The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	7692	78816	4898917	transposase,protease	Ralstonia_phage(30.0%)	55	NA	NA
WP_011407164.1|7692_8529_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011407165.1|8715_9522_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9798_10992_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011257014.1|11145_11817_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|11901_12663_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12709_13132_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13135_13549_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011407166.1|13844_14612_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14622_14892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407167.1|14966_16427_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|17073_18084_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18355_19558_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19699_21838_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|22048_22342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296734.1|22373_22871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113085515.1|23117_24098_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	56.2	5.3e-89
WP_011257025.1|24145_25312_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_069959658.1|25458_26025_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_069959660.1|27499_28708_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|29335_30358_-	sugar kinase	NA	NA	NA	NA	NA
WP_011407175.1|31180_32149_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_146770128.1|32543_33773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129215536.1|33769_34477_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.6e-05
WP_012443646.1|35078_36455_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	4.1e-79
WP_012443643.1|39467_39710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443642.1|39651_39975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257128.1|40440_41421_-|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
WP_011407184.1|42039_43329_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
WP_011407185.1|43768_44104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407187.1|44378_44810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|45158_46568_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041181902.1|46845_47061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|47885_48146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|48162_48495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080256644.1|48494_48953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407913.1|49312_50527_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187731.1|51047_51845_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182053.1|53560_54526_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_125168734.1|54522_54801_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011407196.1|54944_56264_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407197.1|56381_57428_+	methylamine utilization protein	NA	NA	NA	NA	NA
WP_011407198.1|57568_58066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703730.1|58229_58862_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_011257110.1|58878_61041_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011407199.1|61155_61341_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011257109.1|61363_63967_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_094187819.1|63963_65853_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_011257107.1|65909_67667_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_011407200.1|67669_69904_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_027703733.1|69900_71484_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_011257104.1|71957_73586_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_011257103.1|73582_74947_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011257102.1|75139_76081_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_011407202.1|76321_78046_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
WP_109181945.1|78052_78816_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	109333	135585	4898917	transposase	Ralstonia_phage(50.0%)	23	NA	NA
WP_011258529.1|109333_110302_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_115840160.1|110514_111834_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407219.1|112022_113006_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_041181898.1|113727_116136_+	serine kinase	NA	NA	NA	NA	NA
WP_011257061.1|117011_118640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407223.1|119197_119581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407224.1|119577_120063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407225.1|120066_120429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407226.1|120545_121982_-	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.7	1.5e-10
WP_011407227.1|122223_123075_+	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
WP_011257053.1|123534_123852_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011257052.1|124157_125045_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_011407229.1|125751_126702_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	3.0e-97
WP_125168735.1|126815_127025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407230.1|127092_127353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257048.1|127405_127687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407231.1|127825_128884_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011407232.1|129024_129972_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
WP_011407233.1|130226_130538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|132004_132475_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011257042.1|132644_133337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257041.1|133428_133827_+	host attachment protein	NA	NA	NA	NA	NA
WP_011407237.1|134628_135585_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
>prophage 3
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	220003	385029	4898917	tRNA,holin,transposase	Bacillus_phage(15.79%)	110	NA	NA
WP_011257198.1|220003_221908_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_075239321.1|222168_222348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407290.1|222481_222949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257199.1|223106_224066_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_011407291.1|224050_224668_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011257200.1|224710_225130_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_011257201.1|225382_226288_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	39.2	4.4e-37
WP_011257202.1|226536_227421_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011257203.1|227484_228267_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407292.1|228311_229073_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_011257206.1|229236_229566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407293.1|229884_230976_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_011407294.1|231044_232643_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_011407295.1|232807_234052_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_011257210.1|234503_235133_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	3.3e-52
WP_011257211.1|235339_237316_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
WP_011407298.1|238702_239368_-	YceH family protein	NA	NA	NA	NA	NA
WP_011257214.1|239647_240658_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_011257215.1|240654_241386_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_011257216.1|241739_243269_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.0e-46
WP_011407300.1|243378_246411_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257218.1|246709_249748_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257219.1|249912_250965_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_075240491.1|251133_251379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407301.1|251377_252343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257221.1|252342_255003_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_008573820.1|256821_257025_-	YdcH family protein	NA	NA	NA	NA	NA
WP_011257226.1|260663_261308_-	DUF4375 domain-containing protein	NA	NA	NA	NA	NA
WP_011257227.1|261448_262339_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_011407307.1|262466_262949_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257232.1|265984_266518_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_011407313.1|269333_270392_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
WP_011257237.1|270699_271773_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257238.1|272535_273588_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_113079127.1|274235_275366_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011407314.1|275620_275935_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_011257241.1|276682_277072_+	YchJ family protein	NA	NA	NA	NA	NA
WP_011407316.1|277279_277486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|277717_278686_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011257243.1|278939_281102_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407318.1|281649_282954_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011407319.1|283013_283616_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011257245.1|283612_285517_+	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407325.1|294835_295651_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_041182297.1|295997_296960_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182012.1|297064_297827_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257253.1|299626_300685_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011257254.1|300695_300986_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257255.1|300975_301638_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_012446379.1|301634_302186_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257257.1|302197_302947_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407332.1|302946_303741_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257259.1|304125_304413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703982.1|304431_304989_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182061.1|305006_305972_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407336.1|306816_307773_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	2.9e-39
WP_011258802.1|308260_309229_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109182062.1|309806_310605_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407338.1|310736_311951_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
WP_109182063.1|312010_312841_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407798.1|313003_314239_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011257271.1|315637_316066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407344.1|316076_316526_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257273.1|316506_316734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407346.1|317041_318796_-	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_109182012.1|319674_320437_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703800.1|320490_321075_-	gluconokinase	NA	NA	NA	NA	NA
WP_011407349.1|321232_322615_+	MFS transporter	NA	NA	NA	NA	NA
WP_011407350.1|322617_325017_+	NdvB protein	NA	NA	NA	NA	NA
WP_011407351.1|325120_327763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257279.1|328510_331960_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011407353.1|332152_332737_-	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011407354.1|333213_333990_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407355.1|334170_335472_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011257283.1|335474_335834_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_011257284.1|336270_337752_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_109182027.1|337944_338910_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407357.1|339736_341899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042464365.1|342025_344194_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011257288.1|344831_345461_-|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_011257289.1|345463_345895_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011257290.1|345951_346530_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_027703865.1|346625_347378_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_113079157.1|347602_347992_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011257293.1|348105_349779_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_044757204.1|349775_350420_-	sterol-binding protein	NA	NA	NA	NA	NA
WP_011407366.1|354104_354389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182066.1|354740_355539_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187782.1|355598_356362_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182067.1|360315_361281_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042464374.1|362341_363448_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465421.1|365241_366180_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_080493948.1|366298_367087_-	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	4.5e-54
WP_012446343.1|367050_367842_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257314.1|367859_368855_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
WP_075242284.1|368891_369719_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011407379.1|369803_370805_-	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_011407380.1|370870_371143_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_153296754.1|371263_371425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465424.1|371628_372216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257320.1|372212_372413_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011407383.1|372473_374075_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024712051.1|374106_374853_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
WP_011407385.1|374849_376043_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407386.1|376452_377475_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_041181930.1|377614_379180_-	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
WP_011257326.1|379190_380204_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407388.1|380193_380895_-	SapC family protein	NA	NA	NA	NA	NA
WP_011407389.1|381078_384093_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_109181945.1|384266_385029_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	567652	617150	4898917	tRNA,integrase,transposase	Sinorhizobium_phage(14.29%)	42	575803:575819	613938:613954
WP_109181928.1|567652_568618_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_115840162.1|569085_570405_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257475.1|570934_571450_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011407490.1|571852_574075_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_103057279.1|574543_575569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959707.1|575552_576155_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
575803:575819	attL	GCGTAGTGCTGCGTCAT	NA	NA	NA	NA
WP_069959708.1|576485_577430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407493.1|577948_579325_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011407494.1|579409_581311_+	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
WP_011257482.1|581496_581712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407495.1|581818_582595_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407496.1|582756_583431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407497.1|583427_584201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257486.1|584424_584988_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011257487.1|584998_587491_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
WP_011257488.1|587673_588948_-	RDD family protein	NA	NA	NA	NA	NA
WP_041181947.1|588989_589712_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_011257490.1|589752_590226_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_011257491.1|590268_591411_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_011407499.1|591482_592619_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_011257493.1|592751_593264_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_011257494.1|593657_594581_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_011407500.1|594580_595894_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011257496.1|595944_597666_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011257497.1|597830_599108_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257498.1|599305_600130_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011407501.1|600133_601189_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_011257500.1|601354_602821_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_042465436.1|602817_603321_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_011257502.1|603430_604564_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_011407503.1|604806_605328_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011407504.1|605527_606442_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011257505.1|606542_606983_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_011407505.1|607091_608966_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_011407506.1|609158_609479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257519.1|610107_611382_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.4e-110
WP_011257520.1|611515_611722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257521.1|611718_611991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407508.1|611987_612233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407512.1|614168_615404_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
613938:613954	attR	ATGACGCAGCACTACGC	NA	NA	NA	NA
WP_011407513.1|615472_615862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|616184_617150_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	721765	779740	4898917	transposase	Enterobacteria_phage(25.0%)	52	NA	NA
WP_115840163.1|721765_722731_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407584.1|725139_726411_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011407585.1|726618_728448_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.5	1.3e-133
WP_011257638.1|728829_729303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257639.1|729534_730110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187804.1|730142_730905_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|731021_732056_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011407588.1|732272_732797_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_011258803.1|732969_733938_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011257643.1|734113_735220_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_103057232.1|735216_737064_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_011257645.1|737150_737567_-	CopL family metal-binding regulatory protein	NA	NA	NA	NA	NA
