.1|935975_936437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069963917.1|937496_938381_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257806.1|938501_939950_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_011257807.1|940017_940665_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011257808.1|941481_942555_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011407690.1|942885_944448_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_011407691.1|944444_945569_-	threonine dehydratase	NA	NA	NA	NA	NA
WP_011257810.1|945644_945902_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_011257811.1|945885_947607_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257812.1|947650_948652_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011407693.1|949928_951806_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011407694.1|952231_954583_+	biopolymer transporter Tol	NA	NA	NA	NA	NA
WP_011407695.1|954693_955587_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407696.1|955635_958602_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
WP_011257817.1|959216_960365_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011257818.1|960478_961015_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_011407697.1|961211_961694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182067.1|963981_964947_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182120.1|964943_965117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446005.1|965401_965893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257827.1|967572_968829_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011257828.1|968988_969552_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_011257829.1|969918_971277_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_027703752.1|971276_971873_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_011257831.1|972019_972904_+	membrane protein	NA	NA	NA	NA	NA
WP_011257834.1|974885_975500_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257835.1|975582_976569_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|976684_977179_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|977423_979253_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011407704.1|979271_979742_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|980664_981792_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|981892_983275_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_011257842.1|983522_985646_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407706.1|986174_986693_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_115801872.1|987399_988501_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.6e-41
WP_011257570.1|989016_990252_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_103057209.1|990865_991714_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_012445986.1|991845_991986_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_044756431.1|995545_996781_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109182089.1|997763_999083_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182948.1|999828_1000752_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
WP_109182121.1|1001814_1002780_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|1003081_1004659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|1004726_1005490_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1008158_1009127_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011407721.1|1009387_1009849_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011257866.1|1010397_1010640_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_109182012.1|1010633_1011397_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049756327.1|1011429_1012161_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
WP_109182091.1|1013980_1014733_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1014526:1014544	attL	GCGACAGCGGCTACACCGG	NA	NA	NA	NA
WP_109181948.1|1014734_1015700_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257874.1|1015963_1016971_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011257875.1|1017114_1017876_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_012445939.1|1021193_1022486_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1022578_1023205_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|1023329_1024616_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_012445937.1|1024759_1027231_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_002806049.1|1027444_1027717_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_011407728.1|1028548_1030519_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011407729.1|1031224_1032403_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011257886.1|1032399_1033167_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011257887.1|1033179_1033836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257888.1|1033863_1034316_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257889.1|1034324_1035059_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_011257891.1|1035494_1036199_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_041181989.1|1037024_1037654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445927.1|1038545_1038746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082325231.1|1039141_1041865_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.2	2.8e-71
WP_069960070.1|1041932_1044083_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
WP_044757078.1|1044079_1045777_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_115801873.1|1046096_1048304_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	4.5e-19
WP_011257898.1|1048300_1049995_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|1049991_1050255_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_011257899.1|1050316_1050874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182094.1|1050956_1051922_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407739.1|1052020_1052707_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
WP_011257902.1|1052817_1053222_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011407740.1|1053432_1054482_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257904.1|1054502_1055252_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257905.1|1055251_1056001_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257906.1|1056000_1057032_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257907.1|1057049_1057409_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011407742.1|1057433_1057931_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257909.1|1057927_1058173_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011257910.1|1058169_1058616_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257911.1|1059177_1061274_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_011257912.1|1061280_1061601_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011257913.1|1061698_1062292_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_011407744.1|1062393_1062744_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257915.1|1062863_1063397_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011257916.1|1063393_1065346_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257917.1|1065338_1066295_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407746.1|1066300_1067254_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_012445908.1|1067292_1069161_+	membrane protein	NA	NA	NA	NA	NA
WP_011407749.1|1070676_1071192_+	peptide deformylase	NA	NA	NA	NA	NA
WP_103057268.1|1071708_1072467_+	cellulase	NA	NA	NA	NA	NA
WP_041182379.1|1072939_1073686_+	cellulase	NA	NA	NA	NA	NA
WP_011407751.1|1074302_1075904_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_011257570.1|1076892_1078128_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1078956_1079925_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
1079255:1079273	attR	CCGGTGTAGCCGCTGTCGC	NA	NA	NA	NA
WP_075241901.1|1080392_1080743_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_011407756.1|1080824_1082144_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	1120874	1236011	4915452	transposase	Leptospira_phage(14.29%)	97	NA	NA
WP_109182097.1|1120874_1121976_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
WP_011407778.1|1123406_1124030_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_011257965.1|1124053_1124293_+	rubredoxin	NA	NA	NA	NA	NA
WP_011257966.1|1124342_1125224_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011407780.1|1125373_1125823_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_011407781.1|1125973_1126621_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_011257969.1|1126712_1127183_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_011407783.1|1127179_1127770_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_011257971.1|1128378_1128678_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_011407784.1|1128674_1128896_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_011407785.1|1129131_1129674_+	YecA family protein	NA	NA	NA	NA	NA
WP_113175437.1|1129684_1131025_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_162013040.1|1131542_1131701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187736.1|1131732_1132496_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257975.1|1132728_1134054_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_011257976.1|1134252_1134600_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011407789.1|1134596_1137005_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011257978.1|1137183_1138341_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_011257979.1|1138356_1138956_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.8	3.8e-13
WP_011257980.1|1138952_1139348_-	glyoxalase	NA	NA	NA	NA	NA
WP_011257981.1|1139344_1140070_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_011257982.1|1140179_1141040_+	YicC family protein	NA	NA	NA	NA	NA
WP_011257983.1|1141156_1141768_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	30.9	3.1e-10
WP_099051298.1|1141948_1142746_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407791.1|1142894_1143194_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_011257986.1|1143322_1145494_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011257987.1|1145573_1145954_+	RidA family protein	NA	NA	NA	NA	NA
WP_069960167.1|1145974_1148128_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_069959742.1|1148253_1149192_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_005911911.1|1149263_1149506_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011407793.1|1149719_1151009_+	citrate synthase	NA	NA	NA	NA	NA
WP_115801874.1|1151177_1152497_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407794.1|1152861_1153512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257992.1|1153821_1156251_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_011407795.1|1156466_1157525_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257994.1|1157524_1158283_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011257995.1|1158279_1158945_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_011257996.1|1158941_1159475_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011407796.1|1159494_1161444_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_094187763.1|1161514_1162313_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115801875.1|1162455_1163691_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_082323365.1|1163761_1164796_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	41.7	1.1e-65
WP_069963832.1|1165418_1166438_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_069959745.1|1166458_1167421_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407801.1|1167423_1167885_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_011407802.1|1167881_1168889_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_069959746.1|1168885_1170688_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011407804.1|1170684_1172442_+	membrane protein	NA	NA	NA	NA	NA
WP_033013273.1|1172737_1173055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182384.1|1173303_1174533_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011258007.1|1174752_1176753_+	transketolase	NA	NA	NA	NA	NA
WP_011258009.1|1177571_1178288_-	M23 family metallopeptidase	NA	A0A0M5M794	Arthrobacter_phage	34.2	2.7e-05
WP_011407808.1|1178290_1179283_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_042464574.1|1179602_1182317_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407810.1|1182436_1183612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464577.1|1183746_1185705_-	acetyl-CoA hydrolase	NA	NA	NA	NA	NA
WP_069960293.1|1185880_1186528_+	thermostable hemolysin	NA	NA	NA	NA	NA
WP_011407813.1|1186524_1188024_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_011407814.1|1188020_1188695_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_011407815.1|1188694_1189534_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407818.1|1190200_1190899_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	9.8e-29
WP_041182938.1|1190916_1192278_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011407820.1|1192377_1192743_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_069959749.1|1192732_1194049_+	TonB family protein	NA	NA	NA	NA	NA
WP_011407822.1|1194045_1194630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407823.1|1194972_1195587_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-19
WP_011258026.1|1195586_1196279_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_069959750.1|1196289_1197066_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011258028.1|1197136_1197967_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_069959751.1|1197980_1198754_-	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_153296750.1|1201827_1201968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407830.1|1202624_1203626_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_109181946.1|1204013_1204776_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115801876.1|1204865_1205831_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027704076.1|1205940_1207260_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011407833.1|1207722_1208400_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704066.1|1208479_1208869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407835.1|1209082_1209970_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
WP_113081219.1|1210403_1211388_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	6.3e-98
WP_011407838.1|1211563_1213651_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011407839.1|1213802_1214462_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_094187758.1|1214542_1215340_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407841.1|1215362_1215542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258045.1|1215560_1215965_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258046.1|1215998_1216358_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258047.1|1216601_1217474_-	ion transporter	NA	NA	NA	NA	NA
WP_115801877.1|1217546_1218773_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	8.9e-17
WP_011407842.1|1219018_1219636_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_042464589.1|1221172_1222780_+	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_011258050.1|1222776_1223202_+	cytochrome c	NA	NA	NA	NA	NA
