The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	6936	49219	5015823	protease,transposase	Ralstonia_phage(33.33%)	38	NA	NA
WP_011407164.1|6936_7773_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_044756151.1|7959_8766_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9042_10236_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_044756154.1|10389_11058_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|11142_11904_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|11950_12373_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|12376_12790_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257017.1|13085_13853_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|13863_14133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257019.1|14207_15668_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|16314_17325_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|17596_18799_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|18940_21079_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|21289_21583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296734.1|21614_22112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257024.1|22358_23339_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	1.6e-88
WP_011257025.1|23386_24553_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_011257026.1|24699_25266_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_011257028.1|26740_27958_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|28585_29608_-	sugar kinase	NA	NA	NA	NA	NA
WP_080493590.1|30188_31442_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_094187708.1|31515_32313_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157724563.1|32300_33275_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012443571.1|34159_34822_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_044756160.1|34975_35770_-	EcsC family protein	NA	NA	NA	NA	NA
WP_027704023.1|35937_36411_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|38741_39698_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756163.1|39745_40657_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257041.1|41143_41542_-	host attachment protein	NA	NA	NA	NA	NA
WP_044756164.1|41633_42326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|42495_42966_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011407233.1|44432_44744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756166.1|44998_45946_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.4	4.3e-43
WP_044756167.1|46086_47145_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011257048.1|47283_47565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407230.1|47617_47878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168735.1|47945_48155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445831.1|48238_49219_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	3.7e-98
>prophage 2
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	84951	142296	5015823	transposase	Acidithiobacillus_phage(25.0%)	41	NA	NA
WP_044749647.1|84951_86328_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_041182539.1|86493_88047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257097.1|90260_90602_-	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_041182843.1|90786_93345_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_011407204.1|93363_93624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187710.1|93683_94446_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407202.1|94453_96178_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
WP_011257102.1|96418_97360_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_041182540.1|97552_98917_+	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011257104.1|98913_100542_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_027703733.1|101015_102599_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_044756187.1|102595_104830_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_011257107.1|104832_106590_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_094187819.1|106646_108536_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_027703731.1|108532_111142_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_011407199.1|111164_111350_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011257110.1|111464_113627_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_027703730.1|113643_114276_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_075244499.1|114439_114937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407197.1|115077_116124_-	methylamine utilization protein	NA	NA	NA	NA	NA
WP_041182545.1|117519_118476_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_125168734.1|118528_118807_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_115862254.1|118803_119769_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_080256641.1|119866_120877_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_080256644.1|123374_123833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|123832_124165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|124181_124442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|125765_127175_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155296471.1|127209_127362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407187.1|127523_127955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443638.1|128229_128565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407184.1|129004_130294_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
WP_012443641.1|130912_131893_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.0	1.0e-87
WP_012443642.1|132358_132682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|133241_134207_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_044756190.1|135878_137255_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_129215536.1|137856_138564_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.6e-05
WP_070344074.1|138560_139832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128415443.1|139946_140852_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_133264932.1|140855_141272_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_044756191.1|141339_142296_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	6.2e-42
>prophage 3
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	176994	322545	5015823	tail,tRNA,transposase	Arthrobacter_phage(13.64%)	99	NA	NA
WP_115862255.1|176994_177960_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407263.1|182359_183388_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_103057315.1|183561_183657_-	xylosidase	NA	NA	NA	NA	NA
WP_041181912.1|183632_184160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464354.1|184982_187166_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_011407267.1|187177_190528_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011257178.1|190524_193641_-	DUF3416 domain-containing protein	NA	NA	NA	NA	NA
WP_011407587.1|195568_196603_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_094187821.1|199300_199480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080494036.1|199482_199809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443686.1|199878_199992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756212.1|200074_201550_+|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.1	1.4e-101