WP_011407590.1|737702_738806_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_011407591.1|738849_740874_+	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_041181965.1|741047_741869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257649.1|741982_743191_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_011407593.1|743190_743706_-	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA	NA	NA	NA	NA	NA
WP_011407594.1|744051_745131_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_011407595.1|745272_745923_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_011257653.1|746234_746633_-	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_011407596.1|746629_747112_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011407597.1|747436_748111_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_011407598.1|748225_748561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703598.1|748753_749107_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_011407600.1|749519_750902_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.3	1.4e-55
WP_019301777.1|750994_751120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257658.1|751281_752271_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
WP_042464484.1|752314_752941_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_011407601.1|753279_754413_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_011407602.1|754511_754895_+	DUF4398 domain-containing protein	NA	NA	NA	NA	NA
WP_011257662.1|754891_755782_+	membrane protein	NA	NA	NA	NA	NA
WP_003484103.1|756123_756342_+	YdcH family protein	NA	NA	NA	NA	NA
WP_011407603.1|756583_757954_+	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	38.8	2.6e-49
WP_011257665.1|758044_759238_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_011257666.1|759284_760085_+	FkbM family methyltransferase	NA	H8ZJI6	Ostreococcus_tauri_virus	28.0	3.5e-06
WP_011407605.1|760119_761196_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SG19	Hokovirus	21.8	4.9e-11
WP_011407606.1|762227_763154_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_024744691.1|763174_763465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257668.1|763455_764619_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011257669.1|764624_765677_+	acyltransferase	NA	A9YX16	Burkholderia_phage	33.9	1.5e-41
WP_109182077.1|765763_767083_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407609.1|767398_768583_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_011407610.1|769112_770426_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
WP_011407611.1|770415_771234_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257674.1|771456_772398_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011257675.1|772397_773144_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011407612.1|773369_774425_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011407613.1|774480_775368_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407614.1|775364_775922_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
WP_011407615.1|775918_776827_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
WP_011257680.1|776943_778347_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_113081224.1|778393_779740_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	1.5e-33
>prophage 6
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	792004	835308	4898917	tRNA,transposase	Ralstonia_phage(22.22%)	27	NA	NA
WP_011257693.1|792004_793699_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011257694.1|793810_794215_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011407623.1|794346_795120_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011257696.1|795130_795598_+	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_011407624.1|795594_796077_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182079.1|796635_797955_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182080.1|798112_799432_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407627.1|799644_800613_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_109182081.1|800762_802082_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_027704044.1|802386_804360_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	7.9e-15
WP_011257702.1|804626_805667_-	pectate lyase	NA	NA	NA	NA	NA
WP_094187731.1|807256_808054_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257706.1|808706_809021_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_115801870.1|809208_810311_-|transposase	IS3-like element ISXo17 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	7.2e-42
WP_011257710.1|811247_814190_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.8	6.4e-130
WP_011257711.1|814397_814823_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_011257712.1|814863_815169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257713.1|815168_816641_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	6.2e-49
WP_011407634.1|816748_817831_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_011407635.1|817827_818934_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_011258579.1|819108_820077_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011257716.1|820508_820976_-	RDD family protein	NA	NA	NA	NA	NA
WP_011257717.1|821402_822374_+	site-specific tyrosine recombinase XerD	NA	G1JX48	Mycobacterium_phage	27.9	6.4e-18
WP_011257718.1|822829_823627_+	DsbC family protein	NA	NA	NA	NA	NA
WP_011257719.1|824025_828078_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	7.5e-121
WP_069959728.1|829055_832853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409190.1|834351_835308_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	2.4e-41
>prophage 7
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	871019	922647	4898917	transposase,protease	Ralstonia_phage(18.18%)	43	NA	NA
WP_069963827.1|871019_871985_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257750.1|872375_872951_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_011407659.1|873063_873573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010368401.1|873671_873866_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011257752.1|873955_874933_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011257753.1|875162_875603_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_011257754.1|875880_876825_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_011407660.1|876907_877651_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
WP_010368407.1|877855_878095_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_011407661.1|878236_879472_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011407662.1|879642_880998_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_011257758.1|881058_882132_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_011257759.1|882128_883088_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_011257760.1|883084_883438_+	type IV fimbriae assembly protein	NA	NA	NA	NA	NA
WP_011407663.1|883961_884435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407665.1|885455_885782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181972.1|886017_887616_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_011257763.1|887761_888658_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_011407667.1|888733_889888_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_011257765.1|890068_892660_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_011407669.1|892982_893120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407670.1|893392_894592_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_011407671.1|895041_896010_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	6.6e-100
WP_011407672.1|896251_898468_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407673.1|898546_899545_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_103057250.1|899654_899837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464512.1|900816_903804_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041181973.1|903978_904926_+	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
WP_011407676.1|905429_905966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407677.1|906036_907356_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407678.1|907700_908663_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.7e-42
WP_011257778.1|908796_909357_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011257779.1|909399_909882_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_011407679.1|910044_910521_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257781.1|910931_911831_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011257782.1|912070_912457_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011407680.1|913086_914214_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257784.1|914213_915077_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_011257785.1|915370_915556_+	DUF2065 family protein	NA	NA	NA	NA	NA
WP_011407681.1|915893_917186_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	37.5	8.4e-74
WP_011407682.1|917511_920184_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.0	2.6e-77
WP_011257788.1|920377_921160_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_115840190.1|921270_922647_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	4.3e-76
>prophage 8
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	961368	1013087	4898917	transposase,protease	Tenacibaculum_phage(16.67%)	34	NA	NA
WP_109182067.1|961368_962334_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182120.1|962330_962504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446005.1|962788_963280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257827.1|964959_966216_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011257828.1|966375_966939_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_011257829.1|967305_968664_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_027703752.1|968663_969260_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_011257831.1|969406_970291_+	membrane protein	NA	NA	NA	NA	NA
WP_011257834.1|972272_972887_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257835.1|972969_973956_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|974071_974566_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|974810_976640_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011407704.1|976658_977129_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|978051_979179_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|979279_980662_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_011257842.1|980909_983033_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407706.1|983561_984080_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_115801872.1|984786_985888_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.6e-41
WP_011257570.1|986403_987639_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_103057209.1|988252_989101_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_012445986.1|989232_989373_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_011407713.1|992932_994168_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109182089.1|995150_996470_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182948.1|997215_998139_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
WP_109182121.1|999201_1000167_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|1000468_1002046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|1002113_1002877_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1005545_1006514_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011407721.1|1006774_1007236_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011257866.1|1007784_1008027_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_109182012.1|1008020_1008784_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049756327.1|1008816_1009548_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
WP_109182091.1|1011367_1012120_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181948.1|1012121_1013087_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	1020716	1083733	4898917	integrase,transposase,protease	Ralstonia_phage(31.25%)	50	1011913:1011931	1080844:1080862
1011913:1011931	attL	GCGACAGCGGCTACACCGG	NA	NA	NA	NA
WP_011257881.1|1020716_1022003_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_012445937.1|1022146_1024618_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_002806049.1|1024831_1025104_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_011407728.1|1025935_1027906_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011407729.1|1028611_1029790_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011257886.1|1029786_1030554_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011257887.1|1030566_1031223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257888.1|1031250_1031703_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257889.1|1031711_1032446_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_113081222.1|1032881_1033586_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_041181989.1|1034411_1035041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445927.1|1035932_1036133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082325231.1|1036528_1039252_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.2	2.8e-71
WP_069960070.1|1039319_1041470_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
WP_044757078.1|1041466_1043164_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_011257897.1|1043483_1045688_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
WP_011257898.1|1045684_1047379_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|1047375_1047639_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_109182093.1|1047700_1049908_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-19
WP_011407737.1|1049904_1051584_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|1051580_1051844_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_011257899.1|1051905_1052463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182094.1|1052545_1053511_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407739.1|1053609_1054296_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
WP_011257902.1|1054406_1054811_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011407740.1|1055021_1056071_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257904.1|1056091_1056841_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257905.1|1056840_1057590_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257906.1|1057589_1058621_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257907.1|1058638_1058998_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011407742.1|1059022_1059520_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257909.1|1059516_1059762_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011257910.1|1059758_1060205_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257911.1|1060766_1062863_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_011257912.1|1062869_1063190_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011257913.1|1063287_1063881_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_011407744.1|1063982_1064333_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257915.1|1064452_1064986_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011257916.1|1064982_1066935_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257917.1|1066927_1067884_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407746.1|1067889_1068843_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_012445908.1|1068881_1070750_+	membrane protein	NA	NA	NA	NA	NA
WP_011407749.1|1072265_1072781_+	peptide deformylase	NA	NA	NA	NA	NA
WP_103057268.1|1073297_1074056_+	cellulase	NA	NA	NA	NA	NA
WP_041182379.1|1074528_1075275_+	cellulase	NA	NA	NA	NA	NA
WP_011407751.1|1075891_1077493_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_011257570.1|1078481_1079717_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258188.1|1080545_1081514_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
1080844:1080862	attR	CCGGTGTAGCCGCTGTCGC	NA	NA	NA	NA
WP_075241901.1|1081981_1082332_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_011407756.1|1082413_1083733_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	1122463	1164910	4898917	transposase	Leptospira_phage(25.0%)	41	NA	NA
WP_109182097.1|1122463_1123565_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
WP_011407778.1|1124995_1125619_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_011257965.1|1125642_1125882_+	rubredoxin	NA	NA	NA	NA	NA
WP_011257966.1|1125931_1126813_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011407780.1|1126962_1127412_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_011407781.1|1127562_1128210_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_011257969.1|1128301_1128772_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_011407783.1|1128768_1129359_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_011257971.1|1129967_1130267_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_011407784.1|1130263_1130485_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_011407785.1|1130720_1131263_+	YecA family protein	NA	NA	NA	NA	NA
WP_011257974.1|1131273_1132614_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_162013040.1|1133131_1133290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187736.1|1133321_1134085_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257975.1|1134317_1135643_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_011257976.1|1135841_1136189_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011407789.1|1136185_1138594_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011257978.1|1138772_1139930_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_011257979.1|1139945_1140545_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.8	3.8e-13
WP_011257980.1|1140541_1140937_-	glyoxalase	NA	NA	NA	NA	NA
WP_011257981.1|1140933_1141659_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_011257982.1|1141768_1142629_+	YicC family protein	NA	NA	NA	NA	NA
WP_011257983.1|1142745_1143357_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	30.9	3.1e-10
WP_099051298.1|1143537_1144335_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407791.1|1144483_1144783_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_011257986.1|1144911_1147083_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011257987.1|1147162_1147543_+	RidA family protein	NA	NA	NA	NA	NA
WP_011407792.1|1147563_1149717_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011257989.1|1149842_1150781_+	inosine-uridine preferring nucleoside hydrolase	NA	NA	NA	NA	NA
WP_005911911.1|1150852_1151095_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011407793.1|1151308_1152598_+	citrate synthase	NA	NA	NA	NA	NA
