The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	7692	78816	4900521	transposase,protease	Ralstonia_phage(30.0%)	54	NA	NA
WP_011407164.1|7692_8529_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011407165.1|8715_9522_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9798_10992_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011257014.1|11145_11817_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|11901_12663_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12709_13132_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13135_13549_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011407166.1|13844_14612_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14622_14892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407167.1|14966_16427_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|17073_18084_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18355_19558_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19699_21838_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|22048_22342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296734.1|22373_22871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113085515.1|23117_24098_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	56.2	5.3e-89
WP_011257025.1|24145_25312_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_069959658.1|25458_26025_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_069959660.1|27499_28708_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|29335_30358_-	sugar kinase	NA	NA	NA	NA	NA
WP_011407175.1|31180_32149_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407176.1|32636_33773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129215536.1|33769_34477_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.6e-05
WP_012443646.1|35078_36455_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	4.1e-79
WP_012443643.1|39467_39710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443642.1|39651_39975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257128.1|40440_41421_-|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
WP_011407184.1|42039_43329_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
WP_011407185.1|43768_44104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407187.1|44378_44810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|45158_46568_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041181902.1|46845_47061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|47885_48146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|48162_48495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080256644.1|48494_48953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407913.1|49312_50527_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187731.1|51047_51845_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182053.1|53560_54526_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407196.1|54944_56264_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407197.1|56381_57428_+	methylamine utilization protein	NA	NA	NA	NA	NA
WP_011407198.1|57568_58066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703730.1|58229_58862_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_011257110.1|58878_61041_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011407199.1|61155_61341_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011257109.1|61363_63967_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_094187819.1|63963_65853_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_011257107.1|65909_67667_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_011407200.1|67669_69904_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_027703733.1|69900_71484_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_011257104.1|71957_73586_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_011257103.1|73582_74947_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011257102.1|75139_76081_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_011407202.1|76321_78046_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
WP_109181945.1|78052_78816_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	109333	135585	4900521	transposase	Ralstonia_phage(50.0%)	23	NA	NA
WP_011258529.1|109333_110302_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_115840160.1|110514_111834_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407219.1|112022_113006_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_041181898.1|113727_116136_+	serine kinase	NA	NA	NA	NA	NA
WP_011257061.1|117011_118640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407223.1|119197_119581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407224.1|119577_120063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407225.1|120066_120429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407226.1|120545_121982_-	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.7	1.5e-10
WP_011407227.1|122223_123075_+	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
WP_011257053.1|123534_123852_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011257052.1|124157_125045_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_011407229.1|125751_126702_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	3.0e-97
WP_012443587.1|126815_127001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407230.1|127092_127353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257048.1|127405_127687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407231.1|127825_128884_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011407232.1|129024_129972_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
WP_011407233.1|130226_130538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|132004_132475_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011257042.1|132644_133337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257041.1|133428_133827_+	host attachment protein	NA	NA	NA	NA	NA
WP_011407237.1|134628_135585_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
>prophage 3
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	219996	385023	4900521	tRNA,transposase,holin	Bacillus_phage(15.79%)	110	NA	NA
WP_011257198.1|219996_221901_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_075239321.1|222161_222341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407290.1|222474_222942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257199.1|223099_224059_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_011407291.1|224043_224661_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011257200.1|224703_225123_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_011257201.1|225375_226281_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	39.2	4.4e-37
WP_011257202.1|226529_227414_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011257203.1|227477_228260_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407292.1|228304_229066_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_011257206.1|229229_229559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407293.1|229877_230969_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_011407294.1|231037_232636_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_011407295.1|232800_234045_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_011257210.1|234496_235126_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	3.3e-52
WP_011257211.1|235332_237309_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
WP_011407298.1|238695_239361_-	YceH family protein	NA	NA	NA	NA	NA
WP_011257214.1|239640_240651_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_011257215.1|240647_241379_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_011257216.1|241732_243262_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.0e-46
WP_011407300.1|243371_246404_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257218.1|246702_249741_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257219.1|249905_250958_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_075240491.1|251126_251372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407301.1|251370_252336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257221.1|252335_254996_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_008573820.1|256814_257018_-	YdcH family protein	NA	NA	NA	NA	NA
WP_011257226.1|260657_261302_-	DUF4375 domain-containing protein	NA	NA	NA	NA	NA
WP_011257227.1|261442_262333_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_011407307.1|262460_262943_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257232.1|265978_266512_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_011407313.1|269327_270386_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
WP_011257237.1|270693_271767_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257238.1|272529_273582_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_113079127.1|274229_275360_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011407314.1|275614_275929_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_011257241.1|276676_277066_+	YchJ family protein	NA	NA	NA	NA	NA
WP_011407316.1|277273_277480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|277711_278680_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011257243.1|278933_281096_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407318.1|281643_282948_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011407319.1|283007_283610_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011257245.1|283606_285511_+	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407325.1|294829_295645_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_041182297.1|295991_296954_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182012.1|297058_297821_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257253.1|299620_300679_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011257254.1|300689_300980_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257255.1|300969_301632_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_012446379.1|301628_302180_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257257.1|302191_302941_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407332.1|302940_303735_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257259.1|304119_304407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703982.1|304425_304983_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182061.1|305000_305966_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407336.1|306810_307767_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	2.9e-39
WP_011258802.1|308254_309223_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109182062.1|309800_310599_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407338.1|310730_311945_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
WP_109182063.1|312004_312835_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407798.1|312997_314233_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011257271.1|315631_316060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407344.1|316070_316520_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257273.1|316500_316728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407346.1|317035_318790_-	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_109182012.1|319668_320431_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703800.1|320484_321069_-	gluconokinase	NA	NA	NA	NA	NA
WP_011407349.1|321226_322609_+	MFS transporter	NA	NA	NA	NA	NA
WP_011407350.1|322611_325011_+	NdvB protein	NA	NA	NA	NA	NA
WP_011407351.1|325114_327757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257279.1|328504_331954_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011407353.1|332146_332731_-	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011407354.1|333207_333984_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407355.1|334164_335466_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011257283.1|335468_335828_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_011257284.1|336264_337746_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_109182027.1|337938_338904_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407357.1|339730_341893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042464365.1|342019_344188_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011257288.1|344825_345455_-|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_011257289.1|345457_345889_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011257290.1|345945_346524_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_027703865.1|346619_347372_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_113079157.1|347596_347986_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011257293.1|348099_349773_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_044757204.1|349769_350414_-	sterol-binding protein	NA	NA	NA	NA	NA
WP_011407366.1|354098_354383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182066.1|354734_355533_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187782.1|355592_356356_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182067.1|360309_361275_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042464374.1|362335_363442_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465421.1|365235_366174_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_080493948.1|366292_367081_-	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	4.5e-54
WP_012446343.1|367044_367836_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257314.1|367853_368849_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
WP_075242284.1|368885_369713_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011407379.1|369797_370799_-	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_011407380.1|370864_371137_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_153296754.1|371257_371419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465424.1|371622_372210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257320.1|372206_372407_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011407383.1|372467_374069_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024712051.1|374100_374847_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
WP_011407385.1|374843_376037_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407386.1|376446_377469_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_041181930.1|377608_379174_-	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
WP_011257326.1|379184_380198_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407388.1|380187_380889_-	SapC family protein	NA	NA	NA	NA	NA
WP_011407389.1|381072_384087_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_109181945.1|384260_385023_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	567646	617144	4900521	tRNA,transposase,integrase	Sinorhizobium_phage(14.29%)	42	575797:575813	613932:613948
WP_109181928.1|567646_568612_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_115840162.1|569079_570399_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257475.1|570928_571444_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011407490.1|571846_574069_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_103057279.1|574537_575563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959707.1|575546_576149_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
575797:575813	attL	GCGTAGTGCTGCGTCAT	NA	NA	NA	NA
WP_069959708.1|576479_577424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407493.1|577942_579319_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011407494.1|579403_581305_+	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
WP_011257482.1|581490_581706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407495.1|581812_582589_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407496.1|582750_583425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407497.1|583421_584195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257486.1|584418_584982_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011257487.1|584992_587485_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
WP_011257488.1|587667_588942_-	RDD family protein	NA	NA	NA	NA	NA
WP_041181947.1|588983_589706_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_011257490.1|589746_590220_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_011257491.1|590262_591405_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_011407499.1|591476_592613_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_011257493.1|592745_593258_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_011257494.1|593651_594575_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_011407500.1|594574_595888_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011257496.1|595938_597660_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011257497.1|597824_599102_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257498.1|599299_600124_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011407501.1|600127_601183_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_011257500.1|601348_602815_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_042465436.1|602811_603315_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_011257502.1|603424_604558_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_011407503.1|604800_605322_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011407504.1|605521_606436_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011257505.1|606536_606977_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_011407505.1|607085_608960_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_011407506.1|609152_609473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257519.1|610101_611376_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.4e-110
WP_011257520.1|611509_611716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257521.1|611712_611985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407508.1|611981_612227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407512.1|614162_615398_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
613932:613948	attR	ATGACGCAGCACTACGC	NA	NA	NA	NA
WP_011407513.1|615466_615856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|616178_617144_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	721759	779734	4900521	transposase	Enterobacteria_phage(25.0%)	52	NA	NA
WP_115840163.1|721759_722725_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407584.1|725133_726405_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011407585.1|726612_728442_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.5	1.3e-133
WP_011257638.1|728823_729297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257639.1|729528_730104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187804.1|730136_730899_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|731015_732050_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011407588.1|732266_732791_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_011258803.1|732963_733932_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011257643.1|734107_735214_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_103057232.1|735210_737058_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_011257645.1|737144_737561_-	CopL family metal-binding regulatory protein	NA	NA	NA	NA	NA