WP_011407846.1|1223226_1223730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407850.1|1225172_1225622_+	azurin	NA	NA	NA	NA	NA
WP_027703881.1|1229024_1230314_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_011407854.1|1230599_1233779_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258055.1|1234275_1235145_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
WP_011258056.1|1235166_1235838_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_012444927.1|1235834_1236011_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	1450994	1591491	4915452	tRNA,transposase	Ralstonia_phage(16.67%)	108	NA	NA
WP_115801880.1|1450994_1451960_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027703294.1|1452311_1453016_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005926176.1|1453553_1453778_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_069964506.1|1453777_1455850_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_024712563.1|1456081_1456939_+	pirin family protein	NA	NA	NA	NA	NA
WP_082323430.1|1457962_1460362_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	4.6e-41
WP_011258248.1|1460358_1461306_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_158645225.1|1461521_1461905_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_041182394.1|1462299_1462848_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_075245366.1|1463242_1463800_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407990.1|1463849_1465958_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_069959782.1|1465979_1467881_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.2e-30
WP_027704078.1|1467935_1468796_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_075251795.1|1468864_1469443_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258251.1|1469906_1470140_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407994.1|1470360_1470927_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407995.1|1471129_1471717_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_162013049.1|1472069_1472504_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_069959784.1|1472500_1474909_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011407999.1|1475253_1475715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408000.1|1475961_1476852_-	pirin family protein	NA	NA	NA	NA	NA
WP_012444354.1|1477619_1478333_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_011258259.1|1478436_1479186_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_042465485.1|1479546_1479798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408003.1|1480130_1482188_+	M13 family peptidase	NA	A0A1V0SHG2	Klosneuvirus	28.6	1.2e-79
WP_069960076.1|1484135_1485257_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_012444362.1|1485271_1486078_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_069959785.1|1486082_1487366_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011408007.1|1487392_1487908_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_069959786.1|1487918_1490075_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
WP_011408009.1|1490142_1492140_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|1492158_1492488_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_125168745.1|1492527_1492746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756996.1|1492977_1496442_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_011258270.1|1496844_1497387_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408011.1|1497798_1498707_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_094187763.1|1499052_1499851_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042464653.1|1499994_1500714_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_109181900.1|1500869_1501904_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258276.1|1501924_1502737_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408014.1|1503472_1503856_+	membrane protein	NA	NA	NA	NA	NA
WP_011408015.1|1504005_1505175_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
WP_011408016.1|1505169_1506228_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.1e-71
WP_011408017.1|1506288_1507101_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408018.1|1507616_1508000_+	membrane protein	NA	NA	NA	NA	NA
WP_011408019.1|1508131_1509295_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
WP_011408020.1|1509325_1510138_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408021.1|1510368_1510956_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_011407237.1|1511254_1512211_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_075242217.1|1512284_1513016_+	nitrilase	NA	NA	NA	NA	NA
WP_069960180.1|1513037_1514141_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_011258289.1|1514209_1515613_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408024.1|1515626_1516133_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408025.1|1516538_1516997_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|1517774_1517978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258293.1|1519539_1520025_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|1520252_1520468_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_011408030.1|1520718_1521198_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011408031.1|1521329_1521758_-	cytochrome c	NA	NA	NA	NA	NA
WP_011258297.1|1521830_1522661_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_011408032.1|1522722_1523490_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011258299.1|1523489_1523705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408033.1|1523850_1524642_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_027704134.1|1524787_1525963_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_027704133.1|1528196_1528835_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011258305.1|1529010_1530951_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_011258306.1|1531167_1531722_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011408037.1|1531943_1533374_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_012444398.1|1533476_1534895_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	3.3e-47
WP_011258309.1|1535311_1536037_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_094187725.1|1536135_1536546_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_113175329.1|1536597_1537569_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.1	4.6e-32
WP_012444404.1|1537795_1540177_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258314.1|1542805_1543216_+	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_011408042.1|1543515_1543698_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258316.1|1543830_1544871_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_113085368.1|1544943_1546389_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_044756984.1|1546515_1547814_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_012444410.1|1548070_1548616_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_075242211.1|1548612_1550076_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011258323.1|1551536_1551791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075242210.1|1552193_1552727_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_014502654.1|1552752_1553154_+	membrane protein	NA	NA	NA	NA	NA
WP_011258326.1|1553502_1553745_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_069964510.1|1555109_1557014_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_012444418.1|1557277_1559674_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_059317478.1|1559823_1560546_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_069959788.1|1560733_1561681_-	DMT family transporter	NA	NA	NA	NA	NA
WP_059317476.1|1563496_1563997_+	RraA family protein	NA	NA	NA	NA	NA
WP_059317475.1|1563938_1565615_+	serine hydrolase	NA	NA	NA	NA	NA
WP_011258336.1|1565761_1567027_+	potassium transporter	NA	NA	NA	NA	NA
WP_011408056.1|1567085_1568279_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	5.2e-22
WP_011408057.1|1568275_1568965_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_069960078.1|1569070_1570540_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011258340.1|1570559_1571396_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011258341.1|1571421_1572525_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_044756980.1|1572521_1575578_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_069960188.1|1575643_1576234_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_069959790.1|1576365_1578198_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_094187715.1|1578273_1579037_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181904.1|1579079_1580399_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408063.1|1581696_1586187_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_125168746.1|1586183_1586675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258803.1|1586726_1587695_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_125168747.1|1587843_1588143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168748.1|1588139_1588469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408064.1|1589984_1590353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|1590522_1591491_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 10
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	1719080	1784935	4915452	tRNA,transposase	Bacillus_phage(20.0%)	42	NA	NA
WP_011257310.1|1719080_1720316_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|1720366_1721130_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115801884.1|1721196_1722573_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	8.1e-59
WP_008578058.1|1722951_1723626_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_011408164.1|1724256_1724661_-	response regulator	NA	NA	NA	NA	NA
WP_011408165.1|1724739_1725237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959808.1|1725375_1727172_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	2.6e-81
WP_011408166.1|1727728_1728274_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_069959809.1|1728375_1732497_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
WP_011408167.1|1732717_1735360_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182063.1|1736801_1738316_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_094187782.1|1738486_1739249_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408171.1|1739560_1740073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408172.1|1740135_1741254_-	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_011408173.1|1741250_1741529_-	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_011408174.1|1741525_1742278_-	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_011258497.1|1742274_1743174_-	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_002812057.1|1743257_1743338_-	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_042464698.1|1743627_1745814_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_115801918.1|1746103_1747546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756949.1|1747878_1749981_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_069959810.1|1750222_1752667_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_011408178.1|1752680_1753205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408179.1|1753404_1755432_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	4.6e-95
WP_011408180.1|1755445_1756165_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011258505.1|1756161_1757076_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	48.5	1.2e-63
WP_011258506.1|1757370_1758246_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_044756943.1|1758242_1759193_-	glutathione synthase	NA	NA	NA	NA	NA
WP_005913706.1|1759442_1759844_+	response regulator	NA	NA	NA	NA	NA
WP_011258508.1|1759861_1760224_+	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
WP_003482487.1|1760223_1760754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258510.1|1760793_1762830_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
WP_069963843.1|1762943_1769870_+	response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
WP_011408184.1|1769877_1771080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258512.1|1771113_1771590_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_113085458.1|1771840_1772464_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408185.1|1772475_1773558_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258518.1|1778179_1779244_+	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_011258519.1|1779240_1779972_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011408189.1|1779996_1781955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258521.1|1782096_1783200_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_011408191.1|1783699_1784935_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	1893071	1952469	4915452	transposase,protease	Tupanvirus(18.18%)	52	NA	NA
WP_011408249.1|1893071_1894658_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	6.5e-28
WP_041182078.1|1894838_1896629_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.5	3.5e-22
WP_011258600.1|1896735_1897536_+	signal peptidase I	NA	NA	NA	NA	NA
WP_011258601.1|1897566_1897944_+	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011258602.1|1897933_1898614_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.4	1.7e-17
WP_011258603.1|1898610_1899510_+	GTPase Era	NA	NA	NA	NA	NA
WP_011258604.1|1899733_1900456_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011408250.1|1900604_1901327_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_113085401.1|1901485_1902820_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	27.0	2.2e-29
WP_011258607.1|1902994_1903492_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_011257310.1|1903587_1904823_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011408252.1|1905051_1906428_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_041182416.1|1906547_1907231_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_011408254.1|1907247_1908282_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011408255.1|1908462_1910040_+	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	25.6	2.2e-44
WP_011408256.1|1910157_1911162_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_011408257.1|1911161_1911716_+	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011408258.1|1911801_1912554_+	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_003488188.1|1912640_1912847_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_014504008.1|1914357_1915002_-	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_011408263.1|1914991_1917493_-	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_011408264.1|1917489_1919094_-	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	36.6	4.9e-15
WP_011258619.1|1919090_1919324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408265.1|1919320_1920343_-	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_011258621.1|1920679_1921045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408267.1|1921041_1921632_-	cell shape determination protein CcmA	NA	NA	NA	NA	NA
WP_011408268.1|1921729_1923439_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	2.1e-16