WP_011407794.1|1152975_1153626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257992.1|1153935_1156365_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_011407795.1|1156580_1157639_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257994.1|1157638_1158397_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011257995.1|1158393_1159059_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_011257996.1|1159055_1159589_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011407796.1|1159608_1161558_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_094187763.1|1161628_1162427_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257854.1|1162569_1163805_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_115840164.1|1163875_1164910_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	1204127	1235967	4898917	transposase	Feldmannia_irregularis_virus(16.67%)	25	NA	NA
WP_109181945.1|1204127_1204890_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115801876.1|1204979_1205945_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027704076.1|1206054_1207374_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011407833.1|1207836_1208514_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704066.1|1208593_1208983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407835.1|1209196_1210084_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
WP_113081219.1|1210517_1211502_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	6.3e-98
WP_011407838.1|1211676_1213764_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011407839.1|1213915_1214575_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_094187758.1|1214655_1215453_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407841.1|1215475_1215655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258045.1|1215673_1216078_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258046.1|1216111_1216471_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258047.1|1216714_1217587_-	ion transporter	NA	NA	NA	NA	NA
WP_011258048.1|1217659_1218886_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
WP_011407842.1|1219130_1219748_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_042464589.1|1221284_1222892_+	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_011258050.1|1222888_1223314_+	cytochrome c	NA	NA	NA	NA	NA
WP_011407846.1|1223338_1223842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407850.1|1225284_1225734_+	azurin	NA	NA	NA	NA	NA
WP_011407853.1|1228980_1230270_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_011407854.1|1230555_1233735_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258055.1|1234231_1235101_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
WP_011258056.1|1235122_1235794_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_012444927.1|1235790_1235967_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	1450221	1593491	4898917	tRNA,transposase	uncultured_Caudovirales_phage(16.0%)	110	NA	NA
WP_109181897.1|1450221_1451187_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182392.1|1451539_1452244_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005926176.1|1452781_1453006_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_011407979.1|1453005_1455078_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_011407980.1|1455309_1456167_+	pirin family protein	NA	NA	NA	NA	NA
WP_082323236.1|1457202_1459605_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	4.6e-41
WP_027704078.1|1459659_1460520_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_075241467.1|1460588_1461167_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_044757488.1|1461156_1462569_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_044757009.1|1462578_1465002_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	2.4e-37
WP_011258248.1|1464998_1465946_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_162828860.1|1466092_1466545_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_041182394.1|1466939_1467488_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_075245366.1|1467882_1468440_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407990.1|1468489_1470598_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_069964947.1|1470619_1472521_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.9e-30
WP_027704078.1|1472575_1473436_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_075251795.1|1473504_1474083_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258251.1|1474546_1474780_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407994.1|1475000_1475567_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407995.1|1475769_1476357_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_162013049.1|1476709_1477144_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_069959784.1|1477140_1479549_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011407999.1|1479893_1480355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408000.1|1480601_1481492_-	pirin family protein	NA	NA	NA	NA	NA
WP_125168744.1|1481669_1482188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444354.1|1482259_1482973_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_011258259.1|1483076_1483826_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_042465485.1|1484186_1484438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408003.1|1484770_1486828_+	M13 family peptidase	NA	A0A1V0SHG2	Klosneuvirus	28.6	1.2e-79
WP_069960076.1|1488775_1489897_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_012444362.1|1489911_1490718_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_069959785.1|1490722_1492006_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011408007.1|1492032_1492548_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_069959786.1|1492558_1494715_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
WP_011408009.1|1494782_1496780_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|1496798_1497128_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_125168745.1|1497167_1497386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756996.1|1497617_1501082_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_011258270.1|1501484_1502027_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408011.1|1502438_1503347_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_094187763.1|1503692_1504491_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042464653.1|1504634_1505354_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_109181900.1|1505509_1506544_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258276.1|1506564_1507377_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408014.1|1508112_1508496_+	membrane protein	NA	NA	NA	NA	NA
WP_011408015.1|1508618_1509788_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
WP_011408016.1|1509782_1510841_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.1e-71
WP_011408017.1|1510901_1511714_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408018.1|1512229_1512613_+	membrane protein	NA	NA	NA	NA	NA
WP_011408019.1|1512771_1513935_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
WP_011408020.1|1513965_1514778_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408021.1|1515008_1515596_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_011407237.1|1515894_1516851_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_075242217.1|1516924_1517656_+	nitrilase	NA	NA	NA	NA	NA
WP_069960180.1|1517677_1518781_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_011258289.1|1518849_1520253_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408024.1|1520266_1520773_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408025.1|1521178_1521637_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|1522414_1522618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113079221.1|1524179_1524665_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_014503862.1|1524892_1525108_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_014503861.1|1525357_1525837_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_053503312.1|1525968_1526397_-	cytochrome c	NA	NA	NA	NA	NA
WP_053503313.1|1526469_1527300_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_053503314.1|1527361_1528129_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011258299.1|1528128_1528344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408033.1|1528489_1529281_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258301.1|1529426_1530602_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011408036.1|1532835_1533474_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011258305.1|1533649_1535590_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_011258306.1|1535806_1536361_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011408037.1|1536582_1538013_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_012444398.1|1538115_1539534_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	3.3e-47
WP_011258309.1|1539950_1540676_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_011408038.1|1540774_1541185_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041182034.1|1541236_1542193_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	1.0e-39
WP_011408040.1|1542436_1544818_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258314.1|1547465_1547876_+	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_011408042.1|1548175_1548358_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258316.1|1548490_1549531_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011258317.1|1549603_1551049_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_011258802.1|1552579_1553548_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408046.1|1553898_1554444_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_011408047.1|1554440_1555904_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011258323.1|1557364_1557619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258324.1|1558021_1558555_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_011258325.1|1558580_1558982_+	membrane protein	NA	NA	NA	NA	NA
WP_011408050.1|1558950_1559331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258326.1|1559327_1559570_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_075242556.1|1559606_1560260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258329.1|1560936_1562841_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_011408052.1|1563104_1565501_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_011408053.1|1565650_1566373_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011258334.1|1569292_1569793_+	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
WP_075241746.1|1569734_1571411_+	serine hydrolase	NA	NA	NA	NA	NA
WP_011258336.1|1571557_1572823_+	potassium transporter	NA	NA	NA	NA	NA
WP_011408056.1|1572881_1574075_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	5.2e-22
WP_011408057.1|1574071_1574761_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_011408058.1|1574866_1576336_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011258340.1|1576355_1577192_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011258341.1|1577217_1578321_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011408060.1|1578317_1581374_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011258343.1|1581439_1582030_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_011258344.1|1582161_1583994_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_094187715.1|1584069_1584833_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181904.1|1584875_1586195_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408063.1|1587492_1591983_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_125168746.1|1591979_1592471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258803.1|1592522_1593491_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
>prophage 13
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	1717000	1782897	4898917	tRNA,transposase	Bacillus_phage(20.0%)	42	NA	NA
WP_011257310.1|1717000_1718236_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|1718286_1719050_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069959795.1|1719116_1720493_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	1.1e-58
WP_008578058.1|1720871_1721546_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_011408164.1|1722176_1722581_-	response regulator	NA	NA	NA	NA	NA
WP_011408165.1|1722659_1723157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959808.1|1723295_1725092_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	2.6e-81
WP_011408166.1|1725647_1726193_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_069959809.1|1726294_1730416_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
WP_011408167.1|1730636_1733279_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182063.1|1734720_1736235_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_094187715.1|1736405_1737168_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408171.1|1737479_1737992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408172.1|1738054_1739173_-	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_011408173.1|1739169_1739448_-	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_011408174.1|1739444_1740197_-	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_011258497.1|1740193_1741093_-	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_002812057.1|1741176_1741257_-	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_042464698.1|1741546_1743733_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_042465507.1|1744050_1745493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756949.1|1745825_1747928_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_069959810.1|1748169_1750614_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_011408178.1|1750627_1751152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408179.1|1751351_1753379_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	4.6e-95
WP_011408180.1|1753392_1754112_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011258505.1|1754108_1755023_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	48.5	1.2e-63
WP_011258506.1|1755317_1756193_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_044756943.1|1756189_1757140_-	glutathione synthase	NA	NA	NA	NA	NA
WP_005913706.1|1757389_1757791_+	response regulator	NA	NA	NA	NA	NA
WP_011258508.1|1757808_1758171_+	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
WP_003482487.1|1758170_1758701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258510.1|1758740_1760777_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
WP_113079163.1|1760890_1767832_+	response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
WP_011408184.1|1767839_1769042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258512.1|1769075_1769552_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011258513.1|1769802_1770426_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408185.1|1770437_1771520_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258518.1|1776141_1777206_+	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_011258519.1|1777202_1777934_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011408189.1|1777958_1779917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258521.1|1780058_1781162_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_011408191.1|1781661_1782897_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	1892219	1951617	4898917	transposase,protease	Tupanvirus(18.18%)	52	NA	NA
WP_011408249.1|1892219_1893806_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	6.5e-28
WP_041182078.1|1893986_1895777_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.5	3.5e-22
WP_011258600.1|1895883_1896684_+	signal peptidase I	NA	NA	NA	NA	NA
WP_011258601.1|1896714_1897092_+	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011258602.1|1897081_1897762_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.4	1.7e-17
WP_011258603.1|1897758_1898658_+	GTPase Era	NA	NA	NA	NA	NA
WP_011258604.1|1898881_1899604_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011408250.1|1899752_1900475_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011408251.1|1900633_1901968_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	27.2	1.0e-29
WP_011258607.1|1902142_1902640_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_011257310.1|1902735_1903971_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011408252.1|1904199_1905576_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_041182416.1|1905695_1906379_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_011408254.1|1906395_1907430_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011408255.1|1907610_1909188_+	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	25.6	2.2e-44
WP_011408256.1|1909305_1910310_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_011408257.1|1910309_1910864_+	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011408258.1|1910949_1911702_+	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_003488188.1|1911788_1911995_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_014504008.1|1913505_1914150_-	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_011408263.1|1914139_1916641_-	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_011408264.1|1916637_1918242_-	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	36.6	4.9e-15
WP_011258619.1|1918238_1918472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408265.1|1918468_1919491_-	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_011258621.1|1919827_1920193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408267.1|1920189_1920780_-	cell shape determination protein CcmA	NA	NA	NA	NA	NA
WP_011408268.1|1920877_1922587_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	2.1e-16
WP_011258624.1|1922695_1923022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408269.1|1923251_1923596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408270.1|1923718_1924894_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011258626.1|1925049_1927878_+|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011258627.1|1927938_1929039_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_041182081.1|1929507_1930035_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258629.1|1930436_1930610_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011258630.1|1930770_1931025_-	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258631.1|1931199_1931466_+	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_041182418.1|1931656_1932223_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_109181915.1|1933710_1935030_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258635.1|1935422_1935608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445232.1|1935797_1937174_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_011408277.1|1937313_1937787_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408279.1|1939458_1940508_-	cation transporter	NA	NA	NA	NA	NA
WP_011408280.1|1940622_1940958_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_075239156.1|1941246_1941537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408282.1|1942427_1943546_-	alkene reductase	NA	NA	NA	NA	NA
WP_103057305.1|1943766_1944978_+	MFS transporter	NA	NA	NA	NA	NA