WP_012443690.1|203158_204679_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_011257185.1|204695_204974_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_011257186.1|205163_205502_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_012443692.1|206114_208100_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_041182297.1|208731_209694_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011257188.1|210099_210912_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_011257189.1|211104_211716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257190.1|212132_212990_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	31.5	2.9e-14
WP_012443696.1|213227_215114_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_044756215.1|217445_220169_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.2	6.3e-71
WP_044757283.1|220236_222390_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.6e-27
WP_044756216.1|222386_224078_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_012443704.1|224613_226518_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_075239321.1|226778_226958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756221.1|227091_227559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257199.1|227716_228676_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_044756223.1|228660_229278_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011257200.1|229320_229740_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_012443706.1|229992_230898_-	lipid A hydroxylase LpxO	NA	S4VR59	Pandoravirus	39.5	2.6e-37
WP_011257202.1|231146_232031_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011257203.1|232094_232877_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407292.1|232921_233683_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_011257206.1|233846_234176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407293.1|234494_235586_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_011407294.1|235654_237253_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_011407295.1|237417_238662_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_044756226.1|239113_239743_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	2.6e-52
WP_011257211.1|239949_241926_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
WP_011407298.1|243313_243979_-	YceH family protein	NA	NA	NA	NA	NA
WP_044756232.1|244265_245276_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_011257215.1|245272_246004_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_044756234.1|246357_247887_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.3e-46
WP_011407300.1|247996_251029_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044756235.1|251327_254366_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257219.1|254530_255583_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_075239519.1|255751_255997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407301.1|255995_256961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756236.1|256960_259624_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_044756238.1|259820_260801_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_008573820.1|261441_261645_-	YdcH family protein	NA	NA	NA	NA	NA
WP_082322966.1|263105_264290_-|transposase	IS256-like element IS1113 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_082322873.1|264340_265018_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756239.1|265014_265557_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_044756241.1|265553_266372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143690736.1|266368_266593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069970072.1|266657_267614_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_044756245.1|267877_268057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052658672.1|268053_268272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069970072.1|268443_269400_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_011409779.1|271499_272537_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_011409777.1|274230_275076_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.7	3.7e-06
WP_011260788.1|275235_276441_+	aminotransferase	NA	NA	NA	NA	NA
WP_011409775.1|276493_276826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409774.1|276874_277612_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.1	1.5e-19
WP_027704185.1|277608_279081_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_044756247.1|279367_280549_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011409772.1|280620_281904_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_012443732.1|281900_282887_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_011260781.1|282931_284209_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_011260780.1|284205_284826_-	helix-turn-helix transcriptional regulator	NA	A0A0K1LLP9	Caulobacter_phage	41.9	1.9e-07
WP_012443733.1|284968_288676_-	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_033013610.1|288870_289233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443735.1|289329_289506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260776.1|289767_290685_+	AEC family transporter	NA	NA	NA	NA	NA
WP_011409768.1|291037_291670_+	ParA family protein	NA	A0A142F1W4	Mycobacterium_phage	36.6	1.6e-09
WP_027704183.1|291685_292162_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011260773.1|292165_292738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260772.1|292734_294750_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_011260771.1|295034_295463_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_011409766.1|295582_296386_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_011260769.1|296445_297435_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_044756250.1|297848_299921_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011409764.1|300115_300727_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_011260766.1|301880_302687_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_011260765.1|302823_303621_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_011260764.1|303842_305252_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_011260763.1|305529_305868_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_027704182.1|305890_307333_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	32.2	2.0e-31
WP_011260761.1|307603_308659_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011409760.1|308651_310079_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_027704181.1|310577_311180_+	superoxide dismutase family protein	NA	I3XM75	Mamestra_brassicae_nuclear_polyhedrosis_virus	40.6	7.7e-14
WP_027704180.1|311250_311883_+	superoxide dismutase family protein	NA	M1ICI8	Paramecium_bursaria_Chlorella_virus	41.0	7.8e-17
WP_115862256.1|312165_313131_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260755.1|313218_313755_-|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