WP_011407590.1|737696_738800_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_011407591.1|738843_740868_+	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_041181965.1|741041_741863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257649.1|741976_743185_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_011407593.1|743184_743700_-	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA	NA	NA	NA	NA	NA
WP_011407594.1|744045_745125_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_011407595.1|745266_745917_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_011257653.1|746228_746627_-	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_011407596.1|746623_747106_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011407597.1|747430_748105_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_011407598.1|748219_748555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703598.1|748747_749101_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_011407600.1|749513_750896_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.3	1.4e-55
WP_019301777.1|750988_751114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257658.1|751275_752265_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
WP_042464484.1|752308_752935_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_011407601.1|753273_754407_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_011407602.1|754505_754889_+	DUF4398 domain-containing protein	NA	NA	NA	NA	NA
WP_011257662.1|754885_755776_+	membrane protein	NA	NA	NA	NA	NA
WP_003484103.1|756117_756336_+	YdcH family protein	NA	NA	NA	NA	NA
WP_011407603.1|756577_757948_+	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	38.8	2.6e-49
WP_011257665.1|758038_759232_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_011257666.1|759278_760079_+	FkbM family methyltransferase	NA	H8ZJI6	Ostreococcus_tauri_virus	28.0	3.5e-06
WP_011407605.1|760113_761190_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SG19	Hokovirus	21.8	4.9e-11
WP_011407606.1|762221_763148_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_024744691.1|763168_763459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257668.1|763449_764613_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011257669.1|764618_765671_+	acyltransferase	NA	A9YX16	Burkholderia_phage	33.9	1.5e-41
WP_109182077.1|765757_767077_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407609.1|767392_768577_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_011407610.1|769106_770420_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
WP_011407611.1|770409_771228_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257674.1|771450_772392_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011257675.1|772391_773138_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011407612.1|773363_774419_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011407613.1|774474_775362_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407614.1|775358_775916_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
WP_011407615.1|775912_776821_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
WP_011257680.1|776937_778341_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_113081224.1|778387_779734_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	1.5e-33
>prophage 6
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	791998	835301	4900521	tRNA,transposase	Ralstonia_phage(22.22%)	27	NA	NA
WP_011257693.1|791998_793693_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011257694.1|793804_794209_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011407623.1|794340_795114_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011257696.1|795124_795592_+	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_011407624.1|795588_796071_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182079.1|796629_797949_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182080.1|798106_799426_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407627.1|799638_800607_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_109182081.1|800756_802076_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_027704044.1|802380_804354_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	7.9e-15
WP_011257702.1|804620_805661_-	pectate lyase	NA	NA	NA	NA	NA
WP_094187731.1|807250_808048_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257706.1|808700_809015_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_115801870.1|809202_810305_-|transposase	IS3-like element ISXo17 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	7.2e-42
WP_011257710.1|811241_814184_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.8	6.4e-130
WP_011257711.1|814391_814817_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_011257712.1|814857_815163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257713.1|815162_816635_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	6.2e-49
WP_011407634.1|816742_817825_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_011407635.1|817821_818928_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_011258579.1|819102_820071_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011257716.1|820502_820970_-	RDD family protein	NA	NA	NA	NA	NA
WP_011257717.1|821396_822368_+	site-specific tyrosine recombinase XerD	NA	G1JX48	Mycobacterium_phage	27.9	6.4e-18
WP_011257718.1|822822_823620_+	DsbC family protein	NA	NA	NA	NA	NA
WP_011257719.1|824018_828071_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	7.5e-121
WP_069959728.1|829048_832846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409190.1|834344_835301_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	2.4e-41
>prophage 7
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	871012	922641	4900521	transposase,protease	Ralstonia_phage(18.18%)	43	NA	NA
WP_069963827.1|871012_871978_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257750.1|872368_872944_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_011407659.1|873056_873566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010368401.1|873664_873859_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011257752.1|873948_874926_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011257753.1|875155_875596_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_011257754.1|875873_876818_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_011407660.1|876900_877644_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
WP_010368407.1|877848_878088_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_011407661.1|878229_879465_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011407662.1|879635_880991_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_011257758.1|881051_882125_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_011257759.1|882121_883081_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_011257760.1|883077_883431_+	type IV fimbriae assembly protein	NA	NA	NA	NA	NA
WP_011407663.1|883954_884428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407665.1|885448_885775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181972.1|886010_887609_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_011257763.1|887754_888651_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_011407667.1|888726_889881_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_011257765.1|890061_892653_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_011407669.1|892975_893113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407670.1|893385_894585_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_011407671.1|895034_896003_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	6.6e-100
WP_011407672.1|896244_898461_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407673.1|898539_899538_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_103057250.1|899647_899830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464512.1|900809_903797_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041181973.1|903971_904919_+	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
WP_011407676.1|905423_905960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407677.1|906030_907350_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407678.1|907694_908657_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.7e-42
WP_011257778.1|908790_909351_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011257779.1|909393_909876_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_011407679.1|910038_910515_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257781.1|910925_911825_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011257782.1|912064_912451_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011407680.1|913080_914208_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257784.1|914207_915071_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_011257785.1|915364_915550_+	DUF2065 family protein	NA	NA	NA	NA	NA
WP_011407681.1|915887_917180_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	37.5	8.4e-74
WP_011407682.1|917505_920178_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.0	2.6e-77
WP_011257788.1|920371_921154_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_115840190.1|921264_922641_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	4.3e-76
>prophage 8
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	961362	1013081	4900521	transposase,protease	Tenacibaculum_phage(16.67%)	34	NA	NA
WP_109182067.1|961362_962328_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182120.1|962324_962498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446005.1|962782_963274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257827.1|964953_966210_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011257828.1|966369_966933_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_011257829.1|967299_968658_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_027703752.1|968657_969254_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_011257831.1|969400_970285_+	membrane protein	NA	NA	NA	NA	NA
WP_011257834.1|972266_972881_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257835.1|972963_973950_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|974065_974560_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|974804_976634_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011407704.1|976652_977123_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|978045_979173_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|979273_980656_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_011257842.1|980903_983027_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407706.1|983555_984074_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_115801872.1|984780_985882_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.6e-41
WP_011257570.1|986397_987633_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_103057209.1|988246_989095_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_012445986.1|989226_989367_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_011407713.1|992926_994162_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109182089.1|995144_996464_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182948.1|997209_998133_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
WP_109182121.1|999195_1000161_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|1000462_1002040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|1002107_1002871_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1005539_1006508_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011407721.1|1006768_1007230_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011257866.1|1007778_1008021_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_109182012.1|1008014_1008778_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049756327.1|1008810_1009542_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
WP_109182091.1|1011361_1012114_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181948.1|1012115_1013081_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	1020710	1083727	4900521	transposase,integrase,protease	Ralstonia_phage(31.25%)	50	1011907:1011925	1080838:1080856
1011907:1011925	attL	GCGACAGCGGCTACACCGG	NA	NA	NA	NA
WP_011257881.1|1020710_1021997_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_012445937.1|1022140_1024612_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_002806049.1|1024825_1025098_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_011407728.1|1025929_1027900_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011407729.1|1028605_1029784_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011257886.1|1029780_1030548_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011257887.1|1030560_1031217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257888.1|1031244_1031697_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257889.1|1031705_1032440_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_113081222.1|1032875_1033580_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_041181989.1|1034405_1035035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445927.1|1035926_1036127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082325231.1|1036522_1039246_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.2	2.8e-71
WP_069960070.1|1039313_1041464_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
WP_044757078.1|1041460_1043158_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_011257897.1|1043477_1045682_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
WP_011257898.1|1045678_1047373_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|1047369_1047633_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_109182093.1|1047694_1049902_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-19
WP_011407737.1|1049898_1051578_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|1051574_1051838_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_011257899.1|1051899_1052457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182094.1|1052539_1053505_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407739.1|1053603_1054290_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
WP_011257902.1|1054400_1054805_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011407740.1|1055015_1056065_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257904.1|1056085_1056835_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257905.1|1056834_1057584_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257906.1|1057583_1058615_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257907.1|1058632_1058992_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011407742.1|1059016_1059514_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257909.1|1059510_1059756_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011257910.1|1059752_1060199_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257911.1|1060760_1062857_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_011257912.1|1062863_1063184_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011257913.1|1063281_1063875_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_011407744.1|1063976_1064327_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257915.1|1064446_1064980_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011257916.1|1064976_1066929_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257917.1|1066921_1067878_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407746.1|1067883_1068837_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_012445908.1|1068875_1070744_+	membrane protein	NA	NA	NA	NA	NA
WP_011407749.1|1072259_1072775_+	peptide deformylase	NA	NA	NA	NA	NA
WP_103057268.1|1073291_1074050_+	cellulase	NA	NA	NA	NA	NA
WP_041182379.1|1074522_1075269_+	cellulase	NA	NA	NA	NA	NA
WP_011407751.1|1075885_1077487_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_011257570.1|1078475_1079711_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258188.1|1080539_1081508_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
1080838:1080856	attR	CCGGTGTAGCCGCTGTCGC	NA	NA	NA	NA
WP_075241901.1|1081975_1082326_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_011407756.1|1082407_1083727_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	1122457	1164904	4900521	transposase	Leptospira_phage(25.0%)	41	NA	NA
WP_109182097.1|1122457_1123559_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
WP_011407778.1|1124989_1125613_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_011257965.1|1125636_1125876_+	rubredoxin	NA	NA	NA	NA	NA
WP_011257966.1|1125925_1126807_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011407780.1|1126956_1127406_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_011407781.1|1127556_1128204_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_011257969.1|1128295_1128766_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_011407783.1|1128762_1129353_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_011257971.1|1129961_1130261_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_011407784.1|1130257_1130479_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_011407785.1|1130714_1131257_+	YecA family protein	NA	NA	NA	NA	NA
WP_011257974.1|1131267_1132608_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_162013040.1|1133125_1133284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187736.1|1133315_1134079_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257975.1|1134311_1135637_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_011257976.1|1135835_1136183_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011407789.1|1136179_1138588_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011257978.1|1138766_1139924_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_011257979.1|1139939_1140539_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.8	3.8e-13
WP_011257980.1|1140535_1140931_-	glyoxalase	NA	NA	NA	NA	NA
WP_011257981.1|1140927_1141653_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_011257982.1|1141762_1142623_+	YicC family protein	NA	NA	NA	NA	NA
WP_011257983.1|1142739_1143351_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	30.9	3.1e-10
WP_099051298.1|1143531_1144329_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407791.1|1144477_1144777_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_011257986.1|1144905_1147077_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011257987.1|1147156_1147537_+	RidA family protein	NA	NA	NA	NA	NA
WP_011407792.1|1147557_1149711_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011257989.1|1149836_1150775_+	inosine-uridine preferring nucleoside hydrolase	NA	NA	NA	NA	NA
WP_005911911.1|1150846_1151089_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011407793.1|1151302_1152592_+	citrate synthase	NA	NA	NA	NA	NA