WP_011258643.1|1946900_1947356_+	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_011408284.1|1947629_1948232_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011258645.1|1948267_1948876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258646.1|1948935_1949130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408285.1|1949199_1950570_+	virulence factor family protein	NA	NA	NA	NA	NA
WP_109181916.1|1950854_1951617_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	1967659	2026769	4898917	tRNA,coat,transposase,protease	Acidithiobacillus_phage(25.0%)	44	NA	NA
WP_011258663.1|1967659_1969744_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408302.1|1969968_1970418_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_011408304.1|1971181_1972240_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408305.1|1972510_1973908_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_011408306.1|1973904_1974882_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_069959816.1|1975063_1977001_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258669.1|1977421_1978198_-	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258670.1|1978202_1978877_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_082323429.1|1980507_1981884_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.0e-78
WP_011408311.1|1981923_1982319_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_082325258.1|1982361_1983843_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.7	3.7e-102
WP_011408313.1|1984641_1985058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256646.1|1985071_1985242_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_011258676.1|1988936_1989500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445197.1|1989972_1991316_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_011408316.1|1991456_1992059_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408317.1|1992132_1992579_+	membrane protein	NA	NA	NA	NA	NA
WP_012445196.1|1992656_1992923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258681.1|1995024_1996437_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011258682.1|1996433_1997171_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
WP_042464756.1|1997170_1999351_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258685.1|2000190_2001150_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_011408321.1|2001325_2004916_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
WP_011408322.1|2005373_2006114_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
WP_027703356.1|2006110_2007367_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011258689.1|2007405_2008197_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|2008220_2008682_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_069959820.1|2008678_2009692_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_012445188.1|2010091_2012458_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_011408324.1|2012541_2013888_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011258694.1|2013914_2015105_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_011258695.1|2015107_2015935_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027703358.1|2015931_2016693_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258697.1|2016710_2017268_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011258698.1|2017448_2018171_-	UMP kinase	NA	NA	NA	NA	NA
WP_011408325.1|2018227_2018605_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258700.1|2018732_2019611_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011258701.1|2019780_2020584_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011408326.1|2020959_2021685_-	molecular chaperone	NA	NA	NA	NA	NA
WP_041182086.1|2021687_2022020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258703.1|2022066_2023101_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_011258704.1|2023097_2025449_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011408330.1|2025465_2026236_-	molecular chaperone	NA	NA	NA	NA	NA
WP_011408331.1|2026244_2026769_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 16
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	2077986	2198476	4898917	tRNA,transposase	Ralstonia_phage(17.39%)	89	NA	NA
WP_011408357.1|2077986_2079306_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408358.1|2079640_2080567_-	TolC family protein	NA	NA	NA	NA	NA
WP_011258748.1|2080696_2081302_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408359.1|2081640_2083410_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
WP_027703751.1|2083406_2084009_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	4.8e-16
WP_011258751.1|2084267_2084861_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
WP_011258752.1|2085059_2086496_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
WP_011258753.1|2086737_2087940_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_011258754.1|2087982_2090811_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_011408361.1|2090991_2091924_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408362.1|2091920_2093420_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_041182090.1|2093757_2094021_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011258758.1|2094300_2094801_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_011258759.1|2095042_2096410_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_109181925.1|2099433_2100196_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408367.1|2101648_2103052_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_042464794.1|2103174_2103597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258770.1|2104229_2105066_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_075242602.1|2105075_2106062_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011258772.1|2106058_2106934_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_011408371.1|2106930_2107293_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042464800.1|2107295_2107544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408372.1|2107679_2108237_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_027703707.1|2108328_2109294_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408374.1|2109319_2110669_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
WP_011258777.1|2110661_2110898_+	protein SlyX	NA	NA	NA	NA	NA
WP_042464803.1|2110898_2111651_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_042464805.1|2111984_2112830_+	transporter	NA	NA	NA	NA	NA
WP_041182423.1|2112970_2114146_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011408378.1|2114159_2115470_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011408379.1|2115466_2116453_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011408380.1|2116449_2117655_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_011408381.1|2118041_2120795_-	methionine synthase	NA	NA	NA	NA	NA
WP_103057265.1|2120937_2122077_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
WP_011258786.1|2122073_2123069_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_011408383.1|2123157_2124339_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464808.1|2124338_2124479_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464810.1|2124850_2126296_+	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
WP_011258790.1|2126862_2129391_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
WP_109181926.1|2129601_2130400_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258793.1|2131470_2132238_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_011408388.1|2132239_2132587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|2132745_2133714_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109181928.1|2135066_2136032_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2136476_2137661_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011408398.1|2137715_2139191_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
WP_011258799.1|2139512_2139695_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_011258800.1|2139843_2141043_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_011258802.1|2141903_2142872_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258803.1|2143063_2144032_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_109181933.1|2145208_2146311_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
WP_027704061.1|2146497_2146965_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408403.1|2147325_2147985_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258822.1|2148096_2149446_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_094187728.1|2149595_2150394_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408404.1|2150833_2152153_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407175.1|2152365_2153334_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011408405.1|2153397_2153982_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_011258825.1|2154081_2155095_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153296780.1|2155785_2156052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082336051.1|2156464_2160064_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_011408408.1|2160203_2160503_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_042464821.1|2160506_2160701_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_115840167.1|2160969_2164776_-	avirulence protein	NA	NA	NA	NA	NA
WP_069959831.1|2167959_2172087_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408412.1|2172375_2173695_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464827.1|2175526_2176612_-	peptidase C13	NA	NA	NA	NA	NA
WP_011408416.1|2176939_2177638_-	acireductone synthase	NA	NA	NA	NA	NA
WP_011408417.1|2177640_2178207_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_011408418.1|2178218_2178896_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_069959832.1|2178984_2180415_-	amino acid permease	NA	NA	NA	NA	NA
WP_033013325.1|2180491_2181964_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258841.1|2182109_2182697_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011258842.1|2182852_2184094_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
WP_011258843.1|2184302_2185721_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011408424.1|2185755_2186055_+	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_011258845.1|2186051_2187923_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_041182103.1|2188212_2189226_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011258848.1|2189225_2189657_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011258849.1|2189653_2190256_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_011408426.1|2190248_2192186_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011258851.1|2192354_2192825_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011258852.1|2192821_2192992_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011408427.1|2192988_2193741_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_011258853.1|2193835_2194531_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_011408428.1|2194527_2195172_-	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
WP_011408429.1|2195398_2196547_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011408430.1|2196686_2197490_+	amidohydrolase	NA	NA	NA	NA	NA
WP_109181928.1|2197510_2198476_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	2300288	2353848	4898917	tRNA,transposase	Xanthomonas_phage(84.0%)	53	NA	NA
WP_012444952.1|2300288_2301701_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
WP_094187798.1|2302206_2303005_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258940.1|2303318_2303645_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258941.1|2303654_2304569_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258942.1|2304565_2305861_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011408488.1|2305857_2306949_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011258944.1|2306945_2308073_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_011258945.1|2308069_2308672_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011258946.1|2308668_2309403_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011258947.1|2309396_2310173_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011258948.1|2310162_2310783_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_115840169.1|2311368_2315223_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408491.1|2315447_2315747_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_042464821.1|2315750_2315945_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_137455828.1|2316212_2319596_-	avirulence protein	NA	NA	NA	NA	NA
WP_011258951.1|2320053_2320833_-	pectate lyase	NA	NA	NA	NA	NA
WP_075239627.1|2320874_2320973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|2321111_2322080_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_041182117.1|2322886_2323072_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
WP_012444935.1|2323071_2323275_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	70.3	6.1e-16
WP_011258952.1|2323410_2324484_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
WP_011408494.1|2324588_2324888_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
WP_011408495.1|2325251_2325491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057497.1|2325597_2327082_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	1.4e-40
WP_041182119.1|2327083_2327404_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_011408497.1|2327400_2328585_+	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	5.2e-54
WP_080493496.1|2328639_2328810_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	56.0	2.5e-10
WP_075240059.1|2329918_2330179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113081226.1|2330378_2330762_+	hypothetical protein	NA	A0A1D6ZIV0	Xanthomonas_phage	99.2	4.8e-70
WP_011408501.1|2330933_2331581_-	conjugal transfer protein TrbP	NA	A0A1D6ZIU7	Xanthomonas_phage	100.0	3.0e-120
WP_011408502.1|2331582_2332770_-	hypothetical protein	NA	A0A1D6ZIU8	Xanthomonas_phage	100.0	2.8e-217
WP_011408503.1|2332769_2333099_-	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	100.0	3.8e-55
WP_042464851.1|2333098_2334505_-	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	100.0	6.4e-245
WP_011408505.1|2334641_2334872_-	hypothetical protein	NA	A0A1D6ZIT7	Xanthomonas_phage	100.0	1.7e-30
WP_042464854.1|2334883_2335087_-	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	100.0	9.8e-30
WP_011408506.1|2335090_2335387_-	DNA-binding protein	NA	A0A1D6ZIU6	Xanthomonas_phage	100.0	3.6e-49
WP_011408507.1|2335383_2336424_-	replication initiation protein	NA	A0A1D6ZIT9	Xanthomonas_phage	100.0	8.2e-205
WP_134953795.1|2336410_2336596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408508.1|2336576_2336789_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	100.0	1.6e-27
WP_011408509.1|2336788_2336974_-	hypothetical protein	NA	A0A1D6ZIV1	Xanthomonas_phage	100.0	1.4e-27
WP_069970101.1|2337101_2337731_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	80.6	2.5e-71
WP_011408511.1|2337855_2338038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168751.1|2338159_2338471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187780.1|2338540_2339303_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_125168752.1|2339807_2340131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409552.1|2340561_2341524_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011408516.1|2341824_2342337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181945.1|2342469_2343232_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082325281.1|2344453_2348251_+	avirulence protein	NA	NA	NA	NA	NA
WP_041182100.1|2348519_2348714_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408491.1|2348717_2349017_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_115840170.1|2349240_2352996_+	avirulence protein	NA	NA	NA	NA	NA
WP_109181946.1|2353085_2353848_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	2359041	2417217	4898917	transposase	Staphylococcus_prophage(18.18%)	46	NA	NA
WP_012444927.1|2359041_2359218_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011408520.1|2359214_2359886_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_125168753.1|2360911_2361157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|2361140_2362097_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258802.1|2362511_2363480_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_041182129.1|2363624_2364590_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182130.1|2364567_2368668_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011408522.1|2368976_2370161_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_041182131.1|2370211_2371111_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
WP_011408524.1|2371277_2371784_+	glyoxalase	NA	NA	NA	NA	NA
WP_011258968.1|2372258_2372891_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011258969.1|2372890_2374747_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011258970.1|2374743_2376162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258971.1|2376185_2376650_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_011258972.1|2376646_2377426_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258973.1|2377717_2378758_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258974.1|2378754_2380524_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258975.1|2380520_2380985_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011408526.1|2380988_2381651_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011408527.1|2381679_2384088_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_109181948.1|2384341_2385307_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258980.1|2386700_2387435_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_010378794.1|2387427_2388669_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014503500.1|2388692_2389145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408531.1|2389095_2389344_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_011408532.1|2389454_2390237_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_012444910.1|2390253_2390463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258983.1|2390466_2392257_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_011258984.1|2392291_2392678_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_011258985.1|2392674_2393070_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_012444907.1|2393129_2393396_-	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_011408533.1|2393339_2394212_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_011258986.1|2394340_2395438_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408534.1|2395871_2397302_+	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258988.1|2397298_2398306_+	glucokinase	NA	NA	NA	NA	NA
WP_011258989.1|2398302_2399022_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011258990.1|2399124_2401041_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011408535.1|2401096_2401756_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_027703995.1|2403382_2403586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258994.1|2404601_2404982_+	response regulator	NA	NA	NA	NA	NA