WP_011260754.1|313813_314341_-|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011409756.1|314409_314955_-|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_044756255.1|321309_322545_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	347586	447866	5015823	tRNA,transposase	Staphylococcus_prophage(22.22%)	60	NA	NA
WP_041182856.1|347586_348543_-|transposase	IS30-like element IS1112 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	6.9e-41
WP_109182069.1|348645_349965_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187713.1|350093_350891_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260727.1|350924_351605_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_012443767.1|351697_352774_+	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260725.1|352783_353905_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_113090107.1|353970_354960_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|355088_355852_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187716.1|357784_358583_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260718.1|358999_360034_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011409728.1|360065_361553_-	MFS transporter	NA	NA	NA	NA	NA
WP_044756270.1|361651_364585_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012443772.1|365046_366348_+	MFS transporter	NA	NA	NA	NA	NA
WP_044756273.1|367764_368742_+	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_044756275.1|368782_370201_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_012443777.1|370427_371483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260709.1|372460_373933_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_011260708.1|374155_376870_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260707.1|376872_378573_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011409724.1|378572_379832_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_041182560.1|379843_381808_-	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409722.1|381804_384000_-	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409721.1|384175_385243_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259480.1|385468_386806_-	xylose isomerase	NA	NA	NA	NA	NA
WP_012443789.1|387409_388327_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	4.1e-83
WP_011260701.1|388390_389296_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	3.1e-43
WP_011409719.1|389922_390708_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409718.1|390978_391437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075240508.1|391517_392273_-	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
WP_011409716.1|392370_393336_-	ferrochelatase	NA	NA	NA	NA	NA
WP_011409715.1|393490_394393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003484969.1|394465_394693_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_044756277.1|394708_395350_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_011260694.1|395346_396102_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_012443793.1|396253_397153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409712.1|397212_397965_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_094187718.1|398508_399307_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756280.1|399447_408231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260689.1|408624_410439_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_012443796.1|410528_411437_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011260687.1|411726_413964_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_044756282.1|413963_415565_+	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_011260685.1|415817_418577_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.9	1.2e-146
WP_011409702.1|420081_421176_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011409701.1|421254_421917_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_044756284.1|422133_422859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260681.1|422957_424271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260680.1|424385_425711_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_011260679.1|425772_426159_+	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_044756287.1|426249_427968_-	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011409699.1|428239_428758_-	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_075239745.1|429876_430188_+	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_044756291.1|431812_432154_+	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_011409694.1|432715_433336_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260670.1|433464_434628_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011260669.1|434638_436249_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_011260668.1|436491_438519_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011260667.1|438618_440703_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_041182545.1|442737_443694_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_115862257.1|446546_447866_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	578052	703941	5015823	integrase,tRNA,transposase	Ralstonia_phage(17.65%)	102	556184:556205	590914:590935
556184:556205	attL	GGGGTTTTTCAGGGGCGACTAT	NA	NA	NA	NA
WP_011409614.1|578052_579195_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	5.3e-96
WP_044756339.1|581312_582188_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.2	1.2e-55
WP_044756340.1|582418_584257_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011409612.1|584431_584698_+	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011409611.1|584723_585269_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_012443910.1|585740_587048_+	MFS transporter	NA	NA	NA	NA	NA
WP_011409609.1|587186_588446_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_044749647.1|588687_590064_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_027703952.1|590393_590927_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756341.1|590937_592314_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	8.6e-77
590914:590935	attR	ATAGTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
WP_011260548.1|592548_592707_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_012443914.1|592771_593782_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.2	4.5e-14
WP_011260546.1|594010_595681_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_011409606.1|595999_596383_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011260544.1|596604_597507_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_082322967.1|597503_599999_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_011260542.1|600006_601638_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.5	1.7e-63
WP_011260541.1|601634_602798_-	Fic family protein	NA	NA	NA	NA	NA
WP_011260540.1|602869_603886_-	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_010370565.1|603987_604308_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_044756345.1|604693_605155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756347.1|605181_605658_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011260537.1|605999_607223_-	MFS transporter	NA	NA	NA	NA	NA