WP_011258624.1|1923547_1923874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408269.1|1924103_1924448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408270.1|1924570_1925746_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011258626.1|1925901_1928730_+|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011258627.1|1928790_1929891_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_041182081.1|1930359_1930887_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258629.1|1931288_1931462_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011258630.1|1931622_1931877_-	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258631.1|1932051_1932318_+	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_041182418.1|1932508_1933075_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_109182117.1|1934562_1935882_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258635.1|1936274_1936460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445232.1|1936649_1938026_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_011408277.1|1938165_1938639_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408279.1|1940310_1941360_-	cation transporter	NA	NA	NA	NA	NA
WP_011408280.1|1941474_1941810_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_075239156.1|1942098_1942389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408282.1|1943279_1944398_-	alkene reductase	NA	NA	NA	NA	NA
WP_011258642.1|1944618_1945830_+	MFS transporter	NA	NA	NA	NA	NA
WP_011258643.1|1947752_1948208_+	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_011408284.1|1948481_1949084_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011258645.1|1949119_1949728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258646.1|1949787_1949982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408285.1|1950051_1951422_+	virulence factor family protein	NA	NA	NA	NA	NA
WP_109181916.1|1951706_1952469_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	1968511	2027615	4915452	coat,tRNA,transposase,protease	Acidithiobacillus_phage(25.0%)	44	NA	NA
WP_011258663.1|1968511_1970596_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408302.1|1970820_1971270_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_011408304.1|1972033_1973092_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408305.1|1973362_1974760_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_011408306.1|1974756_1975734_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_069959816.1|1975915_1977853_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258669.1|1978273_1979050_-	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258670.1|1979054_1979729_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_082323429.1|1981359_1982736_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.0e-78
WP_011408311.1|1982775_1983171_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_069959817.1|1983213_1984689_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.5	2.2e-102
WP_011408313.1|1985487_1985904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256646.1|1985917_1986088_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_011258676.1|1989782_1990346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445197.1|1990818_1992162_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_011408316.1|1992302_1992905_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408317.1|1992978_1993425_+	membrane protein	NA	NA	NA	NA	NA
WP_012445196.1|1993502_1993769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756910.1|1995870_1997283_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011258682.1|1997279_1998017_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
WP_069959819.1|1998016_2000197_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258685.1|2001036_2001996_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_011408321.1|2002171_2005762_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
WP_011408322.1|2006219_2006960_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
WP_027703356.1|2006956_2008213_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011258689.1|2008251_2009043_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|2009066_2009528_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_069959820.1|2009524_2010538_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_012445188.1|2010937_2013304_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_011408324.1|2013387_2014734_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011258694.1|2014760_2015951_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_011258695.1|2015953_2016781_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027703358.1|2016777_2017539_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258697.1|2017556_2018114_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011258698.1|2018294_2019017_-	UMP kinase	NA	NA	NA	NA	NA
WP_011408325.1|2019073_2019451_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258700.1|2019578_2020457_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011258701.1|2020626_2021430_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011408326.1|2021805_2022531_-	molecular chaperone	NA	NA	NA	NA	NA
WP_041182086.1|2022533_2022866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258703.1|2022912_2023947_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_011258704.1|2023943_2026295_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011408330.1|2026311_2027082_-	molecular chaperone	NA	NA	NA	NA	NA
WP_011408331.1|2027090_2027615_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 13
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	2078766	2205641	4915452	tRNA,transposase	Ralstonia_phage(20.0%)	93	NA	NA
WP_115801887.1|2078766_2080086_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408358.1|2080420_2081347_-	TolC family protein	NA	NA	NA	NA	NA
WP_011258748.1|2081476_2082082_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408359.1|2082420_2084190_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
WP_069960082.1|2084186_2084789_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	1.1e-15
WP_011258751.1|2085047_2085641_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
WP_011258752.1|2085839_2087276_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
WP_011258753.1|2087517_2088720_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_011258754.1|2088762_2091591_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_011408361.1|2091771_2092704_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408362.1|2092700_2094200_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_041182090.1|2094537_2094801_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011258758.1|2095080_2095581_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_011258759.1|2095822_2097190_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_094187715.1|2100212_2100975_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069963920.1|2102427_2103831_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_027703710.1|2103953_2104376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445134.1|2105008_2105839_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_069963848.1|2105848_2106835_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011258772.1|2106831_2107707_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_014502778.1|2107703_2108066_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042464800.1|2108068_2108317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408372.1|2108452_2109010_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_027703707.1|2109101_2110067_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408374.1|2110092_2111442_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
WP_011258777.1|2111434_2111671_+	protein SlyX	NA	NA	NA	NA	NA
WP_011258778.1|2111671_2112424_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_042464805.1|2112757_2113603_+	transporter	NA	NA	NA	NA	NA
WP_041182423.1|2113743_2114919_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011408378.1|2114932_2116243_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011408379.1|2116239_2117226_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011408380.1|2117222_2118428_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_011408381.1|2118814_2121568_-	methionine synthase	NA	NA	NA	NA	NA
WP_011408382.1|2121710_2122850_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
WP_011258786.1|2122846_2123842_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_011408383.1|2123930_2125112_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464808.1|2125111_2125252_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464810.1|2125623_2127069_+	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
WP_012445121.1|2127635_2130164_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	3.1e-64
WP_011258793.1|2131391_2132159_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_011408388.1|2132160_2132508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|2132666_2133635_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109182067.1|2134987_2135953_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2136397_2137582_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011408398.1|2137636_2139112_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
WP_011258799.1|2139433_2139616_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_011258800.1|2139764_2140964_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_069960202.1|2141824_2142793_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_011258803.1|2142984_2143953_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_109181930.1|2144232_2145031_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181931.1|2145256_2146222_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181932.1|2148451_2149417_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2150448_2151417_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181933.1|2152593_2153696_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
WP_027704061.1|2153882_2154350_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_012445101.1|2154710_2155370_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258822.1|2155481_2156831_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_094187763.1|2156980_2157779_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115801888.1|2158218_2159538_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407175.1|2159750_2160719_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_069959827.1|2160770_2161367_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_011258825.1|2161466_2162480_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153296780.1|2163170_2163437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960204.1|2163849_2167365_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_011408408.1|2167588_2167888_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_042464821.1|2167891_2168086_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_082331600.1|2168354_2171957_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_069959830.1|2173508_2174984_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.1	9.2e-101
WP_069959831.1|2175124_2179252_-	avirulence protein	NA	NA	NA	NA	NA
WP_115801889.1|2179540_2180860_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464827.1|2182691_2183777_-	peptidase C13	NA	NA	NA	NA	NA
WP_011408416.1|2184104_2184803_-	acireductone synthase	NA	NA	NA	NA	NA
WP_011408417.1|2184805_2185372_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_011408418.1|2185383_2186061_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_069959832.1|2186149_2187580_-	amino acid permease	NA	NA	NA	NA	NA
WP_033013325.1|2187656_2189129_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258841.1|2189274_2189862_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011258842.1|2190017_2191259_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
WP_011258843.1|2191467_2192886_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011408424.1|2192920_2193220_+	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_011258845.1|2193216_2195088_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_041182103.1|2195377_2196391_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011258848.1|2196390_2196822_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011258849.1|2196818_2197421_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_011408426.1|2197413_2199351_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011258851.1|2199519_2199990_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011258852.1|2199986_2200157_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011408427.1|2200153_2200906_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_011258853.1|2201000_2201696_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_011408428.1|2201692_2202337_-	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
WP_011408429.1|2202563_2203712_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011408430.1|2203851_2204655_+	amidohydrolase	NA	NA	NA	NA	NA
WP_109181948.1|2204675_2205641_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	2284191	2355628	4915452	tRNA,transposase	Xanthomonas_phage(73.33%)	55	NA	NA
WP_115801890.1|2284191_2285511_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258923.1|2285738_2286902_-	MFS transporter	NA	NA	NA	NA	NA
WP_069960085.1|2287064_2288021_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	3.4e-40
WP_012444969.1|2288580_2288715_-	aspartate racemase	NA	NA	NA	NA	NA
WP_012444967.1|2288905_2289817_-	DMT family transporter	NA	NA	NA	NA	NA
WP_012444966.1|2289810_2290863_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_011258927.1|2290859_2291915_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_027703856.1|2291920_2292694_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_069960086.1|2292690_2292975_-	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_011258930.1|2293563_2295096_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011408482.1|2296399_2298907_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_011258933.1|2298903_2299872_+	homoserine kinase	NA	NA	NA	NA	NA
WP_024710669.1|2302807_2303122_-	EthD family reductase	NA	NA	NA	NA	NA
WP_011258935.1|2303283_2304588_+	threonine synthase	NA	NA	NA	NA	NA
WP_041182115.1|2304690_2305434_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_012444952.1|2306698_2308111_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
WP_094187798.1|2308616_2309415_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258940.1|2309728_2310055_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258941.1|2310064_2310979_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258942.1|2310975_2312271_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011408488.1|2312267_2313359_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011258944.1|2313355_2314483_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_011258945.1|2314479_2315082_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011258946.1|2315078_2315813_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011258947.1|2315806_2316583_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011258948.1|2316572_2317193_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_069964532.1|2317778_2321633_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408491.1|2321857_2322157_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_042464821.1|2322160_2322355_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011408491.1|2326665_2326965_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_042464821.1|2326968_2327163_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_137455828.1|2327430_2330814_-	avirulence protein	NA	NA	NA	NA	NA