WP_011407794.1|1152969_1153620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257992.1|1153929_1156359_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_011407795.1|1156574_1157633_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257994.1|1157632_1158391_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011257995.1|1158387_1159053_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_011257996.1|1159049_1159583_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011407796.1|1159602_1161552_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_094187763.1|1161622_1162421_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257854.1|1162563_1163799_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_115840164.1|1163869_1164904_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	1204121	1235961	4900521	transposase	Feldmannia_irregularis_virus(16.67%)	25	NA	NA
WP_109181945.1|1204121_1204884_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115801876.1|1204973_1205939_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027704076.1|1206048_1207368_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011407833.1|1207830_1208508_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704066.1|1208587_1208977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407835.1|1209190_1210078_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
WP_113081219.1|1210511_1211496_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	6.3e-98
WP_011407838.1|1211670_1213758_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011407839.1|1213909_1214569_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_094187758.1|1214649_1215447_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407841.1|1215469_1215649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258045.1|1215667_1216072_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258046.1|1216105_1216465_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258047.1|1216708_1217581_-	ion transporter	NA	NA	NA	NA	NA
WP_011258048.1|1217653_1218880_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
WP_011407842.1|1219124_1219742_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_042464589.1|1221278_1222886_+	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_011258050.1|1222882_1223308_+	cytochrome c	NA	NA	NA	NA	NA
WP_011407846.1|1223332_1223836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407850.1|1225278_1225728_+	azurin	NA	NA	NA	NA	NA
WP_011407853.1|1228974_1230264_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_011407854.1|1230549_1233729_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258055.1|1234225_1235095_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
WP_011258056.1|1235116_1235788_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_012444927.1|1235784_1235961_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	1255226	1305221	4900521	transposase	Xanthomonas_phage(71.43%)	45	NA	NA
WP_011258802.1|1255226_1256195_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_041182117.1|1257001_1257187_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
WP_012444935.1|1257186_1257390_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	70.3	6.1e-16
WP_011258952.1|1257525_1258599_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
WP_011408494.1|1258703_1259003_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
WP_011408495.1|1259366_1259606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057497.1|1259712_1261197_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	1.4e-40
WP_041182119.1|1261198_1261519_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_011408497.1|1261515_1262700_+	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	5.2e-54
WP_080493496.1|1262754_1262925_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	56.0	2.5e-10
WP_075240059.1|1264033_1264294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113081226.1|1264493_1264877_+	hypothetical protein	NA	A0A1D6ZIV0	Xanthomonas_phage	99.2	4.8e-70
WP_011408501.1|1265048_1265696_-	conjugal transfer protein TrbP	NA	A0A1D6ZIU7	Xanthomonas_phage	100.0	3.0e-120
WP_011408502.1|1265697_1266885_-	hypothetical protein	NA	A0A1D6ZIU8	Xanthomonas_phage	100.0	2.8e-217
WP_011408503.1|1266884_1267214_-	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	100.0	3.8e-55
WP_042464851.1|1267213_1268620_-	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	100.0	6.4e-245
WP_011408505.1|1268756_1268987_-	hypothetical protein	NA	A0A1D6ZIT7	Xanthomonas_phage	100.0	1.7e-30
WP_042464854.1|1268998_1269202_-	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	100.0	9.8e-30
WP_011408506.1|1269205_1269502_-	DNA-binding protein	NA	A0A1D6ZIU6	Xanthomonas_phage	100.0	3.6e-49
WP_011408507.1|1269498_1270539_-	replication initiation protein	NA	A0A1D6ZIT9	Xanthomonas_phage	100.0	8.2e-205
WP_011408508.1|1270691_1270904_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	100.0	1.6e-27
WP_069970101.1|1271216_1271846_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	80.6	2.5e-71
WP_011408511.1|1271970_1272153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168751.1|1272274_1272586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187780.1|1272655_1273418_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_125168752.1|1273922_1274246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409552.1|1274676_1275639_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011408516.1|1275939_1276452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181945.1|1276584_1277347_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082325281.1|1278568_1282366_+	avirulence protein	NA	NA	NA	NA	NA
WP_041182100.1|1282634_1282829_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408491.1|1282832_1283132_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_115840170.1|1283355_1287111_+	avirulence protein	NA	NA	NA	NA	NA
WP_109181946.1|1287200_1287963_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042464821.1|1288194_1288389_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011408491.1|1288392_1288692_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_069959856.1|1288916_1292933_+	avirulence protein	NA	NA	NA	NA	NA
WP_012444927.1|1293151_1293328_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011408520.1|1293324_1293996_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_011407237.1|1295250_1296207_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258802.1|1296621_1297590_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_041182129.1|1297734_1298700_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182130.1|1298677_1302778_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011408522.1|1303086_1304271_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_041182131.1|1304321_1305221_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
>prophage 13
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	1459025	1507115	4900521	tRNA,transposase	Moumouvirus(16.67%)	45	NA	NA
WP_011408598.1|1459025_1460420_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	7.6e-81
WP_011259080.1|1460421_1460679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408599.1|1460675_1460981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408600.1|1460977_1461304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408603.1|1462030_1462693_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_024744799.1|1462781_1463312_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_011408606.1|1465535_1466807_+	kynureninase	NA	NA	NA	NA	NA
WP_011408607.1|1466978_1468346_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011259089.1|1468649_1470095_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_011259090.1|1470091_1470778_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_011259091.1|1470750_1471770_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011259092.1|1471811_1472372_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_011259093.1|1472392_1473349_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_011408609.1|1473516_1474293_-	NAD kinase	NA	NA	NA	NA	NA
WP_011408610.1|1474776_1476912_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_027703372.1|1476908_1477100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259098.1|1478874_1479381_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259099.1|1479421_1479949_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408612.1|1479945_1480437_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_011408613.1|1480460_1481036_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011259101.1|1481112_1482066_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259102.1|1482154_1483027_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_162828806.1|1483023_1483863_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_162828804.1|1483743_1483983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408617.1|1483975_1484674_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408618.1|1484837_1485620_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408619.1|1485628_1486009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259107.1|1486005_1486716_+	endonuclease III	NA	NA	NA	NA	NA
WP_011408621.1|1488026_1488575_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_011258803.1|1488746_1489715_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011408623.1|1490319_1491555_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_041182144.1|1492118_1492439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259109.1|1492778_1494029_+	porin	NA	NA	NA	NA	NA
WP_011408625.1|1494217_1495237_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.7	1.6e-48
WP_011408626.1|1495424_1496516_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_069959864.1|1496628_1497603_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_069959865.1|1497602_1498472_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259114.1|1498494_1499325_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011408630.1|1499453_1500164_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011259116.1|1500296_1500704_+	RcnB family protein	NA	NA	NA	NA	NA
WP_011259117.1|1500987_1501623_+	ribonuclease T	NA	NA	NA	NA	NA
WP_011408631.1|1501693_1503013_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464912.1|1503249_1504311_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408760.1|1504361_1505546_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_109181954.1|1505795_1507115_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	1513834	1586182	4900521	tRNA,transposase,protease	uncultured_Mediterranean_phage(33.33%)	53	NA	NA
WP_011259125.1|1513834_1514980_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_027703908.1|1515049_1516120_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259127.1|1516306_1516738_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408638.1|1516861_1518358_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011259129.1|1518702_1519410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259140.1|1522806_1523928_-	phytase	NA	NA	NA	NA	NA
WP_041182147.1|1526200_1526668_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011259142.1|1526818_1527451_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_094187715.1|1527847_1528610_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259143.1|1528890_1529922_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408648.1|1529928_1531722_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_012444765.1|1531718_1532003_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_027703974.1|1532234_1532732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259147.1|1532778_1533285_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_011259148.1|1533281_1533902_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011408651.1|1534142_1536047_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_109181955.1|1536134_1537192_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_109181956.1|1537289_1538609_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239722.1|1538842_1540000_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_109181957.1|1540276_1541242_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181958.1|1541219_1542695_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
WP_162013043.1|1542730_1542937_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1544511_1545480_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258802.1|1546394_1547363_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_075245207.1|1547630_1547864_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011259163.1|1549744_1550965_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011259164.1|1551279_1552677_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011408657.1|1552687_1553905_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259166.1|1553904_1554543_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011259167.1|1554613_1555474_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011408658.1|1555470_1556259_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011259169.1|1556269_1557475_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002812972.1|1557493_1557919_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259170.1|1558138_1558771_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259171.1|1558795_1561168_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259172.1|1561325_1562531_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011259173.1|1562851_1564183_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
WP_011408659.1|1564179_1564530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|1564561_1564969_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011259175.1|1564965_1565292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259176.1|1565323_1566700_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
WP_011259177.1|1566936_1571103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703232.1|1571215_1571887_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011259179.1|1571951_1573880_-	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011259180.1|1574042_1576403_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_011259181.1|1576686_1577655_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011408662.1|1577712_1578834_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_042465566.1|1580261_1581014_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002813418.1|1581094_1581313_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011259186.1|1581593_1583876_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	8.7e-175
WP_005914463.1|1584019_1584340_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_011408665.1|1584590_1585049_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011259189.1|1585045_1586182_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	1667920	1693558	4900521	transposase	Bacillus_phage(50.0%)	14	NA	NA
WP_115801909.1|1667920_1669240_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|1669389_1670358_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_125168757.1|1671982_1672462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259260.1|1680586_1680979_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259261.1|1680987_1681449_+	cytochrome c	NA	NA	NA	NA	NA
WP_153296779.1|1681869_1682268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133264955.1|1682744_1682999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801893.1|1683971_1684937_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_082323190.1|1684943_1686242_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408708.1|1686410_1688096_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
WP_075239845.1|1688092_1689829_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	8.2e-16
WP_082325289.1|1690428_1691385_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.8e-41
WP_011259267.1|1692187_1692451_+	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_115840191.1|1692592_1693558_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	1710442	1771038	4900521	tRNA,transposase,protease	Moumouvirus(10.0%)	53	NA	NA
WP_012444736.1|1710442_1711867_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_011408724.1|1712364_1712802_+	SufE family protein	NA	NA	NA	NA	NA
WP_011259287.1|1712798_1714049_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259288.1|1714116_1715178_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_075242610.1|1715320_1716361_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_011408727.1|1716445_1716733_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_011408728.1|1716729_1718079_+	dihydroorotase	NA	NA	NA	NA	NA
WP_011408729.1|1718078_1718918_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.4e-13
WP_094187715.1|1719816_1720579_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259294.1|1720605_1720869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444728.1|1721240_1721729_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_011408734.1|1721952_1723272_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1723408_1724377_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181979.1|1724576_1725893_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444725.1|1726252_1727434_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_011259303.1|1729022_1730693_+	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
WP_011259304.1|1730909_1731599_-	phytoene synthase	NA	NA	NA	NA	NA
WP_011408736.1|1731627_1732332_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_011259306.1|1732405_1733125_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_027703270.1|1733155_1734493_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_041182450.1|1734512_1735316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002802373.1|1735507_1736074_-	elongation factor P	NA	NA	NA	NA	NA
WP_011408738.1|1736175_1737204_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_011259310.1|1737422_1739540_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011259311.1|1739536_1740466_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011408739.1|1740517_1741282_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_011408740.1|1741400_1742234_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_011259314.1|1742486_1743098_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	69.8	1.1e-79
WP_011259315.1|1743352_1743793_+	ribonuclease	NA	NA	NA	NA	NA
WP_011259316.1|1743789_1744215_+	barstar family protein	NA	NA	NA	NA	NA
WP_011259317.1|1744663_1746559_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.8	1.4e-48
WP_103057284.1|1746648_1748025_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	2.1e-54
WP_011259319.1|1748127_1748688_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.2	1.6e-29
WP_011408741.1|1748785_1750342_-	YdiU family protein	NA	NA	NA	NA	NA
WP_011408742.1|1750625_1751501_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408743.1|1751701_1752400_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011408744.1|1752570_1752780_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	62.3	2.8e-16