WP_011260536.1|607327_607939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409603.1|608040_608790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756348.1|608980_610327_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756350.1|610311_611754_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_044756351.1|611803_613531_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_044756353.1|613889_614486_+	Ax21 family protein	NA	NA	NA	NA	NA
WP_044756355.1|614808_615834_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_044756356.1|615849_616365_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011260528.1|616474_616909_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_044756357.1|616984_617407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703675.1|617435_617906_-	thioesterase	NA	NA	NA	NA	NA
WP_027703859.1|620077_621445_+	VOC family protein	NA	NA	NA	NA	NA
WP_011409597.1|621734_624875_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011260521.1|625008_628257_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_012443931.1|628349_629594_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011409596.1|629853_631170_+	amidohydrolase	NA	NA	NA	NA	NA
WP_011260517.1|631928_632744_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_082322968.1|633211_634396_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	2.9e-41
WP_044756360.1|634537_635773_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407513.1|635841_636231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|636619_637576_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_109181928.1|637611_638577_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407516.1|639815_640538_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.2e-16
WP_027703875.1|640548_641985_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_012443983.1|641984_643253_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011407519.1|643342_645484_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_011407520.1|645568_646234_-	DUF2894 domain-containing protein	NA	NA	NA	NA	NA
WP_011257531.1|646230_646905_-	OmpA family protein	NA	NA	NA	NA	NA
WP_027703874.1|646901_649559_-	DUF802 domain-containing protein	NA	NA	NA	NA	NA
WP_012443985.1|649569_650307_-	DUF3348 domain-containing protein	NA	NA	NA	NA	NA
WP_011257534.1|650645_650858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257535.1|651299_651521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239431.1|651530_651845_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_115862259.1|652305_653625_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260472.1|653876_655625_-	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
WP_012443989.1|655714_656677_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_094187724.1|657439_658202_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409564.1|658970_659417_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
WP_002808376.1|659724_659940_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_011260469.1|660219_661284_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
WP_011409563.1|661362_661719_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260467.1|661946_664118_+	beta-glucosidase	NA	NA	NA	NA	NA
WP_109181928.1|664780_665746_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_044756360.1|666261_667497_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_044756364.1|667912_668875_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_041182297.1|669654_670617_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_041182296.1|671612_672791_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_041182719.1|672957_673914_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_011260461.1|674023_674458_+	membrane protein	NA	NA	NA	NA	NA
WP_011260459.1|675018_675300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187784.1|675503_676266_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704068.1|676325_677642_-	amino acid permease	NA	NA	NA	NA	NA
WP_011260456.1|677638_678415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182294.1|679091_680054_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_094187728.1|680273_681071_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703925.1|681226_682324_-	dipeptide epimerase	NA	NA	NA	NA	NA
WP_012444005.1|682320_683733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756368.1|683956_684763_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011258802.1|684825_685794_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_012444006.1|686015_686762_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011260450.1|687068_687266_+	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_011260449.1|687476_687854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409547.1|688079_688421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182719.1|688533_689490_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_044756370.1|689685_690126_+	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_011260446.1|690163_690916_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011258188.1|691041_692010_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409543.1|692213_692789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465763.1|692913_693531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115862261.1|693573_694371_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260442.1|694379_695189_-	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_012444011.1|695364_696168_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_027703938.1|696271_697249_+	uroporphyrin-III methyltransferase	NA	NA	NA	NA	NA
WP_011260439.1|697245_698511_+	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409538.1|698936_699461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703939.1|699590_700886_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_012444016.1|700957_701860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260435.1|702062_702443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182581.1|702975_703941_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	1036624	1096573	5015823	tRNA,transposase	Tupanvirus(16.67%)	56	NA	NA
WP_094187715.1|1036624_1037387_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260189.1|1037422_1038070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187728.1|1038224_1039023_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260188.1|1039223_1039577_-	DMT family protein	NA	NA	NA	NA	NA
WP_044756474.1|1040541_1041381_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.6	2.6e-28
WP_027704204.1|1042472_1043390_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_044756475.1|1043703_1046187_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_044756477.1|1046183_1046783_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-26
WP_012444227.1|1046907_1047561_+	arylesterase	NA	NA	NA	NA	NA
WP_002811889.1|1047652_1048366_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	2.5e-27
WP_011409346.1|1048508_1049780_+	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.2	1.3e-10
WP_044756480.1|1050353_1051055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409344.1|1051237_1051618_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_011409343.1|1051713_1052352_+	LemA family protein	NA	A0A0C5K8T5	Enterococcus_phage	25.4	2.5e-07