WP_011408539.1|2405196_2408592_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_094187715.1|2410157_2410920_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408544.1|2412815_2413049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259000.1|2413215_2414190_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.6	2.0e-19
WP_113081228.1|2414953_2415835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115840171.1|2416134_2417217_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	2524916	2573006	4898917	tRNA,transposase	Moumouvirus(16.67%)	45	NA	NA
WP_011408598.1|2524916_2526311_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	7.6e-81
WP_011259080.1|2526312_2526570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408599.1|2526566_2526872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408600.1|2526868_2527195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408603.1|2527921_2528584_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_024744799.1|2528672_2529203_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_011408606.1|2531426_2532698_+	kynureninase	NA	NA	NA	NA	NA
WP_011408607.1|2532869_2534237_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011259089.1|2534540_2535986_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_011259090.1|2535982_2536669_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_011259091.1|2536641_2537661_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011259092.1|2537702_2538263_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_011259093.1|2538283_2539240_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_011408609.1|2539407_2540184_-	NAD kinase	NA	NA	NA	NA	NA
WP_011408610.1|2540667_2542803_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_027703372.1|2542799_2542991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259098.1|2544765_2545272_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259099.1|2545312_2545840_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408612.1|2545836_2546328_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_011408613.1|2546351_2546927_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011259101.1|2547003_2547957_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259102.1|2548045_2548918_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_162828806.1|2548914_2549754_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_162828804.1|2549634_2549874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408617.1|2549866_2550565_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408618.1|2550728_2551511_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408619.1|2551519_2551900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259107.1|2551896_2552607_+	endonuclease III	NA	NA	NA	NA	NA
WP_011408621.1|2553917_2554466_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_011258803.1|2554637_2555606_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011408623.1|2556210_2557446_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_041182144.1|2558009_2558330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259109.1|2558669_2559920_+	porin	NA	NA	NA	NA	NA
WP_011408625.1|2560108_2561128_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.7	1.6e-48
WP_011408626.1|2561315_2562407_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_069959864.1|2562519_2563494_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_069959865.1|2563493_2564363_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259114.1|2564385_2565216_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011408630.1|2565344_2566055_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011259116.1|2566187_2566595_+	RcnB family protein	NA	NA	NA	NA	NA
WP_011259117.1|2566878_2567514_+	ribonuclease T	NA	NA	NA	NA	NA
WP_011408631.1|2567584_2568904_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464912.1|2569140_2570202_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408760.1|2570252_2571437_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_109181954.1|2571686_2573006_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	2579725	2652066	4898917	tRNA,transposase,protease	uncultured_Mediterranean_phage(33.33%)	53	NA	NA
WP_011259125.1|2579725_2580871_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_027703908.1|2580940_2582011_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259127.1|2582197_2582629_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408638.1|2582752_2584249_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011259129.1|2584593_2585301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259140.1|2588690_2589812_-	phytase	NA	NA	NA	NA	NA
WP_041182147.1|2592084_2592552_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011259142.1|2592702_2593335_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_094187715.1|2593731_2594494_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259143.1|2594774_2595806_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408648.1|2595812_2597606_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_012444765.1|2597602_2597887_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_027703974.1|2598118_2598616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259147.1|2598662_2599169_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_011259148.1|2599165_2599786_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011408651.1|2600026_2601931_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_109181955.1|2602018_2603076_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_109181956.1|2603173_2604493_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239722.1|2604726_2605884_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_109181957.1|2606160_2607126_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181958.1|2607103_2608579_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
WP_162013043.1|2608614_2608821_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2610395_2611364_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258802.1|2612278_2613247_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_075245207.1|2613514_2613748_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011259163.1|2615628_2616849_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011259164.1|2617163_2618561_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011408657.1|2618571_2619789_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259166.1|2619788_2620427_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011259167.1|2620497_2621358_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011408658.1|2621354_2622143_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011259169.1|2622153_2623359_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002812972.1|2623377_2623803_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259170.1|2624022_2624655_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259171.1|2624679_2627052_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259172.1|2627209_2628415_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011259173.1|2628735_2630067_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
WP_011408659.1|2630063_2630414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|2630445_2630853_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011259175.1|2630849_2631176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259176.1|2631207_2632584_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
WP_011259177.1|2632820_2636987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703232.1|2637099_2637771_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011259179.1|2637835_2639764_-	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011259180.1|2639926_2642287_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_011259181.1|2642570_2643539_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011408662.1|2643596_2644718_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_042465566.1|2646145_2646898_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002813418.1|2646978_2647197_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011259186.1|2647477_2649760_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	8.7e-175
WP_005914463.1|2649903_2650224_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_011408665.1|2650474_2650933_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011259189.1|2650929_2652066_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 21
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	2733804	2759442	4898917	transposase	Bacillus_phage(50.0%)	13	NA	NA
WP_115801909.1|2733804_2735124_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|2735273_2736242_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_125168757.1|2737866_2738346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259260.1|2746470_2746863_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259261.1|2746871_2747333_+	cytochrome c	NA	NA	NA	NA	NA
WP_153296779.1|2747753_2748152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115801893.1|2749855_2750821_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_082323190.1|2750827_2752126_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408708.1|2752294_2753980_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
WP_075239845.1|2753976_2755713_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	8.2e-16
WP_082325289.1|2756312_2757269_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.8e-41
WP_011259267.1|2758071_2758335_+	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_115840191.1|2758476_2759442_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	2776326	2836922	4898917	tRNA,transposase,protease	Moumouvirus(10.0%)	53	NA	NA
WP_012444736.1|2776326_2777751_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_011408724.1|2778248_2778686_+	SufE family protein	NA	NA	NA	NA	NA
WP_011259287.1|2778682_2779933_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259288.1|2780000_2781062_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_075242610.1|2781204_2782245_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_011408727.1|2782329_2782617_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_011408728.1|2782613_2783963_+	dihydroorotase	NA	NA	NA	NA	NA
WP_011408729.1|2783962_2784802_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.4e-13
WP_094187715.1|2785700_2786463_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259294.1|2786489_2786753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444728.1|2787124_2787613_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_011408734.1|2787836_2789156_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2789292_2790261_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181979.1|2790460_2791777_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444725.1|2792136_2793318_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_011259303.1|2794906_2796577_+	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
WP_011259304.1|2796793_2797483_-	phytoene synthase	NA	NA	NA	NA	NA
WP_011408736.1|2797511_2798216_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_011259306.1|2798289_2799009_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_027703270.1|2799039_2800377_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_041182450.1|2800396_2801200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002802373.1|2801391_2801958_-	elongation factor P	NA	NA	NA	NA	NA
WP_011408738.1|2802059_2803088_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_011259310.1|2803306_2805424_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011259311.1|2805420_2806350_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011408739.1|2806401_2807166_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_011408740.1|2807284_2808118_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_011259314.1|2808370_2808982_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	69.8	1.1e-79
WP_011259315.1|2809236_2809677_+	ribonuclease	NA	NA	NA	NA	NA
WP_011259316.1|2809673_2810099_+	barstar family protein	NA	NA	NA	NA	NA
WP_011259317.1|2810547_2812443_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.8	1.4e-48
WP_103057284.1|2812532_2813909_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	2.1e-54
WP_011259319.1|2814011_2814572_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.2	1.6e-29
WP_011408741.1|2814669_2816226_-	YdiU family protein	NA	NA	NA	NA	NA
WP_011408742.1|2816509_2817385_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408743.1|2817585_2818284_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011408744.1|2818454_2818664_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	62.3	2.8e-16
WP_011408745.1|2818933_2819419_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_011259325.1|2819489_2820038_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_011259326.1|2820034_2821216_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012444707.1|2821439_2823509_+	GGDEF and EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011259328.1|2823608_2824487_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_011259329.1|2824584_2825484_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011408747.1|2825571_2826312_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011259331.1|2826471_2827047_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408749.1|2827220_2828192_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_011408750.1|2828225_2829167_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259334.1|2829166_2831044_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_012444702.1|2831181_2832915_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_011259336.1|2832967_2833468_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_075243426.1|2833464_2834952_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_069959886.1|2834976_2836044_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_094187715.1|2836158_2836922_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	2840117	2925994	4898917	tRNA,transposase,protease	Bacillus_phage(18.18%)	57	NA	NA
WP_094187754.1|2840117_2840865_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182165.1|2841181_2843017_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
WP_041182166.1|2843288_2844380_+	ribonuclease D	NA	NA	NA	NA	NA
WP_011259345.1|2845472_2845874_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_015463309.1|2846737_2846917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703932.1|2847518_2847809_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011408759.1|2847796_2848075_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_080256628.1|2848559_2848748_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408760.1|2849520_2850705_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_109181928.1|2851285_2852251_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042465594.1|2856815_2857160_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_011408764.1|2857370_2857697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259352.1|2857729_2858170_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
WP_011259353.1|2858248_2858884_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_011259354.1|2859277_2860036_-	cytochrome c1	NA	NA	NA	NA	NA
WP_011259355.1|2860028_2861288_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_011259356.1|2861287_2861932_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011259357.1|2862461_2863448_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_011408766.1|2865383_2866838_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011408767.1|2867261_2868248_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_011259362.1|2868659_2869322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259363.1|2869376_2869862_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011408769.1|2869861_2870380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408770.1|2870474_2871353_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011259366.1|2871349_2872630_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011259367.1|2872645_2873647_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_011408772.1|2873798_2875163_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011408773.1|2875417_2875828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408774.1|2875983_2876814_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075240820.1|2877127_2878375_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011408777.1|2878520_2880014_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408778.1|2880018_2881605_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408779.1|2881601_2882804_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_115840172.1|2883310_2884699_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408781.1|2884932_2886318_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_011259377.1|2887225_2888605_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_011408783.1|2888604_2889921_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011259379.1|2890003_2891302_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	2.7e-19
WP_011408784.1|2891609_2892890_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_162828805.1|2893195_2893474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259381.1|2893463_2895812_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_011259382.1|2895808_2896654_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_011408786.1|2896660_2898385_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_075242096.1|2898527_2898710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182012.1|2898742_2899505_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259384.1|2899730_2901083_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011408787.1|2901143_2904281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408788.1|2904447_2905302_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
WP_011408789.1|2905472_2906777_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_113079202.1|2906918_2911013_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.9e-55
WP_011259389.1|2911046_2912033_+	response regulator	NA	W8CYM9	Bacillus_phage	26.8	2.8e-05
WP_011408791.1|2912157_2913141_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.4e-97
WP_011408792.1|2913589_2918614_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_011408793.1|2918891_2919551_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408794.1|2919565_2920870_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259395.1|2920882_2924053_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_109181969.1|2925028_2925994_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	2935348	3004942	4898917	transposase	uncultured_Caudovirales_phage(61.54%)	47	NA	NA