WP_011258951.1|2331265_2332045_-	pectate lyase	NA	NA	NA	NA	NA
WP_075239627.1|2332086_2332185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182117.1|2332938_2333124_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
WP_012444935.1|2333123_2333327_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	70.3	6.1e-16
WP_011258952.1|2333462_2334536_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
WP_011408494.1|2334640_2334940_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
WP_011408495.1|2335303_2335543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057497.1|2335649_2337134_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	1.4e-40
WP_041182119.1|2337135_2337456_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_011408497.1|2337452_2338637_+	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	5.2e-54
WP_080493496.1|2338691_2338862_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	56.0	2.5e-10
WP_075240059.1|2339970_2340231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408511.1|2340717_2340900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144408325.1|2341021_2341321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801891.1|2341402_2342165_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_125168752.1|2342669_2342993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408516.1|2343606_2344119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181945.1|2344250_2345013_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082331601.1|2346234_2350032_+	avirulence protein	NA	NA	NA	NA	NA
WP_042464821.1|2350299_2350494_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011408491.1|2350497_2350797_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_069964534.1|2351020_2354776_+	avirulence protein	NA	NA	NA	NA	NA
WP_109181946.1|2354865_2355628_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	2360817	2413339	4915452	transposase	Staphylococcus_prophage(20.0%)	42	NA	NA
WP_012444927.1|2360817_2360994_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011408520.1|2360990_2361662_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_125168753.1|2362687_2362933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|2362916_2363873_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011257031.1|2364287_2365256_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_041182129.1|2365400_2366366_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182130.1|2366343_2370444_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011408522.1|2370752_2371937_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_041182131.1|2371987_2372887_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
WP_011408524.1|2373053_2373560_+	glyoxalase	NA	NA	NA	NA	NA
WP_011258968.1|2374034_2374667_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011258969.1|2374666_2376523_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011258970.1|2376519_2377938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258971.1|2377961_2378426_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_011258972.1|2378422_2379202_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258973.1|2379493_2380534_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258974.1|2380530_2382300_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258975.1|2382296_2382761_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011408526.1|2382764_2383427_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011408527.1|2383455_2385864_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_109181948.1|2386117_2387083_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258980.1|2388476_2389211_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_010378794.1|2389203_2390445_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014503500.1|2390468_2390921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408531.1|2390871_2391120_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_011408532.1|2391230_2392013_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_012444910.1|2392029_2392239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258983.1|2392242_2394033_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_011258984.1|2394067_2394454_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_011258985.1|2394450_2394846_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_012444907.1|2394905_2395172_-	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_011408533.1|2395115_2395988_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_011258986.1|2396116_2397214_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408534.1|2397649_2399080_+	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258988.1|2399076_2400084_+	glucokinase	NA	NA	NA	NA	NA
WP_011258989.1|2400080_2400800_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011258990.1|2400902_2402819_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011408535.1|2402874_2403534_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_027703995.1|2405160_2405364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258994.1|2406379_2406760_+	response regulator	NA	NA	NA	NA	NA
WP_011408539.1|2406974_2410370_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_069964958.1|2412103_2413339_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	2527019	2575115	4915452	tRNA,transposase	Moumouvirus(16.67%)	44	NA	NA
WP_011408598.1|2527019_2528414_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	7.6e-81
WP_011259080.1|2528415_2528673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408599.1|2528669_2528975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408600.1|2528971_2529298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408603.1|2530024_2530687_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_024744799.1|2530775_2531306_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_011408606.1|2533529_2534801_+	kynureninase	NA	NA	NA	NA	NA
WP_011408607.1|2534972_2536340_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011259089.1|2536643_2538089_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_011259090.1|2538085_2538772_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_011259091.1|2538744_2539764_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011259092.1|2539805_2540366_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_011259093.1|2540386_2541343_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_011408609.1|2541510_2542287_-	NAD kinase	NA	NA	NA	NA	NA
WP_011408610.1|2542770_2544906_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_027703372.1|2544902_2545094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259098.1|2546868_2547375_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259099.1|2547415_2547943_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408612.1|2547939_2548431_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_011408613.1|2548454_2549030_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011259101.1|2549106_2550060_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259102.1|2550148_2551021_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011408616.1|2551017_2551863_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_011408617.1|2551975_2552674_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408618.1|2552837_2553620_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408619.1|2553628_2554009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259107.1|2554005_2554716_+	endonuclease III	NA	NA	NA	NA	NA
WP_011408621.1|2556026_2556575_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_011258802.1|2556746_2557715_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408623.1|2558319_2559555_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_041182144.1|2560118_2560439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259109.1|2560778_2562029_+	porin	NA	NA	NA	NA	NA
WP_011408625.1|2562217_2563237_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.7	1.6e-48
WP_011408626.1|2563424_2564516_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_069959864.1|2564628_2565603_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_069959865.1|2565602_2566472_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259114.1|2566494_2567325_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011408630.1|2567453_2568164_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011259116.1|2568296_2568704_+	RcnB family protein	NA	NA	NA	NA	NA
WP_011259117.1|2568987_2569623_+	ribonuclease T	NA	NA	NA	NA	NA
WP_011408631.1|2569693_2571013_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464912.1|2571249_2572311_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2572361_2573546_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181954.1|2573795_2575115_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	2581834	2652952	4915452	tRNA,transposase,protease	uncultured_Mediterranean_phage(35.71%)	52	NA	NA
WP_011259125.1|2581834_2582980_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_027703908.1|2583049_2584120_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259127.1|2584285_2584717_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259128.1|2584840_2586337_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011259129.1|2586681_2587389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259140.1|2590736_2591858_-	phytase	NA	NA	NA	NA	NA
WP_041182147.1|2594130_2594598_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011259142.1|2594748_2595381_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_094187715.1|2595777_2596540_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259143.1|2596820_2597852_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408648.1|2597858_2599652_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_012444765.1|2599648_2599933_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_027703974.1|2600164_2600662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259147.1|2600708_2601215_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_011259148.1|2601211_2601832_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011408651.1|2602072_2603977_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_109181955.1|2604064_2605122_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_109181956.1|2605219_2606539_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239722.1|2606772_2607930_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_109181957.1|2608206_2609172_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181958.1|2609149_2610625_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
WP_162013043.1|2610660_2610867_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2613164_2614133_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_075245207.1|2614400_2614634_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011259163.1|2616514_2617735_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011259164.1|2618049_2619447_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011408657.1|2619457_2620675_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259166.1|2620674_2621313_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011259167.1|2621383_2622244_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011408658.1|2622240_2623029_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011259169.1|2623039_2624245_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002812972.1|2624263_2624689_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259170.1|2624908_2625541_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259171.1|2625565_2627938_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259172.1|2628095_2629301_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_069959870.1|2629621_2630953_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.1e-41
WP_011408659.1|2630949_2631300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|2631331_2631739_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011259175.1|2631735_2632062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259176.1|2632093_2633470_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
WP_011259177.1|2633706_2637873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959871.1|2637985_2638657_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_113085460.1|2638721_2640650_-	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011259180.1|2640812_2643173_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_069959872.1|2643456_2644425_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011408662.1|2644482_2645604_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_042465566.1|2647031_2647784_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002813418.1|2647864_2648083_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011408664.1|2648363_2650646_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.5	4.3e-174
WP_005914463.1|2650789_2651110_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_011408665.1|2651360_2651819_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011259189.1|2651815_2652952_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 18
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	2748114	2855465	4915452	tRNA,transposase,protease	Ralstonia_phage(10.53%)	91	NA	NA
WP_115801893.1|2748114_2749080_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_082323388.1|2749086_2750232_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407175.1|2750356_2751325_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011408708.1|2751713_2753399_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
WP_075239845.1|2753395_2755132_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	8.2e-16
WP_044756785.1|2755283_2756384_+	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011259267.1|2756432_2756696_+	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011259269.1|2757074_2757185_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_044756783.1|2757405_2758671_+	MFS transporter	NA	NA	NA	NA	NA
WP_044756781.1|2758651_2760565_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_011408714.1|2760932_2762177_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
WP_011408715.1|2762341_2763496_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.8	1.2e-47