WP_044756482.1|1052689_1053580_+	dehydrogenase	NA	NA	NA	NA	NA
WP_011260174.1|1053579_1054071_+	membrane protein	NA	NA	NA	NA	NA
WP_011260173.1|1054125_1055016_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_011260172.1|1055012_1055807_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	67.8	3.0e-106
WP_027704106.1|1055873_1056161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260171.1|1056157_1056652_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	46.9	3.0e-24
WP_011260170.1|1056705_1057662_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	S4TNS0	Salmonella_phage	25.3	1.3e-07
WP_011260169.1|1057690_1058074_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_011260168.1|1058110_1058899_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_011409339.1|1059155_1060127_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_011409338.1|1060147_1061539_-	chaperone SurA	NA	NA	NA	NA	NA
WP_011409337.1|1061535_1063977_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_011409336.1|1064104_1065013_-	histone deacetylase family protein	NA	A0A2K9L2T7	Tupanvirus	30.8	3.4e-37
WP_011260163.1|1065050_1065608_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_011409335.1|1065611_1066190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409334.1|1066488_1067697_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_011409333.1|1067693_1068875_+	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_011409332.1|1069002_1069815_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_109182116.1|1070451_1071417_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011409329.1|1072500_1073397_+	gallate dioxygenase	NA	NA	NA	NA	NA
WP_011409327.1|1073833_1074835_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756484.1|1075019_1076498_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.8	1.4e-40
WP_011409325.1|1076700_1078170_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409324.1|1078253_1079081_-	p-hydroxycinnamoyl CoA hydratase/lyase	NA	NA	NA	NA	NA
WP_011260149.1|1079126_1079600_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011409323.1|1079727_1080135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703838.1|1080334_1081057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409321.1|1081139_1082045_-	gluconolactonase	NA	NA	NA	NA	NA
WP_012444247.1|1082239_1083349_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_011409319.1|1083670_1084714_-	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_011409318.1|1084750_1085311_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_011409317.1|1085310_1085721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057260.1|1086078_1086780_-	DMT family transporter	NA	NA	NA	NA	NA
WP_157724585.1|1088235_1088439_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|1088643_1089406_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260138.1|1090496_1092236_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	54.8	9.9e-179
WP_012444256.1|1092640_1093282_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_012444257.1|1093283_1093520_+	DUF2007 domain-containing protein	NA	NA	NA	NA	NA
WP_011409313.1|1093634_1094099_-	response regulator	NA	NA	NA	NA	NA
WP_011260134.1|1094095_1094926_-	response regulator	NA	A0A2K9L5I4	Tupanvirus	38.5	3.4e-12
WP_094187708.1|1094922_1095721_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187801.1|1095774_1096573_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	1191441	1202268	5015823	transposase	Burkholderia_phage(28.57%)	8	NA	NA
WP_082322974.1|1191441_1192398_+|transposase	IS30-like element IS1112 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.4	3.1e-41
WP_011409252.1|1193798_1194884_-	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	37.9	4.0e-61
WP_044756504.1|1194880_1195951_-	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	36.6	9.7e-60
WP_011260011.1|1195958_1196654_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	46.1	2.8e-36
WP_011260010.1|1196650_1197100_-	hypothetical protein	NA	A4JWV5	Burkholderia_virus	34.1	3.3e-09
WP_044757335.1|1197429_1200384_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	50.1	8.1e-258
WP_027703308.1|1200851_1201034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465718.1|1201464_1202268_+	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
>prophage 9
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	1219567	1298597	5015823	plate,transposase	Microcystis_virus(33.33%)	57	NA	NA
WP_094187731.1|1219567_1220366_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259994.1|1220420_1221617_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_010371538.1|1221616_1222258_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011259992.1|1222608_1223790_+	polyketide cyclase	NA	NA	NA	NA	NA
WP_027703302.1|1223871_1224258_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_011259990.1|1224260_1224935_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011259989.1|1224998_1225796_-	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_011259988.1|1225926_1226106_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_011259987.1|1226102_1226387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409230.1|1227003_1228206_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_153303321.1|1229029_1229185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409229.1|1229222_1229963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259982.1|1230162_1231041_+	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	35.5	1.3e-06
WP_011409228.1|1231150_1231411_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_044756512.1|1231470_1232952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259979.1|1236700_1237684_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_044756514.1|1237680_1238511_+	OmpA family protein	NA	NA	NA	NA	NA
WP_011409224.1|1238563_1239637_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_044756517.1|1243546_1246612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756518.1|1246759_1247719_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_075242163.1|1247786_1248353_+	DNA repair protein	NA	NA	NA	NA	NA
WP_044756521.1|1248409_1249366_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	1.2e-16
WP_044756522.1|1249551_1252215_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.3	3.0e-41
WP_011409221.1|1252214_1253111_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_075240218.1|1253107_1253572_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011409218.1|1253595_1254075_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_075239710.1|1254161_1255904_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011259969.1|1255985_1256531_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_044756523.1|1256517_1259583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409215.1|1259635_1260598_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	1.2e-16
WP_044756524.1|1260783_1263453_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.3	5.1e-41