WP_011258188.1|2935348_2936317_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409735.1|2936529_2937849_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_069959892.1|2938088_2940434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|2940451_2941180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959894.1|2941208_2943551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465604.1|2943575_2944319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115840173.1|2944349_2947184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964550.1|2947180_2948110_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069964551.1|2948118_2950881_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.2	1.5e-43
WP_082325566.1|2952446_2954936_-	avirulence protein	NA	NA	NA	NA	NA
WP_041182637.1|2954975_2955365_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_157724569.1|2955525_2956479_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|2956411_2956726_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_011408815.1|2956953_2958273_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259409.1|2959377_2959794_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_011259410.1|2959790_2960237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259411.1|2960479_2961115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|2961614_2962583_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_125168758.1|2963239_2963740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465618.1|2964048_2967150_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042465003.1|2968139_2968592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756758.1|2968846_2970652_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_125168759.1|2970653_2971001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756757.1|2971076_2971784_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	8.4e-52
WP_011408825.1|2971935_2972328_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011408826.1|2972374_2972866_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703781.1|2972862_2973216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259417.1|2973304_2974045_+	flagellar motor protein	NA	NA	NA	NA	NA
WP_011408827.1|2974051_2975026_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_011259419.1|2975027_2975810_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_042465006.1|2975806_2976829_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259421.1|2976929_2977238_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_002806565.1|2977234_2977600_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011408829.1|2977633_2979643_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011408830.1|2979810_2980065_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075242680.1|2981743_2982433_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.3	8.3e-12
WP_011408833.1|2982748_2983510_+	transporter	NA	NA	NA	NA	NA
WP_011408834.1|2983523_2985866_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	4.5e-09
WP_115840174.1|2986362_2987328_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_044756755.1|2987567_2989814_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	2.9e-13
WP_042465628.1|2990542_2992654_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.2e-14
WP_069959907.1|2993338_2995414_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.3e-12
WP_011259431.1|2996006_2998268_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
WP_011408839.1|2998661_3000923_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_011408840.1|3001892_3002678_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_011408841.1|3002813_3003296_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_094187763.1|3004144_3004942_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	3085988	3097763	4898917	tRNA	Escherichia_phage(22.22%)	12	NA	NA
WP_011259503.1|3085988_3086288_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
WP_011259504.1|3086330_3086561_-	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259505.1|3086804_3087554_-	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011408881.1|3087558_3088254_-	hypothetical protein	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_012444559.1|3088439_3088739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057240.1|3089126_3089531_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	56.6	1.1e-32
WP_003481884.1|3090256_3090469_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_011259507.1|3090608_3093257_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_012444556.1|3093358_3093847_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011408884.1|3094149_3095184_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_011408885.1|3095356_3095998_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408886.1|3096086_3097763_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 26
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	3180807	3227898	4898917	transposase,plate	Acidithiobacillus_phage(25.0%)	29	NA	NA
WP_012444515.1|3180807_3182283_-|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	5.4e-101
WP_011408934.1|3182365_3184954_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011259580.1|3185010_3186123_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259581.1|3186247_3186826_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042465046.1|3188312_3190400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959920.1|3190785_3191883_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465048.1|3192299_3195380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033013236.1|3198415_3199123_+	response regulator	NA	NA	NA	NA	NA
WP_011408941.1|3199119_3200112_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259589.1|3200108_3202568_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_011259590.1|3202681_3203662_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041182188.1|3203670_3204699_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_113079223.1|3204871_3205198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703483.1|3205194_3208098_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_011259593.1|3208094_3208817_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_041182189.1|3208813_3209461_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_113079225.1|3209457_3212916_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011408948.1|3212919_3214236_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_011408949.1|3214237_3215575_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_069959924.1|3215571_3216963_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_011408951.1|3216959_3217499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444497.1|3217507_3219445_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
WP_011408952.1|3219709_3220168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168760.1|3220555_3221050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703476.1|3221115_3221613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408953.1|3221801_3224507_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	4.3e-80
WP_011408954.1|3224539_3225550_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011259602.1|3225513_3227391_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259603.1|3227394_3227898_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 27
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	3232729	3288746	4898917	transposase	Ralstonia_phage(83.33%)	43	NA	NA
WP_011257031.1|3232729_3233698_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_069964543.1|3233833_3235150_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260830.1|3235320_3236556_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3236741_3237710_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408960.1|3237761_3239678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259611.1|3239702_3240440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408961.1|3240470_3242813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465640.1|3242830_3243577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465052.1|3243605_3246440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465054.1|3247097_3248927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445381.1|3248940_3249540_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_012445382.1|3249627_3249984_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_012445383.1|3249980_3250403_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408967.1|3250418_3250652_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_069960235.1|3250678_3250939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704270.1|3251287_3253072_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_027704269.1|3253104_3254091_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_042465057.1|3254501_3258215_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_094187765.1|3258740_3259504_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445389.1|3259607_3260255_-	response regulator	NA	NA	NA	NA	NA
WP_011408973.1|3260476_3261238_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011258802.1|3261395_3262364_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408974.1|3262497_3262863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408975.1|3262921_3263353_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011259625.1|3263364_3264627_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408976.1|3264610_3265903_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011408977.1|3266272_3267043_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011259629.1|3267799_3269035_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011408979.1|3270334_3270592_-	stress-induced protein	NA	NA	NA	NA	NA
WP_115840177.1|3271031_3272015_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	1.5e-99
WP_011258802.1|3272330_3273299_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408981.1|3273427_3274390_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_153296740.1|3274639_3274798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182195.1|3274829_3275009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|3275373_3276339_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408985.1|3277546_3278524_+	siroheme synthase	NA	NA	NA	NA	NA
WP_042465070.1|3279332_3279527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408987.1|3280920_3281283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408988.1|3281266_3281836_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_011259640.1|3281873_3283127_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011408989.1|3283332_3283710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408991.1|3285638_3286874_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|3287711_3288746_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 28
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	3429876	3490189	4898917	tRNA,transposase,protease	Burkholderia_virus(14.29%)	49	NA	NA
WP_094187736.1|3429876_3430640_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259756.1|3431663_3434030_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011409066.1|3434026_3434701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259758.1|3434910_3435849_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011259759.1|3435971_3437321_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259760.1|3437317_3438205_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011409067.1|3438522_3439329_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011259762.1|3439774_3440992_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011409068.1|3441097_3442066_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
WP_011259764.1|3442408_3443077_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_011259765.1|3443073_3443847_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_075241401.1|3444420_3446373_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|3447053_3448079_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409070.1|3448163_3449237_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259771.1|3449229_3450333_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_011259772.1|3450343_3451270_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011259773.1|3451350_3452001_+	SCO family protein	NA	NA	NA	NA	NA
WP_027703264.1|3451997_3452846_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_041182211.1|3453396_3454980_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_103057205.1|3456402_3457620_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_153296738.1|3457580_3457868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409076.1|3457978_3458485_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_011259780.1|3458606_3460007_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_012445553.1|3460269_3460845_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011409078.1|3460841_3461276_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259783.1|3462122_3462308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|3462342_3462912_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259785.1|3463004_3463856_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259787.1|3465243_3467259_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445555.1|3467529_3468228_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409081.1|3468268_3468676_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_011409082.1|3469113_3470076_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409084.1|3471359_3472610_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011409085.1|3472617_3473862_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011259794.1|3474089_3474569_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027704197.1|3474679_3475216_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259796.1|3475325_3476075_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_011259797.1|3476282_3476774_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011409088.1|3477887_3479207_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_069963877.1|3479350_3481057_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011409090.1|3481090_3482395_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259802.1|3482426_3482687_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011409091.1|3482688_3483564_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027704198.1|3485398_3485863_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|3485914_3486103_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_069963878.1|3486075_3486396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465665.1|3486392_3487760_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011409095.1|3487905_3488487_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_011259808.1|3488743_3490189_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 29
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	3509289	3557991	4898917	tRNA,integrase,transposase	Ralstonia_phage(33.33%)	37	3532108:3532167	3548778:3549441
WP_011409106.1|3509289_3511932_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_011259826.1|3512004_3512616_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011409107.1|3512820_3513678_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011409108.1|3513933_3514383_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_109181928.1|3514682_3515648_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3515772_3516535_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704065.1|3517145_3517439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259829.1|3517912_3518146_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_011409111.1|3518179_3519193_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259831.1|3519160_3519352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801901.1|3519442_3520762_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182217.1|3520849_3522064_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_011259834.1|3522209_3522737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115840178.1|3522733_3523699_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187771.1|3523939_3524702_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409116.1|3525004_3527137_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011258529.1|3527687_3528656_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011257031.1|3528847_3529816_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_115840192.1|3529960_3530926_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_048488802.1|3530972_3531305_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|3531301_3532065_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
3532108:3532167	attL	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTC	NA	NA	NA	NA
WP_094187763.1|3532936_3533734_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409118.1|3533767_3534160_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_027704094.1|3534250_3534643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239728.1|3536981_3537401_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
WP_012445601.1|3539117_3540902_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_011259851.1|3541092_3541293_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011409125.1|3541828_3542623_+	thiazole synthase	NA	NA	NA	NA	NA
WP_011259853.1|3542924_3543683_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011259854.1|3543758_3545621_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_011409127.1|3545678_3546020_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259856.1|3546279_3546555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409129.1|3549601_3550315_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
3548778:3549441	attR	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTCAGCACAAGCCCAAACGCGGATGACGGCGTACAACGGCGGCCACACGCAGCTGGGTGCCGGAGGAGTTGCGGATTGTGCATCGCCCCGAAGAAGTGCAGACGCGCTTGGTCCCAGGTCATTGGGAAGGCGACTTGATCAAGGGCGCATTCAATCGTTCTTGCGTGGGCACGTTGGTGGAACGCAAGACGCGCTTTGTCGTGCTGTGCCGCATGGATGGCTGCACGGCCGCAGATGCGCTGGAAGGGTTTACCCGGCAAATGAAGAAACTGCCGGCCTCAATGCGGACAAGTCTGACCTACGATCGCGGTACCGAGCTCACGTGCTACGCCGAGCTGATGCAAGGATTGAACATCGACGTGTGGTTCGCTGATCCACATGCGCCGTGGCAGCGGGGAAGTAACGAGAACACCAACGGCCTGCTGCGCCAATTCCTGCCCAAGGGCGCCGACCTGTCCACTGTCAGCCAAGAGTATCTCAATCACATCGCACTGCTGATGAATACCCGCCCTCGTCAGACGCTCGGATGGAAGACACCAAGCGAGGCAATGGAGGAAGAAATCGCAGCACTCAAATCACGTGTTGCACTTGAATCTTGAGACTGCCC	NA	NA	NA	NA
WP_012445603.1|3550375_3550798_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_094187715.1|3550929_3551693_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409134.1|3554766_3555678_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_115801902.1|3557025_3557991_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	3605441	3650017	4898917	transposase	Ralstonia_phage(50.0%)	32	NA	NA
WP_011407175.1|3605441_3606410_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407587.1|3607430_3608465_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011259895.1|3608848_3609574_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409154.1|3609705_3610167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704153.1|3613613_3615734_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_027704154.1|3616000_3616846_-	transporter	NA	NA	NA	NA	NA