WP_011259275.1|2763509_2763770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408716.1|2763769_2764135_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408717.1|2764134_2765430_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_041182650.1|2765553_2766504_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_011259279.1|2767116_2768460_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_011259280.1|2768499_2769600_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_011408722.1|2769605_2770058_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259282.1|2770299_2771541_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_011259283.1|2771612_2772638_-	N-acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_027703614.1|2772950_2773445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444736.1|2773621_2775046_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_011408724.1|2775543_2775981_+	SufE family protein	NA	NA	NA	NA	NA
WP_011259287.1|2775977_2777228_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259288.1|2777295_2778357_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_075242610.1|2778499_2779540_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_011408727.1|2779624_2779912_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_011408728.1|2779908_2781258_+	dihydroorotase	NA	NA	NA	NA	NA
WP_044756777.1|2781257_2782097_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.4e-13
WP_094187715.1|2782995_2783758_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259294.1|2783784_2784048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444728.1|2784419_2784908_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_011408734.1|2785131_2786451_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|2786587_2787556_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_109181979.1|2787755_2789072_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444725.1|2789431_2790613_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_011259303.1|2792201_2793872_+	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
WP_011259304.1|2794088_2794778_-	phytoene synthase	NA	NA	NA	NA	NA
WP_011408736.1|2794806_2795511_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_011259306.1|2795584_2796304_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_027703270.1|2796334_2797672_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_012444720.1|2797691_2798495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002802373.1|2798686_2799253_-	elongation factor P	NA	NA	NA	NA	NA
WP_011408738.1|2799354_2800383_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_113085172.1|2800601_2802719_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011259311.1|2802715_2803645_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011408739.1|2803696_2804461_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_011408740.1|2804579_2805413_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_011259314.1|2805665_2806277_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	69.8	1.1e-79
WP_011259315.1|2806531_2806972_+	ribonuclease	NA	NA	NA	NA	NA
WP_011259316.1|2806968_2807394_+	barstar family protein	NA	NA	NA	NA	NA
WP_027703271.1|2807842_2809738_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.8	1.8e-48
WP_069959885.1|2809827_2811204_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	1.6e-54
WP_011259319.1|2811306_2811867_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.2	1.6e-29
WP_011408741.1|2811964_2813521_-	YdiU family protein	NA	NA	NA	NA	NA
WP_011408742.1|2813804_2814680_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012444709.1|2814880_2815579_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011408744.1|2815749_2815959_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	62.3	2.8e-16
WP_011408745.1|2816228_2816714_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_011259325.1|2816784_2817333_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_011259326.1|2817329_2818511_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012444707.1|2818734_2820804_+	GGDEF and EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011259328.1|2820903_2821782_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_011259329.1|2821879_2822779_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011408747.1|2822866_2823607_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011259331.1|2823766_2824342_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408749.1|2824515_2825487_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_069964544.1|2825520_2826462_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259334.1|2826461_2828339_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_011408751.1|2828476_2830210_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_012444701.1|2830262_2830763_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_011259337.1|2830759_2832247_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_069959886.1|2832271_2833339_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_094187715.1|2833453_2834217_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182164.1|2834300_2835638_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.3e-37
WP_069959887.1|2835933_2837196_-	virulence factor	NA	NA	NA	NA	NA
WP_094187754.1|2837412_2838160_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182165.1|2838476_2840312_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
WP_041182166.1|2840583_2841675_+	ribonuclease D	NA	NA	NA	NA	NA
WP_011259345.1|2842767_2843169_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_015463309.1|2844032_2844212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004541336.1|2844355_2844553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703932.1|2844813_2845104_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011408759.1|2845091_2845370_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_080256628.1|2845854_2846043_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408397.1|2846815_2848000_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181928.1|2848580_2849546_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042465594.1|2854110_2854455_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_011408764.1|2854665_2854992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259352.1|2855024_2855465_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
>prophage 19
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	2862678	2963151	4915452	tRNA,transposase	Bacillus_phage(18.18%)	59	NA	NA
WP_011408766.1|2862678_2864133_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011408767.1|2864556_2865543_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_011259362.1|2865954_2866617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259363.1|2866671_2867157_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011408769.1|2867156_2867675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444677.1|2867769_2868648_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011259366.1|2868644_2869925_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011259367.1|2869940_2870942_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_033013286.1|2871093_2872458_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_041182453.1|2872712_2873123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408774.1|2873278_2874109_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075240820.1|2874428_2875676_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011408777.1|2875821_2877315_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408778.1|2877319_2878906_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408779.1|2878902_2880105_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_115801894.1|2880611_2881931_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408781.1|2882234_2883620_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_011259377.1|2884527_2885907_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_011408783.1|2885906_2887223_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011259379.1|2887305_2888604_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	2.7e-19
WP_011408784.1|2888911_2890192_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_011408785.1|2890497_2890776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259381.1|2890765_2893114_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_011259382.1|2893110_2893956_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_069964545.1|2893962_2895672_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_011259384.1|2896201_2897554_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011408787.1|2897614_2900752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408788.1|2900918_2901773_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
WP_011408789.1|2901943_2903248_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_069959889.1|2903389_2907484_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.1e-55
WP_011259389.1|2907517_2908504_+	response regulator	NA	W8CYM9	Bacillus_phage	26.8	2.8e-05
WP_069959890.1|2908628_2909612_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	1.5e-99
WP_011408792.1|2910060_2915085_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_011408793.1|2915362_2916022_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408794.1|2916036_2917341_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259395.1|2917353_2920524_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_109181969.1|2921499_2922465_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408798.1|2923171_2924167_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_059317461.1|2924327_2926844_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_011259401.1|2926840_2927797_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_069963855.1|2927955_2929698_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_162828856.1|2929875_2931153_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_011258188.1|2931819_2932788_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_069959892.1|2933082_2935428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182891.1|2935445_2936177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801895.1|2936208_2938551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082350371.1|2938575_2938758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408252.1|2938909_2940286_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_069959894.1|2940851_2943194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465604.1|2943218_2943962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325294.1|2943992_2946827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964550.1|2946823_2947753_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069964551.1|2947761_2950524_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.2	1.5e-43
WP_041182637.1|2955408_2955798_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_115801896.1|2957324_2959814_-	avirulence protein	NA	NA	NA	NA	NA
WP_041182637.1|2959853_2960243_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_157724569.1|2960403_2961357_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|2961289_2961604_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_011408815.1|2961831_2963151_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	3090322	3102097	4915452	tRNA	Escherichia_phage(22.22%)	12	NA	NA
WP_011259503.1|3090322_3090622_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
WP_011259504.1|3090664_3090895_-	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259505.1|3091138_3091888_-	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011408881.1|3091892_3092588_-	hypothetical protein	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_012444559.1|3092773_3093073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057240.1|3093460_3093865_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	56.6	1.1e-32
WP_003481884.1|3094590_3094803_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_011259507.1|3094942_3097591_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_012444556.1|3097692_3098181_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011408884.1|3098483_3099518_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_011408885.1|3099690_3100332_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408886.1|3100420_3102097_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 21
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	3142400	3221389	4915452	transposase,plate	Xanthomonas_phage(44.44%)	58	NA	NA
WP_115801897.1|3142400_3143357_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	8.1e-42
WP_011259549.1|3143455_3144568_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_041182180.1|3144564_3145695_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011408908.1|3145816_3146515_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027703449.1|3146511_3147747_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_011259553.1|3147759_3148602_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011259554.1|3148882_3149734_-	chain-length determining protein	NA	NA	NA	NA	NA
WP_027703450.1|3149779_3150913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259555.1|3150909_3151860_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011259556.1|3151856_3153110_-	O-antigen translocase	NA	NA	NA	NA	NA
WP_069959913.1|3153106_3154219_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	28.4	8.3e-30
WP_069959914.1|3154218_3155151_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069959915.1|3155137_3156091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408914.1|3156094_3156766_-	acetyltransferase	NA	NA	NA	NA	NA
WP_011408915.1|3156762_3157194_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_041182464.1|3157588_3158119_+	cytochrome-c oxidase	NA	NA	NA	NA	NA
WP_012444527.1|3158202_3159543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408918.1|3159568_3159961_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_033013216.1|3160403_3161192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408920.1|3161255_3161837_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012444524.1|3161833_3162490_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_011259567.1|3162486_3163812_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	39.2	2.4e-23
WP_011259568.1|3163822_3164581_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_011408923.1|3164577_3164784_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011259569.1|3164780_3165251_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011408924.1|3165314_3167303_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011259571.1|3167299_3167842_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_027703454.1|3167841_3168339_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011408926.1|3168338_3169043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959916.1|3169251_3172971_+	avirulence protein	NA	NA	NA	NA	NA
WP_042464821.1|3173239_3173434_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011408408.1|3173437_3173737_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_069964559.1|3173960_3178412_+	avirulence protein	NA	NA	NA	NA	NA
WP_012444931.1|3178680_3178875_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
WP_011408408.1|3178878_3179178_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_069964560.1|3179401_3183847_+	avirulence protein	NA	NA	NA	NA	NA
WP_069964561.1|3184326_3184920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959918.1|3184909_3186385_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.1	5.4e-101