WP_011408745.1|1753049_1753535_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_011259325.1|1753605_1754154_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_011259326.1|1754150_1755332_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_115877446.1|1755555_1757625_+	GGDEF and EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011259328.1|1757724_1758603_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_011259329.1|1758700_1759600_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011408747.1|1759687_1760428_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011259331.1|1760587_1761163_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408749.1|1761336_1762308_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_011408750.1|1762341_1763283_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259334.1|1763282_1765160_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_012444702.1|1765297_1767031_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_011259336.1|1767083_1767584_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_075243426.1|1767580_1769068_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_069959886.1|1769092_1770160_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_094187715.1|1770274_1771038_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	1774233	1860110	4900521	tRNA,transposase,protease	Bacillus_phage(18.18%)	57	NA	NA
WP_094187754.1|1774233_1774981_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182165.1|1775297_1777133_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
WP_041182166.1|1777404_1778496_+	ribonuclease D	NA	NA	NA	NA	NA
WP_011259345.1|1779588_1779990_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_015463309.1|1780853_1781033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703932.1|1781634_1781925_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011408759.1|1781912_1782191_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_080256628.1|1782675_1782864_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408760.1|1783636_1784821_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_109181928.1|1785401_1786367_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042465594.1|1790931_1791276_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_011408764.1|1791486_1791813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259352.1|1791845_1792286_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
WP_011259353.1|1792364_1793000_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_011259354.1|1793393_1794152_-	cytochrome c1	NA	NA	NA	NA	NA
WP_011259355.1|1794144_1795404_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_011259356.1|1795403_1796048_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011259357.1|1796577_1797564_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_011408766.1|1799499_1800954_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011408767.1|1801377_1802364_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_011259362.1|1802775_1803438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259363.1|1803492_1803978_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011408769.1|1803977_1804496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408770.1|1804590_1805469_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011259366.1|1805465_1806746_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011259367.1|1806761_1807763_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_011408772.1|1807914_1809279_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011408773.1|1809533_1809944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408774.1|1810099_1810930_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075240820.1|1811243_1812491_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011408777.1|1812636_1814130_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408778.1|1814134_1815721_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408779.1|1815717_1816920_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_115840172.1|1817426_1818815_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408781.1|1819048_1820434_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_011259377.1|1821341_1822721_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_011408783.1|1822720_1824037_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011259379.1|1824119_1825418_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	2.7e-19
WP_011408784.1|1825725_1827006_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_162828805.1|1827311_1827590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259381.1|1827579_1829928_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_011259382.1|1829924_1830770_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_011408786.1|1830776_1832501_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_075242096.1|1832643_1832826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182012.1|1832858_1833621_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259384.1|1833846_1835199_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011408787.1|1835259_1838397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408788.1|1838563_1839418_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
WP_011408789.1|1839588_1840893_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_113079202.1|1841034_1845129_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.9e-55
WP_011259389.1|1845162_1846149_+	response regulator	NA	W8CYM9	Bacillus_phage	26.8	2.8e-05
WP_011408791.1|1846273_1847257_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.4e-97
WP_011408792.1|1847705_1852730_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_011408793.1|1853007_1853667_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408794.1|1853681_1854986_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259395.1|1854998_1858169_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_109181969.1|1859144_1860110_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	1869464	1939058	4900521	transposase	uncultured_Caudovirales_phage(61.54%)	47	NA	NA
WP_011258188.1|1869464_1870433_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409735.1|1870645_1871965_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_069959892.1|1872204_1874550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|1874567_1875296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959894.1|1875324_1877667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465604.1|1877691_1878435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115840173.1|1878465_1881300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964550.1|1881296_1882226_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069964551.1|1882234_1884997_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.2	1.5e-43
WP_082325566.1|1886562_1889052_-	avirulence protein	NA	NA	NA	NA	NA
WP_041182637.1|1889091_1889481_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_157724569.1|1889641_1890595_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|1890527_1890842_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_011408815.1|1891069_1892389_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259409.1|1893493_1893910_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_011259410.1|1893906_1894353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259411.1|1894595_1895231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|1895730_1896699_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_125168758.1|1897355_1897856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465618.1|1898164_1901266_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042465003.1|1902255_1902708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756758.1|1902962_1904768_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_125168759.1|1904769_1905117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756757.1|1905192_1905900_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	8.4e-52
WP_011408825.1|1906051_1906444_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011408826.1|1906490_1906982_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703781.1|1906978_1907332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259417.1|1907420_1908161_+	flagellar motor protein	NA	NA	NA	NA	NA
WP_011408827.1|1908167_1909142_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_011259419.1|1909143_1909926_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_042465006.1|1909922_1910945_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259421.1|1911045_1911354_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_002806565.1|1911350_1911716_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011408829.1|1911749_1913759_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011408830.1|1913926_1914181_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075242680.1|1915859_1916549_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.3	8.3e-12
WP_011408833.1|1916864_1917626_+	transporter	NA	NA	NA	NA	NA
WP_011408834.1|1917639_1919982_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	4.5e-09
WP_115840174.1|1920478_1921444_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_044756755.1|1921683_1923930_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	2.9e-13
WP_042465628.1|1924658_1926770_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.2e-14
WP_069959907.1|1927454_1929530_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.3e-12
WP_011259431.1|1930122_1932384_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
WP_011408839.1|1932777_1935039_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_011408840.1|1936008_1936794_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_011408841.1|1936929_1937412_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_094187763.1|1938260_1939058_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	2020106	2031881	4900521	tRNA	Escherichia_phage(22.22%)	12	NA	NA
WP_011259503.1|2020106_2020406_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
WP_011259504.1|2020448_2020679_-	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259505.1|2020922_2021672_-	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011408881.1|2021676_2022372_-	hypothetical protein	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_012444559.1|2022557_2022857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057240.1|2023244_2023649_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	56.6	1.1e-32
WP_003481884.1|2024374_2024587_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_011259507.1|2024726_2027375_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_012444556.1|2027476_2027965_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011408884.1|2028267_2029302_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_011408885.1|2029474_2030116_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408886.1|2030204_2031881_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 20
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	2220525	2342311	4900521	tRNA,transposase	Ralstonia_phage(17.39%)	88	NA	NA
WP_109181928.1|2220525_2221491_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408430.1|2221511_2222315_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011408429.1|2222454_2223603_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011408428.1|2223829_2224474_+	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
WP_011258853.1|2224470_2225166_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_011408427.1|2225260_2226013_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_011258852.1|2226009_2226180_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011258851.1|2226176_2226647_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011408426.1|2226815_2228753_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011258849.1|2228745_2229348_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_011258848.1|2229344_2229776_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_041182103.1|2229775_2230789_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011258845.1|2231078_2232950_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011408424.1|2232946_2233246_-	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_011258843.1|2233280_2234699_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011258842.1|2234907_2236149_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
WP_011258841.1|2236304_2236892_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_033013325.1|2237037_2238510_+	amino acid permease	NA	NA	NA	NA	NA
WP_069959832.1|2238586_2240017_+	amino acid permease	NA	NA	NA	NA	NA
WP_011408418.1|2240105_2240783_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_011408417.1|2240794_2241361_+	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_011408416.1|2241363_2242062_+	acireductone synthase	NA	NA	NA	NA	NA
WP_042464827.1|2242389_2243475_+	peptidase C13	NA	NA	NA	NA	NA
WP_011408412.1|2245306_2246626_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_069959831.1|2246914_2251042_+	avirulence protein	NA	NA	NA	NA	NA
WP_115877447.1|2254225_2257930_+	avirulence protein	NA	NA	NA	NA	NA
WP_042464821.1|2258198_2258393_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011408408.1|2258396_2258696_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_153296780.1|2264245_2264512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258825.1|2265202_2266216_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408405.1|2266315_2266900_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_011407175.1|2266963_2267932_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011408404.1|2268144_2269464_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187728.1|2269903_2270701_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258822.1|2270851_2272201_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_011408403.1|2272312_2272972_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_027704061.1|2273332_2273800_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_109181933.1|2273986_2275088_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
WP_011258803.1|2276265_2277234_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011258802.1|2277425_2278394_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258800.1|2279254_2280454_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_011258799.1|2280602_2280785_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_011408398.1|2281106_2282582_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
WP_011408397.1|2282636_2283821_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181928.1|2284265_2285231_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2286583_2287552_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408388.1|2287710_2288058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258793.1|2288059_2288827_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_109181926.1|2289897_2290695_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258790.1|2290906_2293435_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
WP_042464810.1|2294001_2295447_-	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
WP_042464808.1|2295818_2295959_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011408383.1|2295958_2297140_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011258786.1|2297228_2298224_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_103057265.1|2298220_2299360_+	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
WP_011408381.1|2299502_2302256_+	methionine synthase	NA	NA	NA	NA	NA
WP_011408380.1|2302642_2303848_-	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_011408379.1|2303844_2304831_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011408378.1|2304827_2306138_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_041182423.1|2306151_2307327_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_042464805.1|2307467_2308313_-	transporter	NA	NA	NA	NA	NA
WP_042464803.1|2308646_2309399_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_011258777.1|2309399_2309636_-	protein SlyX	NA	NA	NA	NA	NA
WP_011408374.1|2309628_2310978_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
WP_027703707.1|2311003_2311969_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408372.1|2312060_2312618_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_042464800.1|2312753_2313002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408371.1|2313004_2313367_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011258772.1|2313363_2314239_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_075242602.1|2314235_2315222_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011258770.1|2315231_2316068_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_042464794.1|2316700_2317123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408367.1|2317245_2318649_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_109181925.1|2320100_2320864_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258759.1|2323887_2325255_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_011258758.1|2325496_2325997_+	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_041182090.1|2326276_2326540_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011408362.1|2326877_2328377_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408361.1|2328373_2329306_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011258754.1|2329486_2332315_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_011258753.1|2332357_2333560_+	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_011258752.1|2333801_2335238_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
WP_011258751.1|2335436_2336030_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
WP_027703751.1|2336288_2336891_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	4.8e-16
WP_011408359.1|2336887_2338657_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
WP_011258748.1|2338995_2339601_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408358.1|2339730_2340657_+	TolC family protein	NA	NA	NA	NA	NA
WP_011408357.1|2340991_2342311_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	2393528	2449116	4900521	coat,transposase,protease	Acidithiobacillus_phage(25.0%)	42	NA	NA
WP_011408331.1|2393528_2394053_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_011408330.1|2394061_2394832_+	molecular chaperone	NA	NA	NA	NA	NA
WP_011258704.1|2394848_2397200_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011258703.1|2397196_2398231_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_041182086.1|2398277_2398610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408326.1|2398612_2399338_+	molecular chaperone	NA	NA	NA	NA	NA
WP_011258701.1|2399713_2400517_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011258700.1|2400686_2401565_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_011408325.1|2401692_2402070_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258698.1|2402126_2402849_+	UMP kinase	NA	NA	NA	NA	NA