WP_011257031.1|3617837_3618806_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011259903.1|3619130_3621101_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_011259904.1|3621529_3622927_+	endoproteinase ArgC	NA	NA	NA	NA	NA
WP_027704156.1|3623039_3623858_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011259907.1|3624168_3627420_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	6.1e-81
WP_011259908.1|3627601_3629020_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_011259909.1|3629029_3629680_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011409164.1|3629681_3630287_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
WP_011259911.1|3630436_3630658_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409165.1|3630667_3631093_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
WP_094187731.1|3631584_3632382_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409167.1|3633459_3634239_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409168.1|3634453_3635083_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027704159.1|3635143_3635899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182227.1|3636227_3637004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182229.1|3637412_3638987_+	protein kinase	NA	NA	NA	NA	NA
WP_011409172.1|3639235_3639502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409173.1|3639780_3642960_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.3	1.2e-73
WP_011258802.1|3643025_3643994_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407756.1|3644193_3645513_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011409174.1|3645596_3646271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409175.1|3646270_3647017_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_011409176.1|3647013_3647547_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011258529.1|3647672_3648641_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_113079192.1|3648755_3649046_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011258803.1|3649048_3650017_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
>prophage 31
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	3666281	3724984	4898917	transposase,plate	Staphylococcus_prophage(20.0%)	38	NA	NA
WP_069970072.1|3666281_3667238_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_082325322.1|3667212_3669651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182737.1|3669562_3670594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325323.1|3670602_3672540_-	DUF3784 domain-containing protein	NA	NA	NA	NA	NA
WP_011409194.1|3672451_3673471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325324.1|3673475_3675419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325325.1|3675330_3676353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409198.1|3678317_3679343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325327.1|3679346_3682214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113079154.1|3682232_3683138_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_082325328.1|3683079_3685842_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	9.6e-43
WP_011259938.1|3685934_3686288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259939.1|3686318_3689048_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_011259940.1|3689133_3690225_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_069959967.1|3690188_3692024_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011409203.1|3692026_3692515_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003467612.1|3692662_3693160_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011409204.1|3693301_3694798_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467601.1|3694801_3695302_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_033005590.1|3695348_3695837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409206.1|3696223_3696832_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011409207.1|3696983_3698318_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_113079215.1|3698317_3699106_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_115840179.1|3699116_3701834_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_075242365.1|3701830_3702808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168764.1|3702782_3703358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115840180.1|3703366_3705535_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011259950.1|3705559_3708454_+	calcium-binding protein	NA	A0A2D1GNI0	Pseudomonas_phage	27.5	7.5e-06
WP_011409552.1|3708692_3709655_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_146770766.1|3709731_3710346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259951.1|3710368_3711802_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_075242326.1|3711805_3714061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129215583.1|3714035_3714581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259961.1|3716420_3716810_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_113079229.1|3716790_3719022_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011259963.1|3719021_3719618_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_041182243.1|3719610_3720435_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011258188.1|3724015_3724984_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 32
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	3774373	3785204	4898917	transposase	Burkholderia_virus(28.57%)	8	NA	NA
WP_042465718.1|3774373_3775177_-	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
WP_027703308.1|3775607_3775790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182486.1|3776261_3779216_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	49.9	5.3e-257
WP_011260010.1|3779545_3779995_+	hypothetical protein	NA	A4JWV5	Burkholderia_virus	34.1	3.3e-09
WP_113079227.1|3779991_3780687_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	46.1	2.2e-36
WP_011409251.1|3780694_3781765_+	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	36.6	5.7e-60
WP_011409252.1|3781761_3782847_+	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	37.9	4.0e-61
WP_069960108.1|3784247_3785204_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.8e-41
>prophage 33
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	4092761	4187875	4898917	transposase	Ralstonia_phage(17.65%)	66	NA	NA
WP_115840193.1|4092761_4094369_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075242322.1|4094530_4094794_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_075242321.1|4094798_4095458_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
WP_011260279.1|4095644_4097009_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_011409411.1|4097224_4097920_+	VIT family protein	NA	NA	NA	NA	NA
WP_011409413.1|4098866_4099490_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011260283.1|4099634_4100432_+	cytochrome c4	NA	NA	NA	NA	NA
WP_011409415.1|4100525_4101176_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260284.1|4101267_4102083_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011409416.1|4102132_4102870_+	endonuclease	NA	NA	NA	NA	NA
WP_082325341.1|4104798_4105794_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.0	5.4e-97
WP_041182588.1|4105916_4108490_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_109182012.1|4108682_4109445_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|4109518_4110487_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011409421.1|4111220_4111487_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094187728.1|4112418_4113217_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|4114863_4116096_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_115840183.1|4116135_4117098_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|4117273_4118230_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011257031.1|4118441_4119410_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_094187715.1|4119745_4120508_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182027.1|4123918_4124884_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012444134.1|4125345_4125576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409428.1|4126200_4128243_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_011409429.1|4128244_4130143_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011260297.1|4130144_4131398_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_011260298.1|4131394_4132000_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_011409430.1|4132419_4133574_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_011260300.1|4133576_4134605_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_011409431.1|4134601_4135678_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260302.1|4135718_4136996_-	sugar MFS transporter	NA	NA	NA	NA	NA
WP_011409432.1|4137040_4137808_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409433.1|4138022_4139189_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_075242688.1|4139322_4141719_-	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_011260306.1|4141715_4144613_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
WP_011409436.1|4144763_4147454_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409437.1|4147735_4148692_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.6e-42
WP_011409439.1|4149182_4150418_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_103057228.1|4151853_4153038_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011409442.1|4153105_4153843_+	pteridine reductase	NA	NA	NA	NA	NA
WP_011260313.1|4154011_4154527_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011260314.1|4154618_4156121_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
WP_011260315.1|4156124_4156565_-	response regulator	NA	NA	NA	NA	NA
WP_011409443.1|4156561_4158373_-	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
WP_011260317.1|4158658_4159030_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_011260318.1|4159180_4160233_+	oxidoreductase	NA	NA	NA	NA	NA
WP_011260319.1|4160572_4161514_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
WP_075239460.1|4161534_4162872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409446.1|4163043_4163424_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_012444115.1|4163548_4164310_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_053504166.1|4166558_4167962_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	52.1	1.2e-131
WP_053504165.1|4168084_4169140_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.7e-80
WP_053504164.1|4169301_4170168_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_053504163.1|4170459_4172643_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.4	1.8e-81
WP_011260329.1|4173141_4174236_-	type II restriction enzyme	NA	NA	NA	NA	NA
WP_041182275.1|4174232_4176044_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_011260331.1|4176288_4177302_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_011260332.1|4177316_4178015_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_011409453.1|4178002_4178281_-	YbeD family protein	NA	NA	NA	NA	NA
WP_011260334.1|4179346_4180552_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
WP_011260335.1|4181052_4182468_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_011260336.1|4182464_4183604_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_125168765.1|4184829_4185372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409455.1|4185343_4186618_-	DUF3380 domain-containing protein	NA	B3FJ91	Pseudomonas_phage	33.7	1.2e-21
WP_075242420.1|4186617_4186836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409456.1|4186912_4187875_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	4213844	4295866	4898917	transposase,protease	Erwinia_phage(18.18%)	55	NA	NA
WP_011260359.1|4213844_4215212_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.1	6.2e-43
WP_011260360.1|4215322_4215874_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_011409475.1|4216389_4217307_-	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	27.7	2.2e-12
WP_011409476.1|4217506_4218178_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_011260363.1|4218174_4219029_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_011409477.1|4219018_4219255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409478.1|4219312_4219711_-	YbaN family protein	NA	NA	NA	NA	NA
WP_027703683.1|4220054_4222190_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	2.1e-29
WP_011409479.1|4222313_4223498_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011409480.1|4223823_4224255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409481.1|4224337_4226431_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409482.1|4226498_4226810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260370.1|4227197_4227767_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_011260371.1|4227875_4228841_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260372.1|4229399_4230200_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_011409484.1|4230750_4231665_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011409485.1|4231695_4232433_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011260375.1|4232463_4233516_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
WP_011260376.1|4233520_4234189_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011260377.1|4234340_4236278_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_094187780.1|4237004_4237767_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260378.1|4238081_4239731_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_011409489.1|4241121_4242609_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.7	1.0e-123
WP_011260380.1|4242816_4244265_+	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.3	7.5e-47
WP_011409492.1|4245499_4248124_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.6	1.9e-08
WP_011260383.1|4248379_4251250_+	insulinase family protein	NA	NA	NA	NA	NA
WP_041182280.1|4251797_4252727_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011409494.1|4252765_4253770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187782.1|4254012_4254776_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704042.1|4255823_4256609_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_011260388.1|4256862_4258536_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_011409497.1|4259079_4259526_-	autotransporter	NA	NA	NA	NA	NA
WP_012444053.1|4259856_4260141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260390.1|4260735_4261647_-	magnesium transporter	NA	NA	NA	NA	NA
WP_011409498.1|4261892_4262888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260392.1|4262981_4264358_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_041182283.1|4265578_4267225_+	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_011260394.1|4267633_4269406_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_011409500.1|4269681_4270557_-	DMT family transporter	NA	NA	NA	NA	NA
WP_027703846.1|4270754_4271633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260398.1|4273672_4274764_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_041182286.1|4276666_4278991_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260402.1|4279186_4281133_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409509.1|4281507_4281699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260404.1|4282089_4283673_+	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_027704189.1|4284020_4284617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409513.1|4285965_4286814_-	amino acid lyase	NA	NA	NA	NA	NA
WP_011409514.1|4286848_4288324_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
WP_011260408.1|4288914_4289844_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_011260409.1|4290078_4290570_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260410.1|4290566_4291238_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011409516.1|4291632_4291962_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_012444032.1|4292170_4293097_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.7	3.9e-49
WP_094187728.1|4293885_4294684_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|4294831_4295866_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 35
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	4316745	4358453	4898917	tRNA,transposase	Ralstonia_phage(50.0%)	37	NA	NA
WP_109182021.1|4316745_4317711_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260435.1|4318243_4318624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080493654.1|4318826_4319729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409537.1|4319800_4321096_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_011409538.1|4321225_4321750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260439.1|4322175_4323441_-	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409539.1|4323437_4324415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444011.1|4324518_4325322_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011260442.1|4325497_4326307_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_109182023.1|4326314_4327113_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465763.1|4327155_4327773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409543.1|4327897_4328473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181902.1|4328684_4330004_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|4330153_4331122_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011409546.1|4331247_4332000_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011260447.1|4332037_4332478_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_011409547.1|4332684_4333026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260449.1|4333251_4333629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260450.1|4333839_4334037_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_113079160.1|4334343_4335090_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409549.1|4335182_4335989_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_012444005.1|4336212_4337625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260454.1|4337621_4338719_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_094187763.1|4338873_4339672_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099051302.1|4339725_4340524_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409552.1|4340743_4341706_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_115840184.1|4342153_4342917_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260456.1|4343198_4343975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409554.1|4343971_4345288_+	amino acid permease	NA	NA	NA	NA	NA
WP_011408623.1|4345804_4347040_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260459.1|4347633_4347915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260461.1|4348475_4348910_-	membrane protein	NA	NA	NA	NA	NA
WP_011409559.1|4349084_4350263_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_069960023.1|4351258_4352221_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260467.1|4354554_4356726_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_011409563.1|4356953_4357310_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260469.1|4357388_4358453_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