WP_069964562.1|3186467_3189056_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011259580.1|3189112_3190225_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259581.1|3190349_3190928_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042465046.1|3192414_3194502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959920.1|3194887_3195985_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465048.1|3196401_3199482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033013236.1|3202517_3203225_+	response regulator	NA	NA	NA	NA	NA
WP_011259588.1|3203221_3204214_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259589.1|3204210_3206670_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_011259590.1|3206783_3207764_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408942.1|3207772_3208801_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_109181977.1|3208967_3209765_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181978.1|3209827_3210625_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444504.1|3210685_3211012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964563.1|3211008_3213912_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_011408945.1|3213908_3214631_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011408946.1|3214627_3215275_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_069959923.1|3215271_3218730_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011408948.1|3218733_3220050_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_011408949.1|3220051_3221389_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 22
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	3230352	3296040	4915452	transposase,plate	Ralstonia_phage(83.33%)	51	NA	NA
WP_113085480.1|3230352_3231363_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011259602.1|3231326_3233204_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259603.1|3233207_3233711_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011259604.1|3233698_3234532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259605.1|3234567_3235071_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_027703472.1|3235170_3236685_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_024711387.1|3236677_3237184_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011257031.1|3238542_3239511_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_115801898.1|3239646_3240966_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260830.1|3241136_3242372_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3242557_3243526_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408960.1|3243577_3245494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113085419.1|3245518_3246256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408961.1|3246286_3248629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465640.1|3248646_3249393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465052.1|3249421_3252256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465054.1|3252913_3254743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445381.1|3254756_3255356_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_012445382.1|3255443_3255800_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_012445383.1|3255796_3256219_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_012445384.1|3256234_3256468_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_069964565.1|3256494_3256755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115801899.1|3257103_3258888_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_027704269.1|3258920_3259907_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_042465057.1|3260317_3264031_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_012445389.1|3265424_3266072_-	response regulator	NA	NA	NA	NA	NA
WP_011408973.1|3266293_3267055_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011257031.1|3267212_3268181_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011408974.1|3268314_3268680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408975.1|3268738_3269170_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011259625.1|3269181_3270444_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408976.1|3270427_3271720_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011408977.1|3272089_3272860_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011259629.1|3273616_3274852_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011408979.1|3276151_3276409_-	stress-induced protein	NA	NA	NA	NA	NA
WP_011408980.1|3276848_3277832_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011258802.1|3278147_3279116_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407489.1|3279252_3280572_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408981.1|3280721_3281684_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_153296740.1|3281933_3282092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182195.1|3282123_3282303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|3282667_3283633_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408985.1|3284840_3285818_+	siroheme synthase	NA	NA	NA	NA	NA
WP_042465070.1|3286626_3286821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408987.1|3288214_3288577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408988.1|3288560_3289130_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_011259640.1|3289167_3290421_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011408989.1|3290626_3291004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|3291561_3292527_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408991.1|3292932_3294168_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|3295005_3296040_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 23
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	3437151	3565302	4915452	integrase,tRNA,transposase,protease	Ralstonia_phage(14.29%)	99	3538612:3538671	3558240:3559051
WP_094187736.1|3437151_3437915_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259756.1|3438938_3441305_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011409066.1|3441301_3441976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259758.1|3442185_3443124_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_044756626.1|3443246_3444596_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259760.1|3444592_3445480_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011409067.1|3445797_3446604_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_044756624.1|3447049_3448267_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011409068.1|3448372_3449341_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
WP_011259764.1|3449739_3450408_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_011259765.1|3450404_3451178_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_075241401.1|3451751_3453704_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|3454384_3455410_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409070.1|3455494_3456568_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259771.1|3456560_3457664_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_069964573.1|3457674_3458601_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_069959940.1|3458681_3459332_+	SCO family protein	NA	NA	NA	NA	NA
WP_069964574.1|3459328_3460177_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_069959942.1|3460727_3462311_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_103073413.1|3462497_3462953_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	43.6	5.4e-12
WP_011409074.1|3463021_3463489_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_103057205.1|3463733_3464951_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_153296738.1|3464911_3465199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960098.1|3465309_3465816_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_044756621.1|3465937_3467338_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_011409077.1|3467600_3468176_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011409078.1|3468172_3468607_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259783.1|3469459_3469645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|3469679_3470249_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259785.1|3470341_3471193_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259787.1|3472580_3474596_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445555.1|3474866_3475565_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409081.1|3475605_3476013_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_011409082.1|3476450_3477413_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409084.1|3478696_3479947_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011409085.1|3479954_3481199_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011259794.1|3481426_3481906_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027704197.1|3482016_3482553_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259796.1|3482662_3483412_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_011259797.1|3483619_3484111_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011409088.1|3485224_3486544_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_069963877.1|3486687_3488394_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011409090.1|3488427_3489732_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259802.1|3489763_3490024_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011409091.1|3490025_3490901_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027704198.1|3492735_3493200_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|3493251_3493440_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_069963878.1|3493412_3493733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465665.1|3493729_3495097_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011409095.1|3495242_3495824_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_011259808.1|3496080_3497526_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_115801900.1|3498372_3502293_-	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_011259814.1|3502426_3503926_-	ribonuclease G	NA	NA	NA	NA	NA
WP_011409098.1|3503925_3504498_-	Maf-like protein	NA	NA	NA	NA	NA
WP_011409099.1|3504636_3505371_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_011409100.1|3505842_3508956_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409102.1|3510374_3510845_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_012445580.1|3511429_3511609_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_011259821.1|3511934_3513050_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_011259822.1|3513061_3513478_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_011409104.1|3513534_3514434_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259823.1|3514430_3515459_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_011409105.1|3515481_3516117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259825.1|3516630_3519273_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_011259826.1|3519345_3519957_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011409107.1|3520161_3521019_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011409108.1|3521274_3521724_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_109181928.1|3522023_3522989_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3523113_3523876_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704065.1|3524486_3524780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259829.1|3525253_3525487_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_011409111.1|3525520_3526534_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259831.1|3526501_3526693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801901.1|3526783_3528103_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182217.1|3528190_3529405_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_011259834.1|3529550_3530078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182722.1|3530074_3531040_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187771.1|3531280_3532043_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409116.1|3532345_3534478_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011258529.1|3535028_3535998_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011258803.1|3536158_3537127_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_162828857.1|3538241_3538616_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
3538612:3538671	attL	GTTAACACATCCGAAGCCCATCAACGACCAGAACGAAGCTGAGGAAGCCAAGGAACATGA	NA	NA	NA	NA
WP_094187715.1|3538612_3539376_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187763.1|3540247_3541045_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409118.1|3541078_3541471_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_027704094.1|3541561_3541954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239728.1|3544292_3544712_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
WP_012445601.1|3546428_3548213_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_011259851.1|3548403_3548604_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011409125.1|3549139_3549934_+	thiazole synthase	NA	NA	NA	NA	NA
WP_011259853.1|3550235_3550994_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011259854.1|3551069_3552932_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_011409127.1|3552989_3553331_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259856.1|3553590_3553866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409129.1|3556912_3557626_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_012445603.1|3557686_3558109_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_094187715.1|3558240_3559004_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409134.1|3562077_3562989_-	RNA methyltransferase	NA	NA	NA	NA	NA
3558240:3559051	attR	GTTAACACATCCGAAGCCCATCAACGACCAGAACGAAGCTGAGGAAGCCAAGGAACATGACATCCAGCTTCTCGAAGCGCGTGAAAATCCGTCGGTAGCCCTTCAAGCGACGGAACAGCCTCTCCACTTCGTTGCGCCGCTTGTACATTTCCTTGTCGTACTCCCAAGGATCGACCCGATTGGACTTGGGTGGAACCACCGGCACGAAGCCAAGATCGAGCGCCAACTGGCGGGTTTCATTGCCTTCGTAAGCGCGATCCATCAGCAGATGAACCGGCCGCTCCACTGGCCCCAGGTGTTCAAGCAACGCGCGGCCTGCGGGTGCGTCATGTGCGTTGCCAGGCGTCAATCCGAACGTGATGGCTGTTCGAGCATCTGCGGCAACCATATGAATTTTGGTGTTCCATCCGCCGCGCGATTTCCCGATGGATTGTGGGCCGTTTTTTTTAATGCGCCAGTGCCATCCGGATGCACCTTGATGCTGGTGGAGTCCAGCGAGACCGCTTCGATTTTGATGCGCACGATCTGGCAGGTCTGCAATTGGGCGAACATCCGGTCCAGCACACCGGACTTGGCCCAACGGTTAATGCGCGTGTACACCGTATGCCAGTTGCCAAAGCGCTCGGGCAGACCGCGCCATTTGCAGCCATGCTCTGCGACGTAAAGAAGGGCGTTGACTACCTGCAGGTTGGTCATGCTGACATTGCCGCGTTGCAAAGGTAGGCAATGCTCGATGAGTGCAAATTGTGCTGGCGTGATCTCCATGCCCAATAGTTTAATCGCTCGAGACATTAATGTTAACAGGCCCTAGC	NA	NA	NA	NA
WP_115801902.1|3564336_3565302_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	3612752	3690463	4915452	transposase,plate	Ralstonia_phage(15.38%)	52	NA	NA
WP_011407175.1|3612752_3613721_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407587.1|3614741_3615776_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011259895.1|3616159_3616885_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409154.1|3617016_3617478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704153.1|3620924_3623045_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_027704154.1|3623311_3624157_-	transporter	NA	NA	NA	NA	NA