WP_011258697.1|2403029_2403587_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_027703358.1|2403604_2404366_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258695.1|2404362_2405190_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258694.1|2405192_2406383_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_011408324.1|2406409_2407756_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_012445188.1|2407839_2410206_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_069959820.1|2410605_2411619_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|2411615_2412077_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_011258689.1|2412100_2412892_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_027703356.1|2412930_2414187_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011408322.1|2414183_2414924_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
WP_011408321.1|2415381_2418972_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
WP_011258685.1|2419147_2420107_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_042464756.1|2420946_2423127_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258682.1|2423126_2423864_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
WP_011258681.1|2423860_2425273_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_012445196.1|2427374_2427641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408317.1|2427718_2428165_-	membrane protein	NA	NA	NA	NA	NA
WP_011408316.1|2428238_2428841_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012445197.1|2428981_2430325_+	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_011258676.1|2430797_2431361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256646.1|2435055_2435226_+	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_011408313.1|2435239_2435656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325258.1|2436454_2437936_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.7	3.7e-102
WP_011408311.1|2437978_2438374_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_082323429.1|2438413_2439790_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.0e-78
WP_011258670.1|2441420_2442095_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_011258669.1|2442099_2442876_+	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_069959816.1|2443296_2445234_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_011408306.1|2445415_2446393_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_011408305.1|2446389_2447787_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_011408304.1|2448057_2449116_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	2468680	2528078	4900521	transposase,protease	Tupanvirus(18.18%)	52	NA	NA
WP_109181916.1|2468680_2469442_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408285.1|2469727_2471098_-	virulence factor family protein	NA	NA	NA	NA	NA
WP_011258646.1|2471167_2471362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258645.1|2471421_2472030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408284.1|2472065_2472668_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011258643.1|2472941_2473397_-	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_103057305.1|2475319_2476531_-	MFS transporter	NA	NA	NA	NA	NA
WP_011408282.1|2476751_2477870_+	alkene reductase	NA	NA	NA	NA	NA
WP_075239156.1|2478760_2479051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408280.1|2479339_2479675_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_011408279.1|2479789_2480839_+	cation transporter	NA	NA	NA	NA	NA
WP_011408277.1|2482510_2482984_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_012445232.1|2483123_2484500_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_011258635.1|2484689_2484875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181915.1|2485267_2486587_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182418.1|2488074_2488641_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_011258631.1|2488831_2489098_-	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_011258630.1|2489272_2489527_+	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258629.1|2489687_2489861_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_041182081.1|2490262_2490790_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258627.1|2491258_2492359_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_011258626.1|2492419_2495248_-|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011408270.1|2495403_2496579_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011408269.1|2496701_2497046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258624.1|2497275_2497602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408268.1|2497710_2499420_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	2.1e-16
WP_011408267.1|2499517_2500108_+	cell shape determination protein CcmA	NA	NA	NA	NA	NA
WP_011258621.1|2500104_2500470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408265.1|2500806_2501829_+	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_011258619.1|2501825_2502059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408264.1|2502055_2503660_+	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	36.6	4.9e-15
WP_011408263.1|2503656_2506158_+	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_014504008.1|2506147_2506792_+	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_003488188.1|2508302_2508509_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_011408258.1|2508595_2509348_-	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_011408257.1|2509433_2509988_-	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011408256.1|2509987_2510992_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_011408255.1|2511109_2512687_-	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	25.6	2.2e-44
WP_011408254.1|2512867_2513902_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041182416.1|2513918_2514602_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_011408252.1|2514721_2516098_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_011257310.1|2516326_2517562_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258607.1|2517657_2518155_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_011408251.1|2518329_2519664_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	27.2	1.0e-29
WP_011408250.1|2519822_2520545_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011258604.1|2520693_2521416_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011258603.1|2521639_2522539_-	GTPase Era	NA	NA	NA	NA	NA
WP_011258602.1|2522535_2523216_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.4	1.7e-17
WP_011258601.1|2523205_2523583_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011258600.1|2523613_2524414_-	signal peptidase I	NA	NA	NA	NA	NA
WP_041182078.1|2524520_2526311_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.5	3.5e-22
WP_011408249.1|2526491_2528078_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	6.5e-28
>prophage 23
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	2622066	2702017	4900521	tRNA,transposase	Bacillus_phage(18.18%)	53	NA	NA
WP_011258802.1|2622066_2623035_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408202.1|2623940_2625185_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012445311.1|2625181_2625460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408200.1|2625537_2625939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408199.1|2626221_2626593_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_075243684.1|2626589_2626886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408198.1|2627057_2627360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258527.1|2627596_2629060_+	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_011408197.1|2629195_2631538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408196.1|2631817_2633659_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_113079198.1|2633708_2636240_-	type III secretion system effector protein XopK	NA	NA	NA	NA	NA
WP_113051296.1|2636857_2637058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408191.1|2637400_2638636_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258521.1|2639135_2640239_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_011408189.1|2640380_2642339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258519.1|2642363_2643095_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011258518.1|2643091_2644156_-	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_011408185.1|2648777_2649860_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258513.1|2649871_2650495_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011258512.1|2650745_2651222_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011408184.1|2651255_2652458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113079163.1|2652465_2659407_-	response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
WP_011258510.1|2659520_2661557_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
WP_003482487.1|2661596_2662127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258508.1|2662126_2662489_-	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
WP_005913706.1|2662506_2662908_-	response regulator	NA	NA	NA	NA	NA
WP_044756943.1|2663157_2664108_+	glutathione synthase	NA	NA	NA	NA	NA
WP_011258506.1|2664104_2664980_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258505.1|2665274_2666189_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	48.5	1.2e-63
WP_011408180.1|2666185_2666905_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011408179.1|2666918_2668946_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	4.6e-95
WP_011408178.1|2669145_2669670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959810.1|2669683_2672128_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_044756949.1|2672369_2674472_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_042465507.1|2674804_2676247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464698.1|2676571_2678758_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002812057.1|2679047_2679128_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_011258497.1|2679211_2680111_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_011408174.1|2680107_2680860_+	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_011408173.1|2680856_2681135_+	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_011408172.1|2681131_2682250_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_011408171.1|2682312_2682825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|2683135_2683899_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182063.1|2684069_2685584_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_011408167.1|2687025_2689668_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_069959809.1|2689888_2694010_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
WP_011408166.1|2694111_2694657_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_069959808.1|2695212_2697009_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	2.6e-81
WP_011408165.1|2697147_2697645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408164.1|2697723_2698128_+	response regulator	NA	NA	NA	NA	NA
WP_008578058.1|2698758_2699433_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_069959795.1|2699811_2701188_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	1.1e-58
WP_094187715.1|2701254_2702017_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	2764589	2911688	4900521	tRNA,transposase	Ralstonia_phage(19.23%)	116	NA	NA
WP_011258399.1|2764589_2767421_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
WP_011408095.1|2767427_2768444_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_011408094.1|2768642_2770247_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_003484323.1|2770363_2770633_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_011258396.1|2770724_2771777_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_011258395.1|2772009_2772270_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_011258394.1|2772282_2772603_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_012444462.1|2772895_2775862_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.8	3.3e-307
WP_075242206.1|2775858_2776266_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011258392.1|2776379_2776844_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_011408091.1|2776867_2777638_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_011408090.1|2777708_2778614_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_011408089.1|2778841_2779345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408088.1|2779456_2780200_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_041182403.1|2780454_2780910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181906.1|2781054_2781853_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408086.1|2781895_2782477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464672.1|2782537_2783452_+	arginyltransferase	NA	NA	NA	NA	NA
WP_027703288.1|2783405_2784737_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011258382.1|2785041_2786643_-	membrane protein	NA	NA	NA	NA	NA
WP_027703287.1|2787088_2788165_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_011408082.1|2788260_2788734_-	DUF3574 domain-containing protein	NA	NA	NA	NA	NA
WP_011408081.1|2788969_2791405_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	22.5	2.6e-12
WP_027703286.1|2791953_2792502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182043.1|2792727_2793486_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_011408078.1|2793530_2795309_+	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_011258376.1|2795305_2796673_+	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_011258374.1|2796922_2797303_-	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_027703285.1|2797277_2797802_-	DUF4166 domain-containing protein	NA	NA	NA	NA	NA
WP_011258372.1|2797804_2798611_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_011408077.1|2798618_2799614_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_011258370.1|2799734_2800616_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_011408076.1|2800773_2802429_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.0	9.3e-94
WP_011408075.1|2802860_2803157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258368.1|2803476_2804352_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_011258367.1|2804376_2805546_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_011258366.1|2805779_2807393_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011408074.1|2807723_2809115_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703281.1|2809187_2809394_+	DUF2559 family protein	NA	NA	NA	NA	NA
WP_011408072.1|2809973_2811707_-	type IV-A pilus assembly ATPase PilB	NA	NA	NA	NA	NA
WP_042464666.1|2811741_2813268_-	membrane protein	NA	NA	NA	NA	NA
WP_027703278.1|2813237_2813897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408069.1|2813877_2815467_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_011408068.1|2815601_2816027_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011408067.1|2816381_2817641_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_011258358.1|2817647_2818511_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_011258357.1|2818524_2819133_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_115801881.1|2819203_2820523_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158645227.1|2821083_2821386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182041.1|2821369_2822326_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	1.1e-41
WP_011258802.1|2823017_2823986_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408064.1|2824155_2824524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168748.1|2826039_2826369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168747.1|2826365_2826665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258803.1|2826813_2827782_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_128415435.1|2827833_2828322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408063.1|2828321_2832812_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_109181904.1|2834109_2835429_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|2835471_2836234_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258344.1|2836310_2838143_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_011258343.1|2838274_2838865_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_011408060.1|2838930_2841987_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011258341.1|2841983_2843087_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011258340.1|2843112_2843949_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011408058.1|2843968_2845438_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408057.1|2845543_2846233_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_011408056.1|2846229_2847423_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	5.2e-22
WP_011258336.1|2847481_2848747_-	potassium transporter	NA	NA	NA	NA	NA
WP_075241746.1|2848893_2850570_-	serine hydrolase	NA	NA	NA	NA	NA
WP_011258334.1|2850511_2851012_-	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
WP_011408053.1|2853931_2854654_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011408052.1|2854803_2857200_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_011258329.1|2857463_2859368_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_113055161.1|2860044_2860707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258326.1|2860735_2860978_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_011258325.1|2861323_2861725_-	membrane protein	NA	NA	NA	NA	NA
WP_011258324.1|2861750_2862284_-	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_011258323.1|2862686_2862941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408047.1|2864401_2865865_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011408046.1|2865861_2866407_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_011258802.1|2866757_2867726_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258317.1|2869256_2870702_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_011258316.1|2870774_2871815_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011408042.1|2871947_2872130_-	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258314.1|2872429_2872840_-	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_041182034.1|2878113_2879070_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	1.0e-39
WP_011408038.1|2879121_2879532_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011258309.1|2879630_2880356_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_012444398.1|2880772_2882191_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	3.3e-47