>prophage 36
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	4381417	4439933	4898917	tRNA,transposase	Acinetobacter_phage(30.0%)	45	NA	NA
WP_094187805.1|4381417_4382396_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
WP_115840195.1|4382475_4383441_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_003483093.1|4383453_4383924_-	bacterioferritin	NA	NA	NA	NA	NA
WP_027703893.1|4384266_4384482_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011260490.1|4384562_4385180_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005990700.1|4385728_4386121_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260491.1|4386124_4386553_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_011260492.1|4386738_4387392_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_011409578.1|4387673_4387988_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260494.1|4388147_4388942_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_115840185.1|4389079_4389772_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_011409579.1|4390092_4390809_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011260497.1|4390801_4391599_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
WP_011409580.1|4391735_4392773_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_011260499.1|4392890_4393520_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011409581.1|4393671_4394253_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_094187806.1|4395680_4396782_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
WP_011409585.1|4397386_4399618_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011409586.1|4399807_4401520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260506.1|4401668_4403045_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.4e-79
WP_094187777.1|4405252_4406051_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407175.1|4407035_4408004_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_069960033.1|4408170_4409142_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
WP_011409594.1|4409334_4410519_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011260517.1|4410986_4411802_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_011409596.1|4412560_4413877_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011260520.1|4414136_4415381_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011260521.1|4415473_4418722_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_011409597.1|4418855_4421996_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011409598.1|4422285_4423653_-	VOC family protein	NA	NA	NA	NA	NA
WP_041182775.1|4424397_4425363_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_069964616.1|4425781_4426747_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027703675.1|4427209_4427680_+	thioesterase	NA	NA	NA	NA	NA
WP_011409601.1|4427708_4428131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260528.1|4428206_4428641_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011260529.1|4428750_4429266_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011409602.1|4429281_4430307_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011260531.1|4430629_4431226_-	Ax21 family protein	NA	NA	NA	NA	NA
WP_011260532.1|4431583_4433311_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_011260533.1|4433360_4434803_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011260534.1|4434787_4436134_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409603.1|4436324_4437074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260536.1|4437175_4437787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260537.1|4437891_4439115_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260538.1|4439456_4439933_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 37
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	4452800	4510732	4898917	integrase,transposase	Leptospira_phage(25.0%)	37	4452684:4452703	4466743:4466762
4452684:4452703	attL	AGTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
WP_011260549.1|4452800_4454177_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
WP_041182305.1|4454187_4454721_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409609.1|4455149_4456409_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_011260552.1|4456547_4457855_-	MFS transporter	NA	NA	NA	NA	NA
WP_011407587.1|4459939_4460974_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409611.1|4461324_4461870_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_011409612.1|4461895_4462162_-	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011260556.1|4462336_4464175_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011260557.1|4464405_4465281_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
WP_011409614.1|4467398_4468541_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	5.3e-96
4466743:4466762	attR	GGGGTTTTTCAGGGGCGACT	NA	NA	NA	NA
WP_011260560.1|4469667_4470567_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_011260561.1|4471514_4474316_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
WP_011409617.1|4474392_4474683_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_113101711.1|4475040_4476143_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	6.7e-40
WP_075240612.1|4476248_4476839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168769.1|4476979_4477885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409622.1|4478074_4480762_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_011409626.1|4484083_4488013_+	avirulence protein	NA	NA	NA	NA	NA
WP_011409629.1|4489701_4490214_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	68.8	1.6e-44
WP_075244060.1|4490210_4490438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013372.1|4490722_4491070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409630.1|4491287_4493294_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_012443890.1|4493290_4493722_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_011260579.1|4493718_4494138_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_075240651.1|4494623_4495376_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_011409633.1|4495586_4496177_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_011409634.1|4496310_4497258_+	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_011409635.1|4497300_4498170_+	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
WP_011409636.1|4498166_4498667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409640.1|4501765_4502326_+	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	29.6	2.1e-13
WP_011409641.1|4502421_4505247_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_011260589.1|4505408_4505927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409642.1|4505926_4506847_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_011260591.1|4507275_4507899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443879.1|4507908_4508100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465296.1|4508196_4508817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182033.1|4509766_4510732_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 38
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	4588259	4731663	4898917	tRNA,tail,transposase	Arthrobacter_phage(18.75%)	91	NA	NA
WP_109182036.1|4588259_4589225_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260658.1|4589325_4589751_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094187715.1|4589793_4590556_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260659.1|4590618_4591650_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.0e-70
WP_011260660.1|4593010_4594267_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011260661.1|4594263_4595154_+	allantoinase PuuE	NA	NA	NA	NA	NA
WP_012443820.1|4595150_4595546_+	DUF3225 domain-containing protein	NA	NA	NA	NA	NA
WP_075239612.1|4595565_4596144_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_115801912.1|4596029_4596887_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_011409690.1|4596819_4598208_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260667.1|4602993_4605078_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260668.1|4605177_4607205_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011260669.1|4607447_4609058_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_011260670.1|4609068_4610232_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011409694.1|4610360_4610981_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260672.1|4611542_4611878_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_075242289.1|4613502_4613814_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_011409699.1|4614932_4615451_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_011409700.1|4615722_4617441_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011260679.1|4617531_4617918_-	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_011260680.1|4617979_4619305_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_011260681.1|4619419_4620733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260682.1|4620831_4621557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409701.1|4621773_4622436_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409702.1|4622514_4623609_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011409705.1|4625113_4627873_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.9	3.5e-146
WP_011409706.1|4628125_4629715_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_011409707.1|4629714_4631952_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011409708.1|4632240_4633149_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011409709.1|4633238_4635053_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_153303324.1|4635438_4644264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182038.1|4644362_4645160_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409712.1|4645704_4646457_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_011260693.1|4646516_4647416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260694.1|4647567_4648323_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_011409714.1|4648319_4648955_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003484969.1|4648970_4649198_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_011409715.1|4649270_4650173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409716.1|4650327_4651293_+	ferrochelatase	NA	NA	NA	NA	NA
WP_075242173.1|4651390_4652146_+	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
WP_011409718.1|4652226_4652685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409719.1|4652955_4653741_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409720.1|4654367_4655273_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	4.1e-43
WP_011260702.1|4655336_4656254_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_011259480.1|4656857_4658195_+	xylose isomerase	NA	NA	NA	NA	NA
WP_011409721.1|4658420_4659488_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409722.1|4659663_4661859_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409723.1|4661855_4663820_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409724.1|4663831_4665091_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_011260707.1|4665090_4666791_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011260708.1|4666793_4669508_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260709.1|4669730_4671203_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_011260711.1|4672180_4673236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260712.1|4673463_4674882_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_011409725.1|4674922_4675900_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_042465333.1|4677316_4678618_-	MFS transporter	NA	NA	NA	NA	NA
WP_011409727.1|4679079_4682013_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409728.1|4682111_4683599_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260718.1|4683630_4684665_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_094187716.1|4685081_4685879_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182039.1|4687185_4688142_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_115840186.1|4688869_4689632_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075242372.1|4689649_4690750_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011260725.1|4690815_4691937_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_011409734.1|4691946_4693023_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260727.1|4693115_4693796_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_109182041.1|4693828_4694627_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409735.1|4694755_4696075_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465802.1|4696177_4697134_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.4e-41
WP_011260733.1|4698600_4699059_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409738.1|4699160_4699589_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_069960048.1|4699835_4700699_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_042465346.1|4703875_4704142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260739.1|4704303_4704552_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011409743.1|4704760_4705519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465805.1|4705515_4706211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409745.1|4706309_4706642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409747.1|4707113_4707548_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_069960049.1|4707663_4707909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260743.1|4708244_4708577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703652.1|4709026_4710421_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011260746.1|4711358_4711649_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	53.8	1.5e-15
WP_011260747.1|4711666_4711948_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	40.7	3.1e-10
WP_011409750.1|4712042_4714295_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	21.7	8.7e-10
WP_082325367.1|4714482_4718550_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	4.1e-10
WP_011409752.1|4718546_4721960_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_125168771.1|4722007_4722298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409756.1|4728873_4729419_+|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_011260754.1|4729487_4730015_+|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011260755.1|4730073_4730610_+|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
WP_109182045.1|4730697_4731663_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 39
NZ_CP031459	Xanthomonas oryzae pv. oryzae strain JL33 chromosome, complete genome	4898917	4814223	4887039	4898917	transposase,protease	Ralstonia_virus(20.0%)	52	NA	NA
WP_011260830.1|4814223_4815459_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260831.1|4816330_4817386_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_011260832.1|4817378_4818050_-	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_011260833.1|4818147_4819455_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409807.1|4819471_4820890_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011409808.1|4821461_4822856_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_011260838.1|4823203_4825390_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.7	2.2e-111
WP_012446438.1|4825565_4825790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182049.1|4826370_4827336_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409811.1|4827511_4828927_-	amino acid permease	NA	NA	NA	NA	NA
WP_075242296.1|4829417_4831742_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_041182970.1|4832147_4832510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409815.1|4832887_4833433_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	33.9	2.6e-16
WP_011260845.1|4836685_4837813_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_011409820.1|4838668_4840009_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_011409821.1|4840225_4840918_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409822.1|4841034_4841355_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_011260850.1|4841354_4842347_+	D-2-hydroxyacid dehydrogenase family protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.4	8.5e-10
WP_011409823.1|4842653_4844177_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.7e-25
WP_011409824.1|4844281_4845517_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_011260853.1|4845677_4846334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409825.1|4846484_4848296_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_011409826.1|4848443_4848794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115840187.1|4848972_4850292_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465377.1|4851704_4852886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409829.1|4852983_4856415_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011409830.1|4856562_4857261_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_011409831.1|4857244_4858717_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_011409832.1|4858713_4859301_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_011409833.1|4859300_4860497_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_041182832.1|4860570_4861173_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	48.9	2.0e-46
WP_069960057.1|4861348_4861792_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_113055205.1|4862047_4862671_+	TolC family protein	NA	NA	NA	NA	NA
WP_011409837.1|4862667_4863234_+	FUSC family protein	NA	NA	NA	NA	NA
WP_011409838.1|4863509_4864871_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.9	8.3e-32
WP_075242371.1|4864984_4865305_-	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_069960058.1|4867120_4867327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960059.1|4867313_4868426_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_049756351.1|4870777_4871530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409848.1|4871526_4872234_-	hypothetical protein	NA	A4PE25	Ralstonia_virus	34.6	2.0e-08
WP_113079208.1|4872247_4872589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757268.1|4872569_4873079_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	4.8e-09
WP_011409850.1|4873075_4873477_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_011407756.1|4873868_4875188_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_005921785.1|4876299_4876521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446478.1|4877417_4877603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757270.1|4878635_4879805_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	1.3e-41
WP_069960119.1|4879830_4881141_-	MFS transporter	NA	NA	NA	NA	NA
WP_069960063.1|4883054_4883375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960064.1|4883493_4884660_-	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
WP_011260885.1|4884922_4885879_+	TerC family protein	NA	K4F9T9	Cronobacter_phage	29.9	8.4e-31
WP_011260886.1|4886253_4887039_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