WP_011257031.1|3625148_3626117_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011259903.1|3626441_3628412_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_011259904.1|3628840_3630238_+	endoproteinase ArgC	NA	NA	NA	NA	NA
WP_027704156.1|3630350_3631169_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011259907.1|3631479_3634731_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	6.1e-81
WP_011259908.1|3634912_3636331_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_011259909.1|3636340_3636991_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011409164.1|3636992_3637598_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
WP_011259911.1|3637747_3637969_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409165.1|3637978_3638404_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
WP_094187763.1|3638895_3639693_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409167.1|3640770_3641550_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409168.1|3641764_3642394_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027704159.1|3642454_3643210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069963882.1|3643538_3644315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182229.1|3644723_3646298_+	protein kinase	NA	NA	NA	NA	NA
WP_011409172.1|3646546_3646813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964578.1|3647091_3650271_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.3	4.6e-73
WP_069963885.1|3650270_3650945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959956.1|3650944_3651691_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_075242182.1|3651687_3653199_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_011409179.1|3653191_3653626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182476.1|3653636_3655166_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	29.3	2.5e-45
WP_011409181.1|3655468_3656461_-	restriction endonuclease	NA	A0A1B1IUE7	uncultured_Mediterranean_phage	29.2	1.5e-30
WP_044756557.1|3656513_3656822_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_069959957.1|3657402_3660876_+	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	22.4	1.5e-08
WP_069964580.1|3661015_3662014_+	Abi family protein	NA	NA	NA	NA	NA
WP_069964581.1|3662060_3663605_+	type I restriction-modification system subunit M	NA	A0A220A2U5	Liberibacter_phage	23.9	2.0e-13
WP_069964642.1|3663585_3665064_+	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011259929.1|3665097_3665406_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011259930.1|3665412_3665676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082323166.1|3666398_3667154_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_069964582.1|3667447_3668464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082331605.1|3668475_3670419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964583.1|3670330_3671356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082331606.1|3671359_3673303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959964.1|3673214_3674231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082331622.1|3674239_3676255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959960.1|3676739_3677771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964585.1|3677779_3680638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465165.1|3680656_3681502_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_115801903.1|3681503_3684281_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.2	5.1e-44
WP_011259938.1|3684373_3684727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259939.1|3684757_3687487_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_011259940.1|3687572_3688664_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_069959967.1|3688627_3690463_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 25
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	4109764	4203177	4915452	transposase	Ralstonia_phage(17.65%)	60	NA	NA
WP_115801919.1|4109764_4111372_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075242322.1|4111533_4111797_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_075242321.1|4111801_4112461_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
WP_011260279.1|4112647_4114012_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_011409411.1|4114227_4114923_+	VIT family protein	NA	NA	NA	NA	NA
WP_011409413.1|4115869_4116493_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011260283.1|4116637_4117435_+	cytochrome c4	NA	NA	NA	NA	NA
WP_011409415.1|4117528_4118179_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260284.1|4118270_4119086_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011409416.1|4119135_4119873_+	endonuclease	NA	NA	NA	NA	NA
WP_115801906.1|4121801_4122785_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	2.4e-97
WP_041182588.1|4122907_4125481_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_109182012.1|4125673_4126436_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|4126509_4127478_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409421.1|4128211_4128478_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094187728.1|4129409_4130208_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|4131854_4133087_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_011409423.1|4133126_4134089_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|4134264_4135221_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258802.1|4135432_4136401_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187715.1|4136736_4137499_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444134.1|4142336_4142567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409428.1|4143190_4145233_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_011409429.1|4145234_4147133_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011260297.1|4147134_4148388_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_044756435.1|4148384_4148990_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_044756434.1|4149409_4150564_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_011260300.1|4150566_4151595_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_011409431.1|4151591_4152668_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260302.1|4152708_4153986_-	sugar MFS transporter	NA	NA	NA	NA	NA
WP_011409432.1|4154030_4154798_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069959999.1|4155012_4156179_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_113175426.1|4158734_4161632_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
WP_069960264.1|4161782_4164473_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011260311.1|4166553_4167738_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011409442.1|4167805_4168543_+	pteridine reductase	NA	NA	NA	NA	NA
WP_011260313.1|4168711_4169227_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011260314.1|4169318_4170821_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
WP_011260315.1|4170824_4171265_-	response regulator	NA	NA	NA	NA	NA
WP_011409443.1|4171261_4173073_-	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
WP_011260317.1|4173358_4173730_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_011260318.1|4173880_4174933_+	oxidoreductase	NA	NA	NA	NA	NA
WP_011260319.1|4175272_4176214_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
WP_075239460.1|4176234_4177572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409446.1|4177743_4178124_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_012444115.1|4178248_4179010_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_011409450.1|4181267_4182671_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.5	8.1e-131
WP_011260326.1|4182793_4183849_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.3e-80
WP_069964507.1|4184744_4186121_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_011260328.1|4186686_4188870_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.6	2.8e-82
WP_011260329.1|4189368_4190463_-	type II restriction enzyme	NA	NA	NA	NA	NA
WP_041182275.1|4190459_4192271_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_155296183.1|4192365_4192515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964601.1|4192515_4193529_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_069964602.1|4193543_4194242_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_011409453.1|4194229_4194508_-	YbeD family protein	NA	NA	NA	NA	NA
WP_011260334.1|4195573_4196779_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
WP_011260335.1|4197279_4198695_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_011260336.1|4198691_4199831_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_069963899.1|4202220_4203177_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	8.1e-42
>prophage 26
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	4269026	4411770	4915452	tRNA,transposase	Acinetobacter_phage(28.57%)	115	NA	NA
WP_109181887.1|4269026_4269790_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704042.1|4270837_4271623_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_011260388.1|4271876_4273550_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_011409497.1|4274093_4274540_-	autotransporter	NA	NA	NA	NA	NA
WP_012444053.1|4274870_4275155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703841.1|4275749_4276661_-	magnesium transporter	NA	NA	NA	NA	NA
WP_027703842.1|4276906_4277902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757313.1|4277995_4279372_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_162828859.1|4280592_4282239_+	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_075242248.1|4282647_4284420_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_011409500.1|4284695_4285571_-	DMT family transporter	NA	NA	NA	NA	NA
WP_041182866.1|4285768_4286647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964606.1|4288686_4289778_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_011409507.1|4291680_4294005_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_069960011.1|4294200_4296147_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409509.1|4296521_4296713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260404.1|4297103_4298687_+	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_027704189.1|4299034_4299631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960267.1|4300979_4301828_-	threonine aldolase	NA	NA	NA	NA	NA
WP_011409514.1|4301862_4303338_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
WP_011260408.1|4303956_4304886_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_011260409.1|4305120_4305612_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260410.1|4305608_4306280_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011409516.1|4306674_4307004_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_012444032.1|4307212_4308139_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.7	3.9e-49
WP_044757306.1|4308612_4309290_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	60.3	8.8e-75
WP_011409520.1|4311807_4312293_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_011409522.1|4312831_4315660_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_011409523.1|4315659_4316034_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_069960013.1|4316030_4317575_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_044756383.1|4317571_4318078_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_011260421.1|4318074_4318359_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_011260422.1|4318355_4318709_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
WP_103057261.1|4319156_4319495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407627.1|4319678_4320647_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_011409528.1|4321078_4322404_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_012444023.1|4322768_4323884_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_011260425.1|4324009_4324498_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409530.1|4324854_4325445_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_044756377.1|4325456_4326965_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.8	1.3e-62
WP_011260428.1|4327407_4328301_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_075242274.1|4329675_4330341_+	pyruvate dehydrogenase E1 subunit alpha	NA	NA	NA	NA	NA
WP_115801908.1|4330973_4331939_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260435.1|4332471_4332852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|4333012_4333776_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080493565.1|4333870_4334773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260437.1|4334844_4336140_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_069960017.1|4336255_4336780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260439.1|4337205_4338471_-	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409539.1|4338467_4339445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444011.1|4339548_4340352_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011260442.1|4340527_4341337_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_109182023.1|4341344_4342143_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465763.1|4342185_4342803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409543.1|4342927_4343503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801909.1|4343714_4345034_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|4345183_4346152_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011260446.1|4346277_4347030_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011260447.1|4347067_4347508_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_011409547.1|4347714_4348056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260449.1|4348281_4348659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260450.1|4348869_4349067_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_069960019.1|4349373_4350120_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011260452.1|4350212_4351019_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_012444005.1|4351239_4352652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260454.1|4352648_4353746_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_094187763.1|4353900_4354699_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099051302.1|4354752_4355551_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409552.1|4355770_4356733_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182024.1|4357180_4357944_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260456.1|4358225_4359002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409554.1|4358998_4360315_+	amino acid permease	NA	NA	NA	NA	NA
WP_011408623.1|4360831_4362067_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260459.1|4362660_4362942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260461.1|4363502_4363937_-	membrane protein	NA	NA	NA	NA	NA
WP_011409559.1|4364111_4365290_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_069960023.1|4366285_4367248_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260467.1|4369581_4371753_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_011409563.1|4371980_4372337_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_069964611.1|4372415_4373480_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.6	4.3e-100