WP_011408037.1|2882293_2883724_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_011258306.1|2883945_2884500_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011258305.1|2884716_2886657_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_011408036.1|2886832_2887471_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011258301.1|2889704_2890880_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011408033.1|2891025_2891817_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258299.1|2891962_2892178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053503314.1|2892177_2892945_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_053503313.1|2893006_2893837_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_053503312.1|2893909_2894338_+	cytochrome c	NA	NA	NA	NA	NA
WP_014503861.1|2894469_2894949_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_014503862.1|2895198_2895414_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_113079221.1|2895641_2896127_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|2897688_2897892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408025.1|2898669_2899128_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408024.1|2899533_2900040_-	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_011258289.1|2900053_2901457_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_069960180.1|2901525_2902629_-	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_075242217.1|2902650_2903382_-	nitrilase	NA	NA	NA	NA	NA
WP_011407237.1|2903455_2904412_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011408021.1|2904710_2905298_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_011408020.1|2905528_2906341_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408019.1|2906371_2907535_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
WP_011408018.1|2907693_2908077_-	membrane protein	NA	NA	NA	NA	NA
WP_011408017.1|2908592_2909405_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408016.1|2909465_2910524_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.1e-71
WP_011408015.1|2910518_2911688_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
>prophage 25
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	3137160	3290350	4900521	plate,transposase	Ralstonia_phage(50.0%)	105	NA	NA
WP_011257854.1|3137160_3138396_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011258091.1|3138817_3140206_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258090.1|3140961_3141903_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_011407882.1|3142216_3142981_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407881.1|3143173_3144556_+	APC family permease	NA	NA	NA	NA	NA
WP_011407879.1|3145010_3146408_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_011407877.1|3146970_3147369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258085.1|3147513_3148518_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011258084.1|3148555_3150073_-	tryptophan 7-halogenase	NA	A0A1D7SEI2	Cyanophage	32.3	8.1e-52
WP_011407876.1|3150113_3151160_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407875.1|3151170_3151923_-	SapC family protein	NA	NA	NA	NA	NA
WP_011407874.1|3152254_3155413_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407873.1|3156459_3158466_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258079.1|3158685_3159132_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_011258077.1|3161111_3162278_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.1	5.8e-74
WP_011407870.1|3162279_3162852_-	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	27.7	1.1e-09
WP_011407869.1|3162864_3163269_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_012445805.1|3163306_3163984_-	YjfK family protein	NA	NA	NA	NA	NA
WP_011407867.1|3163980_3165063_-	potassium channel protein	NA	NA	NA	NA	NA
WP_011258072.1|3165088_3165862_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_012445807.1|3165874_3166291_-	YjfI family protein	NA	NA	NA	NA	NA
WP_011258070.1|3166471_3167071_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_011258069.1|3167237_3167780_+	shikimate kinase	NA	NA	NA	NA	NA
WP_011407865.1|3167776_3168889_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_011407864.1|3169190_3169442_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_011407863.1|3169456_3170521_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_011407860.1|3171992_3175709_+	avirulence protein	NA	NA	NA	NA	NA
WP_011408408.1|3176176_3176476_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_115840176.1|3176699_3181349_+	avirulence protein	NA	NA	NA	NA	NA
WP_012444515.1|3182411_3183887_-|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	5.4e-101
WP_011408934.1|3183969_3186558_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011259580.1|3186614_3187727_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259581.1|3187851_3188430_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042465046.1|3189916_3192004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959920.1|3192389_3193487_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465048.1|3193903_3196984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033013236.1|3200019_3200727_+	response regulator	NA	NA	NA	NA	NA
WP_011408941.1|3200723_3201716_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259589.1|3201712_3204172_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_011259590.1|3204285_3205266_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041182188.1|3205274_3206303_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_113079223.1|3206475_3206802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703483.1|3206798_3209702_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_011259593.1|3209698_3210421_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_041182189.1|3210417_3211065_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_113079225.1|3211061_3214520_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011408948.1|3214523_3215840_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_011408949.1|3215841_3217179_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_069959924.1|3217175_3218567_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_011408951.1|3218563_3219103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444497.1|3219111_3221049_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
WP_011408952.1|3221313_3221772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168760.1|3222159_3222654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703476.1|3222719_3223217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408953.1|3223405_3226111_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	4.3e-80
WP_011408954.1|3226143_3227154_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011259602.1|3227117_3228995_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259603.1|3228998_3229502_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011259604.1|3229489_3230323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259605.1|3230358_3230862_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_027703472.1|3230961_3232476_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_024711387.1|3232468_3232975_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011257031.1|3234333_3235302_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_069964543.1|3235437_3236754_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260830.1|3236924_3238160_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3238345_3239314_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408960.1|3239365_3241282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259611.1|3241306_3242044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408961.1|3242074_3244417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465640.1|3244434_3245181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465052.1|3245209_3248044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465054.1|3248701_3250531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445381.1|3250544_3251144_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_012445382.1|3251231_3251588_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_012445383.1|3251584_3252007_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408967.1|3252022_3252256_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_069960235.1|3252282_3252543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704270.1|3252891_3254676_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_027704269.1|3254708_3255695_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_042465057.1|3256105_3259819_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_094187765.1|3260344_3261108_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445389.1|3261211_3261859_-	response regulator	NA	NA	NA	NA	NA
WP_011408973.1|3262080_3262842_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011258802.1|3262999_3263968_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408974.1|3264101_3264467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408975.1|3264525_3264957_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011259625.1|3264968_3266231_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408976.1|3266214_3267507_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011408977.1|3267876_3268647_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011259629.1|3269403_3270639_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011408979.1|3271938_3272196_-	stress-induced protein	NA	NA	NA	NA	NA
WP_115840177.1|3272635_3273619_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	1.5e-99
WP_011258802.1|3273934_3274903_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408981.1|3275031_3275994_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_153296740.1|3276243_3276402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182195.1|3276433_3276613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|3276977_3277943_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408985.1|3279150_3280128_+	siroheme synthase	NA	NA	NA	NA	NA
WP_042465070.1|3280936_3281131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408987.1|3282524_3282887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408988.1|3282870_3283440_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_011259640.1|3283477_3284731_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011408989.1|3284936_3285314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408991.1|3287242_3288478_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|3289315_3290350_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 26
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	3431480	3491793	4900521	tRNA,transposase,protease	Burkholderia_virus(14.29%)	49	NA	NA
WP_094187736.1|3431480_3432244_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259756.1|3433267_3435634_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011409066.1|3435630_3436305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259758.1|3436514_3437453_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011259759.1|3437575_3438925_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259760.1|3438921_3439809_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011409067.1|3440126_3440933_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011259762.1|3441378_3442596_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011409068.1|3442701_3443670_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
WP_011259764.1|3444012_3444681_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_011259765.1|3444677_3445451_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_075241401.1|3446024_3447977_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|3448657_3449683_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409070.1|3449767_3450841_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259771.1|3450833_3451937_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_011259772.1|3451947_3452874_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011259773.1|3452954_3453605_+	SCO family protein	NA	NA	NA	NA	NA
WP_027703264.1|3453601_3454450_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_041182211.1|3455000_3456584_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_103057205.1|3458006_3459224_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_153296738.1|3459184_3459472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409076.1|3459582_3460089_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_011259780.1|3460210_3461611_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_012445553.1|3461873_3462449_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011409078.1|3462445_3462880_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259783.1|3463726_3463912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|3463946_3464516_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259785.1|3464608_3465460_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259787.1|3466847_3468863_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445555.1|3469133_3469832_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409081.1|3469872_3470280_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_011409082.1|3470717_3471680_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409084.1|3472963_3474214_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011409085.1|3474221_3475466_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011259794.1|3475693_3476173_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027704197.1|3476283_3476820_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259796.1|3476929_3477679_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_011259797.1|3477886_3478378_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011409088.1|3479491_3480811_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_069963877.1|3480954_3482661_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011409090.1|3482694_3483999_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259802.1|3484030_3484291_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011409091.1|3484292_3485168_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027704198.1|3487002_3487467_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|3487518_3487707_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_069963878.1|3487679_3488000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465665.1|3487996_3489364_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011409095.1|3489509_3490091_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_011259808.1|3490347_3491793_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 27
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	3510893	3559595	4900521	tRNA,transposase,integrase	Ralstonia_phage(33.33%)	38	3533712:3533771	3550382:3551045
WP_011409106.1|3510893_3513536_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_011259826.1|3513608_3514220_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011409107.1|3514424_3515282_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011409108.1|3515537_3515987_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_109181928.1|3516286_3517252_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_115877448.1|3517376_3518139_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704065.1|3518749_3519043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259829.1|3519516_3519750_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_011409111.1|3519783_3520797_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259831.1|3520764_3520956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801901.1|3521046_3522366_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182217.1|3522453_3523668_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_011259834.1|3523813_3524341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115840178.1|3524337_3525303_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187771.1|3525543_3526306_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409116.1|3526608_3528741_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011258529.1|3529291_3530260_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011257031.1|3530451_3531420_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_115840192.1|3531564_3532530_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_048488802.1|3532576_3532909_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|3532905_3533669_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
3533712:3533771	attL	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTC	NA	NA	NA	NA
WP_094187763.1|3534540_3535338_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409118.1|3535371_3535764_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_027704094.1|3535854_3536247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239728.1|3538585_3539005_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
WP_012445601.1|3540721_3542506_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_011259851.1|3542696_3542897_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011409125.1|3543432_3544227_+	thiazole synthase	NA	NA	NA	NA	NA
WP_011259853.1|3544528_3545287_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011259854.1|3545362_3547225_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_011409127.1|3547282_3547624_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259856.1|3547883_3548159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409129.1|3551205_3551919_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
3550382:3551045	attR	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTCAGCACAAGCCCAAACGCGGATGACGGCGTACAACGGCGGCCACACGCAGCTGGGTGCCGGAGGAGTTGCGGATTGTGCATCGCCCCGAAGAAGTGCAGACGCGCTTGGTCCCAGGTCATTGGGAAGGCGACTTGATCAAGGGCGCATTCAATCGTTCTTGCGTGGGCACGTTGGTGGAACGCAAGACGCGCTTTGTCGTGCTGTGCCGCATGGATGGCTGCACGGCCGCAGATGCGCTGGAAGGGTTTACCCGGCAAATGAAGAAACTGCCGGCCTCAATGCGGACAAGTCTGACCTACGATCGCGGTACCGAGCTCACGTGCTACGCCGAGCTGATGCAAGGATTGAACATCGACGTGTGGTTCGCTGATCCACATGCGCCGTGGCAGCGGGGAAGTAACGAGAACACCAACGGCCTGCTGCGCCAATTCCTGCCCAAGGGCGCCGACCTGTCCACTGTCAGCCAAGAGTATCTCAATCACATCGCACTGCTGATGAATACCCGCCCTCGTCAGACGCTCGGATGGAAGACACCAAGCGAGGCAATGGAGGAAGAAATCGCAGCACTCAAATCACGTGTTGCACTTGAATCTTGAGACTGCCC	NA	NA	NA	NA
WP_012445603.1|3551979_3552402_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_094187715.1|3552533_3553297_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409134.1|3556370_3557282_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_033013519.1|3557797_3557935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801902.1|3558629_3559595_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	3607045	3651621	4900521	transposase	Ralstonia_phage(50.0%)	32	NA	NA
WP_011407175.1|3607045_3608014_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407587.1|3609034_3610069_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011259895.1|3610452_3611178_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409154.1|3611309_3611771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704153.1|3615217_3617338_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_027704154.1|3617604_3618450_-	transporter	NA	NA	NA	NA	NA
WP_011257031.1|3619441_3620410_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011259903.1|3620734_3622705_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_011259904.1|3623133_3624531_+	endoproteinase ArgC	NA	NA	NA	NA	NA