WP_044756525.1|1263449_1264274_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_044756527.1|1264266_1264881_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_094187763.1|1265354_1266152_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044757342.1|1266742_1267291_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_044756529.1|1267290_1269522_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011259961.1|1269502_1269892_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_094187774.1|1271159_1272262_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-44
WP_041183127.1|1272352_1272916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756533.1|1273077_1276119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756534.1|1276143_1278681_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_044756536.1|1278691_1279480_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_044756538.1|1280345_1281425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082322887.1|1281421_1282900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082322889.1|1282959_1285419_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_125168764.1|1285427_1286003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075242365.1|1285977_1286955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756541.1|1286951_1289669_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_044756542.1|1289679_1290468_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011409207.1|1290467_1291802_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011409206.1|1291953_1292562_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_012445672.1|1292948_1293437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259944.1|1293483_1293984_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011259943.1|1293987_1295484_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467612.1|1295625_1296123_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011259942.1|1296270_1296759_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_014502420.1|1296761_1298597_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 10
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	1367650	1421551	5015823	transposase	Ralstonia_phage(12.5%)	36	NA	NA
WP_011258802.1|1367650_1368619_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109182069.1|1368818_1370138_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082323169.1|1370229_1371210_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_044756568.1|1371347_1374188_+	DUF2339 domain-containing protein	NA	NA	NA	NA	NA
WP_044756570.1|1374184_1375543_+	DUF3999 domain-containing protein	NA	NA	NA	NA	NA
WP_027704219.1|1375876_1377052_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_011259886.1|1377048_1377693_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011409145.1|1377949_1379416_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_011259884.1|1380012_1381017_+	fructose-bisphosphate aldolase class I	NA	A0A0K0KVJ8	Prochlorococcus_phage	48.2	3.9e-79
WP_041182225.1|1381218_1381758_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	42.6	9.9e-29
WP_011259882.1|1381953_1382460_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_011259881.1|1382766_1383726_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	49.0	3.8e-79
WP_075240596.1|1383742_1384948_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_044756573.1|1385115_1386099_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756574.1|1386109_1386391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445617.1|1387460_1388657_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_012445616.1|1388978_1389416_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_041182223.1|1389610_1391614_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012445614.1|1391613_1393206_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_044756578.1|1393341_1394067_-	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_011409143.1|1394063_1395785_-	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_011409142.1|1395893_1397741_-	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_011259870.1|1397921_1398830_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_011409141.1|1398829_1400806_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	30.6	5.6e-29
WP_011409140.1|1401240_1402311_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259867.1|1402307_1405433_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.8	7.0e-74
WP_041182725.1|1405784_1408454_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	48.3	1.8e-240
WP_109182116.1|1409333_1410299_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_033013519.1|1410993_1411131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409134.1|1411646_1412558_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_044756585.1|1414419_1414725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182719.1|1415284_1416241_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_080494023.1|1416234_1417869_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012445603.1|1418279_1418702_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_011259859.1|1418762_1419476_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_094187763.1|1420753_1421551_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	1426253	1493328	5015823	protease,transposase,tRNA	Ralstonia_phage(50.0%)	53	NA	NA
WP_011259853.1|1426253_1427012_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011409125.1|1427313_1428108_-	thiazole synthase	NA	NA	NA	NA	NA
WP_011259851.1|1428643_1428844_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_012445601.1|1429034_1430819_+	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_027704094.1|1435284_1435677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409118.1|1435767_1436160_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_094187763.1|1436192_1436991_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|1437862_1438625_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_048488802.1|1438622_1438955_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011409560.1|1439009_1439972_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_115840192.1|1440081_1441047_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258803.1|1441191_1442160_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011409116.1|1442710_1444843_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_094187771.1|1445144_1445908_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115862263.1|1446032_1446998_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_012445397.1|1447523_1448492_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
WP_011407913.1|1448828_1450043_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_115862264.1|1450130_1451450_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259831.1|1451540_1451732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409111.1|1451699_1452713_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259829.1|1452746_1452980_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_044756598.1|1453453_1453747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|1454356_1455120_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181988.1|1455244_1456210_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011409108.1|1456509_1456959_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_012445586.1|1457214_1458072_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011259826.1|1458276_1458888_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011259825.1|1458960_1461603_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_044756603.1|1462116_1462752_+	lipoprotein	NA	NA	NA	NA	NA