WP_002808376.1|4373759_4373975_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_011409564.1|4374291_4374738_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
WP_012443989.1|4376215_4377178_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_011260472.1|4377267_4379016_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
WP_041182298.1|4380343_4380589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059317500.1|4380588_4380855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013369.1|4381079_4382126_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_011409569.1|4382309_4383890_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011409570.1|4384278_4385175_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_011260477.1|4385177_4386341_-	heme A synthase	NA	NA	NA	NA	NA
WP_011260478.1|4386351_4386927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409571.1|4386954_4387674_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_012443949.1|4387734_4387953_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_011260481.1|4388045_4388921_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_011260482.1|4388959_4389556_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011260484.1|4389706_4391311_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_069964612.1|4391349_4392303_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_044757542.1|4392319_4392796_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_011260487.1|4393072_4396273_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_109182027.1|4397488_4398454_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_069960028.1|4398466_4398937_-	bacterioferritin	NA	NA	NA	NA	NA
WP_027703893.1|4399279_4399495_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011260490.1|4399575_4400193_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005990700.1|4400741_4401134_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260491.1|4401137_4401566_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_069960112.1|4401751_4402405_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_011409578.1|4402661_4402976_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260494.1|4403135_4403930_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_011260495.1|4404067_4404760_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_011409579.1|4405080_4405797_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011260497.1|4405789_4406587_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
WP_011409580.1|4406723_4407761_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_011260499.1|4407878_4408508_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011409581.1|4408659_4409241_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_094187806.1|4410668_4411770_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
>prophage 27
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	4416656	4506735	4915452	tRNA,transposase,integrase	Acidithiobacillus_phage(15.38%)	58	4416538:4416558	4483272:4483292
4416538:4416558	attL	ATAGTCGCCCCTGAAAAACCG	NA	NA	NA	NA
WP_069964614.1|4416656_4418033_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.5	3.7e-80
WP_115801910.1|4420240_4421039_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155296585.1|4422224_4422521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075240159.1|4423139_4423370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|4423627_4424596_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_069960033.1|4424762_4425734_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
WP_011409594.1|4425926_4427111_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011260517.1|4427578_4428394_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_069960034.1|4429152_4430469_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011260520.1|4430728_4431973_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_113085303.1|4432065_4435314_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_069964615.1|4435447_4438588_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011409598.1|4438877_4440245_-	VOC family protein	NA	NA	NA	NA	NA
WP_041182775.1|4440989_4441955_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027703675.1|4442417_4442888_+	thioesterase	NA	NA	NA	NA	NA
WP_011409601.1|4442916_4443339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260528.1|4443414_4443849_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011260529.1|4443958_4444474_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011409602.1|4444489_4445515_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011260531.1|4445837_4446434_-	Ax21 family protein	NA	NA	NA	NA	NA
WP_069960036.1|4446791_4448519_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_011260533.1|4448568_4450011_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011260534.1|4449995_4451342_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409603.1|4451532_4452282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260536.1|4452383_4452995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260537.1|4453099_4454323_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260538.1|4454664_4455141_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011409604.1|4455167_4455629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010370565.1|4456014_4456335_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_011260540.1|4456436_4457453_+	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011260541.1|4457524_4458688_+	Fic family protein	NA	NA	NA	NA	NA
WP_011260542.1|4458684_4460316_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.5	1.7e-63
WP_011409605.1|4460323_4462819_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_069964618.1|4462815_4463718_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409606.1|4463939_4464323_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011260546.1|4464641_4466312_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_011409607.1|4466540_4467551_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.6	1.5e-14
WP_011260548.1|4467615_4467774_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011260549.1|4468008_4469385_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
WP_041182305.1|4469395_4469929_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409609.1|4470357_4471617_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_011260552.1|4471755_4473063_-	MFS transporter	NA	NA	NA	NA	NA
WP_011407587.1|4475147_4476182_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409611.1|4476532_4477078_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_011409612.1|4477103_4477370_-	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011260556.1|4477544_4479383_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011260557.1|4479613_4480489_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
WP_011257570.1|4481974_4483210_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_115801911.1|4484088_4485069_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	3.1e-97
4483272:4483292	attR	CGGTTTTTCAGGGGCGACTAT	NA	NA	NA	NA
WP_011260560.1|4486189_4487089_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_044756337.1|4488036_4490838_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
WP_069964620.1|4490914_4491205_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_075240612.1|4492769_4493360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128415341.1|4493500_4494406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014504812.1|4494595_4497283_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_011409626.1|4500604_4504534_+	avirulence protein	NA	NA	NA	NA	NA
WP_155296185.1|4504599_4504740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409629.1|4506222_4506735_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	68.8	1.6e-44
>prophage 28
NZ_CP031456	Xanthomonas oryzae pv. oryzae strain HuN37 chromosome, complete genome	4915452	4606295	4749638	4915452	tail,tRNA,transposase	Arthrobacter_phage(18.75%)	90	NA	NA
WP_094187715.1|4606295_4607058_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260659.1|4607120_4608152_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.0e-70
WP_011260660.1|4609512_4610769_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011260661.1|4610765_4611656_+	allantoinase PuuE	NA	NA	NA	NA	NA
WP_012443820.1|4611652_4612048_+	DUF3225 domain-containing protein	NA	NA	NA	NA	NA
WP_075239612.1|4612067_4612646_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_115801912.1|4612531_4613389_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_011409690.1|4613321_4614710_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260667.1|4619495_4621580_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260668.1|4621679_4623707_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011260669.1|4623949_4625560_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_011260670.1|4625570_4626734_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011409694.1|4626862_4627483_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012443812.1|4627813_4628002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260672.1|4628044_4628380_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_075242289.1|4630004_4630316_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_011409699.1|4631434_4631953_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_011409700.1|4632224_4633943_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011260679.1|4634033_4634420_-	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_011260680.1|4634481_4635807_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_011260681.1|4635921_4637235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260682.1|4637333_4638059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409701.1|4638275_4638938_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409702.1|4639016_4640111_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011409705.1|4641615_4644375_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.9	3.5e-146
WP_011409706.1|4644627_4646217_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_011409707.1|4646216_4648454_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011409708.1|4648742_4649651_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011409709.1|4649740_4651555_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_153303324.1|4651940_4660766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801913.1|4660864_4661662_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409712.1|4662206_4662959_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_011260693.1|4663018_4663918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260694.1|4664069_4664825_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_011409714.1|4664821_4665457_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003484969.1|4665472_4665700_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_011409715.1|4665772_4666675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409716.1|4666829_4667795_+	ferrochelatase	NA	NA	NA	NA	NA
WP_075242173.1|4667892_4668648_+	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
WP_011409718.1|4668728_4669187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409719.1|4669457_4670243_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409720.1|4670869_4671775_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	4.1e-43
WP_011260702.1|4671838_4672756_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_011259480.1|4673359_4674697_+	xylose isomerase	NA	NA	NA	NA	NA
WP_011409721.1|4674922_4675990_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409722.1|4676165_4678361_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409723.1|4678357_4680322_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409724.1|4680333_4681593_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_011260707.1|4681592_4683293_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_080493943.1|4683295_4686010_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260709.1|4686232_4687705_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_011260711.1|4688682_4689738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260712.1|4689965_4691384_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_011409725.1|4691424_4692402_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_042465333.1|4693818_4695120_-	MFS transporter	NA	NA	NA	NA	NA
WP_011409727.1|4695581_4698515_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409728.1|4698613_4700101_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260718.1|4700132_4701167_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_094187716.1|4701583_4702381_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182039.1|4703687_4704644_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_109182040.1|4705371_4706134_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075242372.1|4706151_4707252_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011260725.1|4707317_4708439_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_011409734.1|4708448_4709525_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260727.1|4709617_4710298_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_115801914.1|4710330_4711129_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409735.1|4711257_4712577_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465802.1|4712679_4713636_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.4e-41
WP_011260733.1|4715102_4715561_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409738.1|4715662_4716091_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_069960048.1|4716337_4717201_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_042465346.1|4720377_4720644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260739.1|4720805_4721054_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027703649.1|4721262_4721787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465805.1|4723493_4724189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409745.1|4724287_4724620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409747.1|4725091_4725526_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_069960049.1|4725641_4725887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260743.1|4726222_4726555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703652.1|4727004_4728399_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011260746.1|4729327_4729618_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	53.8	1.5e-15
WP_012443754.1|4729635_4729917_-	plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	40.7	3.1e-10
WP_069960050.1|4730011_4732264_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	21.9	1.8e-10
WP_075242560.1|4732451_4736525_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	4.1e-10
WP_069964629.1|4736521_4739935_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_133260594.1|4739970_4740273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409756.1|4746848_4747394_+|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_011260754.1|4747462_4747990_+|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011260755.1|4748048_4748585_+|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
WP_109182045.1|4748672_4749638_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