WP_027704156.1|3624643_3625462_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011259907.1|3625772_3629024_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	6.1e-81
WP_011259908.1|3629205_3630624_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_011259909.1|3630633_3631284_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011409164.1|3631285_3631891_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
WP_011259911.1|3632040_3632262_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409165.1|3632271_3632697_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
WP_094187731.1|3633188_3633986_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409167.1|3635063_3635843_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409168.1|3636057_3636687_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027704159.1|3636747_3637503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182227.1|3637831_3638608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182229.1|3639016_3640591_+	protein kinase	NA	NA	NA	NA	NA
WP_011409172.1|3640839_3641106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409173.1|3641384_3644564_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.3	1.2e-73
WP_011258802.1|3644629_3645598_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407756.1|3645797_3647117_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011409174.1|3647200_3647875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409175.1|3647874_3648621_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_011409176.1|3648617_3649151_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011258529.1|3649276_3650245_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_113079192.1|3650359_3650650_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011258803.1|3650652_3651621_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
>prophage 29
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	3667885	3726588	4900521	plate,transposase	Staphylococcus_prophage(20.0%)	38	NA	NA
WP_069970072.1|3667885_3668842_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_082325322.1|3668816_3671255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182737.1|3671166_3672198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325323.1|3672206_3674144_-	DUF3784 domain-containing protein	NA	NA	NA	NA	NA
WP_011409194.1|3674055_3675075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325324.1|3675079_3677023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325325.1|3676934_3677957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409198.1|3679921_3680947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325327.1|3680950_3683818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113079154.1|3683836_3684742_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_082325328.1|3684683_3687446_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	9.6e-43
WP_011259938.1|3687538_3687892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259939.1|3687922_3690652_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_011259940.1|3690737_3691829_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_069959967.1|3691792_3693628_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011409203.1|3693630_3694119_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003467612.1|3694266_3694764_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011409204.1|3694905_3696402_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467601.1|3696405_3696906_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_033005590.1|3696952_3697441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409206.1|3697827_3698436_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011409207.1|3698587_3699922_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_113079215.1|3699921_3700710_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_115840179.1|3700720_3703438_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_075242365.1|3703434_3704412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168764.1|3704386_3704962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115840180.1|3704970_3707139_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011259950.1|3707163_3710058_+	calcium-binding protein	NA	A0A2D1GNI0	Pseudomonas_phage	27.5	7.5e-06
WP_011409552.1|3710296_3711259_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_146770766.1|3711335_3711950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259951.1|3711972_3713406_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_075242326.1|3713409_3715665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129215583.1|3715639_3716185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259961.1|3718024_3718414_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_113079229.1|3718394_3720626_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011259963.1|3720625_3721222_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_041182243.1|3721214_3722039_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011258188.1|3725619_3726588_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 30
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	3775977	3786808	4900521	transposase	Burkholderia_virus(28.57%)	8	NA	NA
WP_042465718.1|3775977_3776781_-	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
WP_027703308.1|3777211_3777394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182486.1|3777865_3780820_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	49.9	5.3e-257
WP_011260010.1|3781149_3781599_+	hypothetical protein	NA	A4JWV5	Burkholderia_virus	34.1	3.3e-09
WP_113079227.1|3781595_3782291_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	46.1	2.2e-36
WP_011409251.1|3782298_3783369_+	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	36.6	5.7e-60
WP_011409252.1|3783365_3784451_+	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	37.9	4.0e-61
WP_011407237.1|3785851_3786808_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
>prophage 31
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	4094365	4189479	4900521	transposase	Ralstonia_phage(17.65%)	66	NA	NA
WP_115840193.1|4094365_4095973_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075242322.1|4096134_4096398_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_075242321.1|4096402_4097062_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
WP_011260279.1|4097248_4098613_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_011409411.1|4098828_4099524_+	VIT family protein	NA	NA	NA	NA	NA
WP_011409413.1|4100470_4101094_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011260283.1|4101238_4102036_+	cytochrome c4	NA	NA	NA	NA	NA
WP_011409415.1|4102129_4102780_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260284.1|4102871_4103687_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011409416.1|4103736_4104474_+	endonuclease	NA	NA	NA	NA	NA
WP_082325341.1|4106402_4107398_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.0	5.4e-97
WP_041182588.1|4107520_4110094_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_109182012.1|4110286_4111049_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|4111122_4112091_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011409421.1|4112824_4113091_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094187728.1|4114022_4114821_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|4116467_4117700_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_115840183.1|4117739_4118702_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|4118877_4119834_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011257031.1|4120045_4121014_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_094187715.1|4121349_4122112_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182027.1|4125522_4126488_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012444134.1|4126949_4127180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409428.1|4127804_4129847_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_011409429.1|4129848_4131747_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011260297.1|4131748_4133002_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_011260298.1|4132998_4133604_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_011409430.1|4134023_4135178_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_011260300.1|4135180_4136209_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_011409431.1|4136205_4137282_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260302.1|4137322_4138600_-	sugar MFS transporter	NA	NA	NA	NA	NA
WP_011409432.1|4138644_4139412_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409433.1|4139626_4140793_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_075242688.1|4140926_4143323_-	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_011260306.1|4143319_4146217_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
WP_011409436.1|4146367_4149058_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409437.1|4149339_4150296_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.6e-42
WP_011409439.1|4150786_4152022_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_103057228.1|4153457_4154642_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011409442.1|4154709_4155447_+	pteridine reductase	NA	NA	NA	NA	NA
WP_011260313.1|4155615_4156131_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011260314.1|4156222_4157725_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
WP_011260315.1|4157728_4158169_-	response regulator	NA	NA	NA	NA	NA
WP_011409443.1|4158165_4159977_-	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
WP_011260317.1|4160262_4160634_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_011260318.1|4160784_4161837_+	oxidoreductase	NA	NA	NA	NA	NA
WP_011260319.1|4162176_4163118_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
WP_075239460.1|4163138_4164476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409446.1|4164647_4165028_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_012444115.1|4165152_4165914_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_053504166.1|4168162_4169566_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	52.1	1.2e-131
WP_053504165.1|4169688_4170744_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.7e-80
WP_053504164.1|4170905_4171772_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_053504163.1|4172063_4174247_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.4	1.8e-81
WP_011260329.1|4174745_4175840_-	type II restriction enzyme	NA	NA	NA	NA	NA
WP_041182275.1|4175836_4177648_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_011260331.1|4177892_4178906_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_011260332.1|4178920_4179619_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_011409453.1|4179606_4179885_-	YbeD family protein	NA	NA	NA	NA	NA
WP_011260334.1|4180950_4182156_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
WP_011260335.1|4182656_4184072_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_011260336.1|4184068_4185208_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_125168765.1|4186433_4186976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409455.1|4186947_4188222_-	DUF3380 domain-containing protein	NA	B3FJ91	Pseudomonas_phage	33.7	1.2e-21
WP_075242420.1|4188221_4188440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409456.1|4188516_4189479_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	4215448	4297470	4900521	transposase,protease	Erwinia_phage(18.18%)	55	NA	NA
WP_011260359.1|4215448_4216816_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.1	6.2e-43
WP_011260360.1|4216926_4217478_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_011409475.1|4217993_4218911_-	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	27.7	2.2e-12
WP_011409476.1|4219110_4219782_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_011260363.1|4219778_4220633_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_011409477.1|4220622_4220859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409478.1|4220916_4221315_-	YbaN family protein	NA	NA	NA	NA	NA
WP_027703683.1|4221658_4223794_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	2.1e-29
WP_011409479.1|4223917_4225102_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011409480.1|4225427_4225859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409481.1|4225941_4228035_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409482.1|4228102_4228414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260370.1|4228801_4229371_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_011260371.1|4229479_4230445_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260372.1|4231003_4231804_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_011409484.1|4232354_4233269_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011409485.1|4233299_4234037_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011260375.1|4234067_4235120_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
WP_011260376.1|4235124_4235793_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011260377.1|4235944_4237882_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_094187780.1|4238608_4239371_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260378.1|4239685_4241335_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_011409489.1|4242725_4244213_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.7	1.0e-123
WP_011260380.1|4244420_4245869_+	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.3	7.5e-47
WP_011409492.1|4247103_4249728_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.6	1.9e-08
WP_011260383.1|4249983_4252854_+	insulinase family protein	NA	NA	NA	NA	NA
WP_041182280.1|4253401_4254331_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011409494.1|4254369_4255374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187782.1|4255616_4256380_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704042.1|4257427_4258213_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_011260388.1|4258466_4260140_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_011409497.1|4260683_4261130_-	autotransporter	NA	NA	NA	NA	NA
WP_012444053.1|4261460_4261745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260390.1|4262339_4263251_-	magnesium transporter	NA	NA	NA	NA	NA
WP_011409498.1|4263496_4264492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260392.1|4264585_4265962_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_041182283.1|4267182_4268829_+	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_011260394.1|4269237_4271010_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_011409500.1|4271285_4272161_-	DMT family transporter	NA	NA	NA	NA	NA
WP_027703846.1|4272358_4273237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260398.1|4275276_4276368_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_041182286.1|4278270_4280595_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260402.1|4280790_4282737_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409509.1|4283111_4283303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260404.1|4283693_4285277_+	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_027704189.1|4285624_4286221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409513.1|4287569_4288418_-	amino acid lyase	NA	NA	NA	NA	NA
WP_011409514.1|4288452_4289928_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
WP_011260408.1|4290518_4291448_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_011260409.1|4291682_4292174_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260410.1|4292170_4292842_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011409516.1|4293236_4293566_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_012444032.1|4293774_4294701_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.7	3.9e-49
WP_094187728.1|4295489_4296288_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|4296435_4297470_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 33
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	4318349	4360057	4900521	tRNA,transposase	Ralstonia_phage(50.0%)	37	NA	NA
WP_109182021.1|4318349_4319315_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260435.1|4319847_4320228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080493654.1|4320430_4321333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409537.1|4321404_4322700_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_011409538.1|4322829_4323354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260439.1|4323779_4325045_-	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409539.1|4325041_4326019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444011.1|4326122_4326926_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011260442.1|4327101_4327911_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_109182023.1|4327918_4328717_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465763.1|4328759_4329377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409543.1|4329501_4330077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181902.1|4330288_4331608_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|4331757_4332726_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011409546.1|4332851_4333604_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011260447.1|4333641_4334082_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_011409547.1|4334288_4334630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260449.1|4334855_4335233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260450.1|4335443_4335641_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_113079160.1|4335947_4336694_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409549.1|4336786_4337593_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_012444005.1|4337816_4339229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260454.1|4339225_4340323_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_094187763.1|4340477_4341276_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099051302.1|4341329_4342128_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409552.1|4342347_4343310_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_115840184.1|4343757_4344521_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260456.1|4344802_4345579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409554.1|4345575_4346892_+	amino acid permease	NA	NA	NA	NA	NA
WP_011408623.1|4347408_4348644_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260459.1|4349237_4349519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260461.1|4350079_4350514_-	membrane protein	NA	NA	NA	NA	NA
WP_011409559.1|4350688_4351867_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_069960023.1|4352862_4353825_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260467.1|4356158_4358330_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_011409563.1|4358557_4358914_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260469.1|4358992_4360057_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
>prophage 34
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	4383021	4441537	4900521	tRNA,transposase	Acinetobacter_phage(30.0%)	45	NA	NA
WP_094187805.1|4383021_4384000_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
WP_115877449.1|4384079_4385045_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_003483093.1|4385057_4385528_-	bacterioferritin	NA	NA	NA	NA	NA
WP_027703893.1|4385870_4386086_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011260490.1|4386166_4386784_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005990700.1|4387332_4387725_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260491.1|4387728_4388157_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_011260492.1|4388342_4388996_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_011409578.1|4389277_4389592_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260494.1|4389751_4390546_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_011260495.1|4390683_4391376_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_011409579.1|4391696_4392413_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011260497.1|4392405_4393203_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
WP_011409580.1|4393339_4394377_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_011260499.1|4394494_4395124_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011409581.1|4395275_4395857_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_094187806.1|4397284_4398386_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
WP_011409585.1|4398990_4401222_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011409586.1|4401411_4403124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260506.1|4403272_4404649_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.4e-79
WP_094187777.1|4406856_4407655_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407175.1|4408639_4409608_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_069960033.1|4409774_4410746_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
WP_011409594.1|4410938_4412123_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011260517.1|4412590_4413406_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_011409596.1|4414164_4415481_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011260520.1|4415740_4416985_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011260521.1|4417077_4420326_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_011409597.1|4420459_4423600_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011409598.1|4423889_4425257_-	VOC family protein	NA	NA	NA	NA	NA
WP_041182775.1|4426001_4426967_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_069964616.1|4427385_4428351_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027703675.1|4428813_4429284_+	thioesterase	NA	NA	NA	NA	NA
WP_011409601.1|4429312_4429735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260528.1|4429810_4430245_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011260529.1|4430354_4430870_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011409602.1|4430885_4431911_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011260531.1|4432233_4432830_-	Ax21 family protein	NA	NA	NA	NA	NA
WP_011260532.1|4433187_4434915_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_011260533.1|4434964_4436407_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011260534.1|4436391_4437738_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409603.1|4437928_4438678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260536.1|4438779_4439391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260537.1|4439495_4440719_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260538.1|4441060_4441537_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 35
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	4454404	4512336	4900521	transposase,integrase	Leptospira_phage(25.0%)	37	4454288:4454307	4468347:4468366
4454288:4454307	attL	AGTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
WP_011260549.1|4454404_4455781_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
WP_041182305.1|4455791_4456325_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409609.1|4456753_4458013_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_011260552.1|4458151_4459459_-	MFS transporter	NA	NA	NA	NA	NA
WP_011407587.1|4461543_4462578_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409611.1|4462928_4463474_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_011409612.1|4463499_4463766_-	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011260556.1|4463940_4465779_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011260557.1|4466009_4466885_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
WP_011409614.1|4469002_4470145_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	5.3e-96
4468347:4468366	attR	GGGGTTTTTCAGGGGCGACT	NA	NA	NA	NA
WP_011260560.1|4471271_4472171_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_011260561.1|4473118_4475920_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
WP_011409617.1|4475996_4476287_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_113101711.1|4476644_4477747_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	6.7e-40
WP_075240612.1|4477852_4478443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168769.1|4478583_4479489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409622.1|4479678_4482366_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_011409626.1|4485687_4489617_+	avirulence protein	NA	NA	NA	NA	NA
WP_011409629.1|4491305_4491818_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	68.8	1.6e-44
WP_075244060.1|4491814_4492042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013372.1|4492326_4492674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409630.1|4492891_4494898_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_012443890.1|4494894_4495326_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_011260579.1|4495322_4495742_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_075240651.1|4496227_4496980_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_011409633.1|4497190_4497781_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_011409634.1|4497914_4498862_+	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_011409635.1|4498904_4499774_+	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
WP_011409636.1|4499770_4500271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409640.1|4503369_4503930_+	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	29.6	2.1e-13
WP_011409641.1|4504025_4506851_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_011260589.1|4507012_4507531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409642.1|4507530_4508451_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_011260591.1|4508879_4509503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465293.1|4509512_4509698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465296.1|4509800_4510421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182033.1|4511370_4512336_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	4589863	4733267	4900521	tRNA,transposase,tail	Arthrobacter_phage(18.75%)	91	NA	NA
WP_109182036.1|4589863_4590829_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260658.1|4590929_4591355_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094187715.1|4591397_4592160_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260659.1|4592222_4593254_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.0e-70
WP_011260660.1|4594614_4595871_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011260661.1|4595867_4596758_+	allantoinase PuuE	NA	NA	NA	NA	NA
WP_012443820.1|4596754_4597150_+	DUF3225 domain-containing protein	NA	NA	NA	NA	NA
WP_075239612.1|4597169_4597748_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_115801912.1|4597633_4598491_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_011409690.1|4598423_4599812_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260667.1|4604597_4606682_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260668.1|4606781_4608809_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011260669.1|4609051_4610662_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_011260670.1|4610672_4611836_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011409694.1|4611964_4612585_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260672.1|4613146_4613482_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_075242289.1|4615106_4615418_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_011409699.1|4616536_4617055_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_011409700.1|4617326_4619045_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011260679.1|4619135_4619522_-	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_011260680.1|4619583_4620909_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_011260681.1|4621023_4622337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260682.1|4622435_4623161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409701.1|4623377_4624040_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409702.1|4624118_4625213_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011409705.1|4626717_4629477_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.9	3.5e-146
WP_011409706.1|4629729_4631319_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_011409707.1|4631318_4633556_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011409708.1|4633844_4634753_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011409709.1|4634842_4636657_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_153303324.1|4637042_4645868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182038.1|4645966_4646764_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409712.1|4647308_4648061_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_011260693.1|4648120_4649020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260694.1|4649171_4649927_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_011409714.1|4649923_4650559_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003484969.1|4650574_4650802_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_011409715.1|4650874_4651777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409716.1|4651931_4652897_+	ferrochelatase	NA	NA	NA	NA	NA
WP_075242173.1|4652994_4653750_+	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
WP_011409718.1|4653830_4654289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409719.1|4654559_4655345_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409720.1|4655971_4656877_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	4.1e-43
WP_011260702.1|4656940_4657858_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_011259480.1|4658461_4659799_+	xylose isomerase	NA	NA	NA	NA	NA
WP_011409721.1|4660024_4661092_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409722.1|4661267_4663463_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409723.1|4663459_4665424_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409724.1|4665435_4666695_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_011260707.1|4666694_4668395_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011260708.1|4668397_4671112_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260709.1|4671334_4672807_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_011260711.1|4673784_4674840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260712.1|4675067_4676486_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_011409725.1|4676526_4677504_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_042465333.1|4678920_4680222_-	MFS transporter	NA	NA	NA	NA	NA
WP_011409727.1|4680683_4683617_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409728.1|4683715_4685203_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260718.1|4685234_4686269_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_094187716.1|4686685_4687483_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182039.1|4688789_4689746_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_115840186.1|4690473_4691236_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075242372.1|4691253_4692354_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011260725.1|4692419_4693541_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_011409734.1|4693550_4694627_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260727.1|4694719_4695400_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_109182041.1|4695432_4696231_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409735.1|4696359_4697679_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465802.1|4697781_4698738_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.4e-41
WP_011260733.1|4700204_4700663_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409738.1|4700764_4701193_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_069960048.1|4701439_4702303_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_042465346.1|4705479_4705746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260739.1|4705907_4706156_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011409743.1|4706364_4707123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465805.1|4707119_4707815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409745.1|4707913_4708246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409747.1|4708717_4709152_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_069960049.1|4709267_4709513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260743.1|4709848_4710181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703652.1|4710630_4712025_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011260746.1|4712962_4713253_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	53.8	1.5e-15
WP_011260747.1|4713270_4713552_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	40.7	3.1e-10
WP_011409750.1|4713646_4715899_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	21.7	8.7e-10
WP_082325367.1|4716086_4720154_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	4.1e-10
WP_011409752.1|4720150_4723564_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_128415416.1|4723599_4723902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409756.1|4730477_4731023_+|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_011260754.1|4731091_4731619_+|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011260755.1|4731677_4732214_+|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
WP_109182045.1|4732301_4733267_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 37
NZ_CP031457	Xanthomonas oryzae pv. oryzae strain JL25 chromosome, complete genome	4900521	4815827	4888643	4900521	transposase,protease	Ralstonia_virus(20.0%)	52	NA	NA
WP_011260830.1|4815827_4817063_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260831.1|4817934_4818990_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_011260832.1|4818982_4819654_-	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_011260833.1|4819751_4821059_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409807.1|4821075_4822494_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011409808.1|4823065_4824460_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_011260838.1|4824807_4826994_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.7	2.2e-111
WP_012446438.1|4827169_4827394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182049.1|4827974_4828940_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409811.1|4829115_4830531_-	amino acid permease	NA	NA	NA	NA	NA
WP_075242296.1|4831021_4833346_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_041182970.1|4833751_4834114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409815.1|4834491_4835037_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	33.9	2.6e-16
WP_011260845.1|4838289_4839417_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_011409820.1|4840272_4841613_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_011409821.1|4841829_4842522_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409822.1|4842638_4842959_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_011260850.1|4842958_4843951_+	D-2-hydroxyacid dehydrogenase family protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.4	8.5e-10
WP_011409823.1|4844257_4845781_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.7e-25
WP_011409824.1|4845885_4847121_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_011260853.1|4847281_4847938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409825.1|4848088_4849900_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_011409826.1|4850047_4850398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115840187.1|4850576_4851896_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465377.1|4853308_4854490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409829.1|4854587_4858019_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011409830.1|4858166_4858865_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_011409831.1|4858848_4860321_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_011409832.1|4860317_4860905_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_011409833.1|4860904_4862101_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_041182832.1|4862174_4862777_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	48.9	2.0e-46
WP_069960057.1|4862952_4863396_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_113055205.1|4863651_4864275_+	TolC family protein	NA	NA	NA	NA	NA
WP_011409837.1|4864271_4864838_+	FUSC family protein	NA	NA	NA	NA	NA
WP_011409838.1|4865113_4866475_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.9	8.3e-32
WP_075242371.1|4866588_4866909_-	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_069960058.1|4868724_4868931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960059.1|4868917_4870030_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_049756351.1|4872381_4873134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409848.1|4873130_4873838_-	hypothetical protein	NA	A4PE25	Ralstonia_virus	34.6	2.0e-08
WP_113079208.1|4873851_4874193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757268.1|4874173_4874683_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	4.8e-09
WP_011409850.1|4874679_4875081_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_011407756.1|4875472_4876792_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_005921785.1|4877903_4878125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446478.1|4879021_4879207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757270.1|4880239_4881409_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	1.3e-41
WP_069960119.1|4881434_4882745_-	MFS transporter	NA	NA	NA	NA	NA
WP_069960063.1|4884658_4884979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960064.1|4885097_4886264_-	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
WP_011260885.1|4886526_4887483_+	TerC family protein	NA	K4F9T9	Cronobacter_phage	29.9	8.4e-31
WP_011260886.1|4887857_4888643_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