WP_011259823.1|1462774_1463803_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_011409104.1|1463799_1464699_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259822.1|1464755_1465172_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_011259821.1|1465183_1466299_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_011259820.1|1466624_1466834_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_044756605.1|1467388_1467859_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_012445578.1|1469274_1472388_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_094187763.1|1472686_1473485_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1473769_1474738_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109182069.1|1474950_1476270_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259816.1|1476348_1477083_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_011409098.1|1477221_1477794_+	Maf-like protein	NA	NA	NA	NA	NA
WP_011259814.1|1477793_1479293_+	ribonuclease G	NA	NA	NA	NA	NA
WP_044756607.1|1479440_1483361_+	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_027704199.1|1483366_1484119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259808.1|1484217_1485663_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_044756609.1|1485919_1486501_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_012445571.1|1486646_1488014_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_069959944.1|1488010_1488331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445570.1|1488303_1488492_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_027704198.1|1488543_1489008_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_044756613.1|1490854_1491730_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_011259802.1|1491731_1491992_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_044756614.1|1492023_1493328_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	1604312	1693793	5015823	transposase,tRNA	Acinetobacter_phage(22.22%)	57	NA	NA
WP_012445467.1|1604312_1605308_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.0	1.0e-31
WP_011259703.1|1605416_1607795_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002811076.1|1607816_1608116_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.7e-12
WP_005995911.1|1608096_1608453_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259702.1|1609061_1609760_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_075242444.1|1609741_1611181_+	GumC family protein	NA	NA	NA	NA	NA
WP_011409041.1|1611424_1612879_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_049756340.1|1612973_1614263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259698.1|1614259_1615351_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_094187837.1|1615367_1616444_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_011259696.1|1616511_1617654_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011259695.1|1617650_1618700_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011409038.1|1618717_1620211_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_011259693.1|1620275_1621472_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011259692.1|1621508_1622303_+	polysaccharide pyruvyl transferase family protein	NA	A0A1V0SAR6	Catovirus	36.0	6.0e-22
WP_011259691.1|1622307_1623102_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_011259690.1|1623136_1623598_+	cupin domain-containing protein	NA	A0A291AU44	Pandoravirus	40.0	6.3e-16
WP_011259689.1|1623707_1624688_+	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_041182468.1|1624805_1625888_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_024743012.1|1628678_1629215_-	lipocalin family protein	NA	A0A2I2L3Z7	Orpheovirus	33.8	4.0e-14
WP_094187768.1|1630728_1631754_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_094187731.1|1631897_1632695_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756654.1|1632682_1633171_-	BrxE family protein	NA	NA	NA	NA	NA
WP_011259682.1|1633202_1633523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409027.1|1633857_1634457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259680.1|1634453_1635377_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_033013473.1|1635456_1635705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259679.1|1636392_1636635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259678.1|1637059_1637569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703322.1|1643763_1644042_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_011259671.1|1644065_1645139_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_027703321.1|1645617_1647234_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_011409015.1|1647438_1648155_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409014.1|1648312_1649251_+	hydroxyproline-2-epimerase	NA	NA	NA	NA	NA
WP_011259667.1|1649250_1650513_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011259666.1|1650509_1650755_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_011259665.1|1650726_1652061_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044756657.1|1652057_1652966_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_044756659.1|1653176_1654793_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_044756660.1|1654789_1655989_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_044756661.1|1656106_1657939_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_044756662.1|1657935_1659801_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_044757373.1|1659863_1661450_+	amino acid permease	NA	NA	NA	NA	NA
WP_044756663.1|1661439_1663779_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409006.1|1665493_1665790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756673.1|1665996_1667568_-	S8/S53 family peptidase	NA	A0A1V0SLL0	Klosneuvirus	37.6	2.3e-70
WP_044756675.1|1668031_1670389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182199.1|1670910_1673727_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	2.4e-49
WP_044756677.1|1673965_1678330_+	carbohydrate-binding protein	NA	NA	NA	NA	NA
WP_033013184.1|1678326_1679913_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_044756679.1|1680234_1682580_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_011408999.1|1683076_1683508_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_115862311.1|1683492_1684086_+	TonB-dependent receptor plug domain-containing protein	NA	A0A0P0I887	Acinetobacter_phage	33.0	2.1e-11
WP_044756683.1|1687408_1689784_+	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
WP_094187766.1|1689898_1690697_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115862265.1|1691536_1692502_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_041182719.1|1692836_1693793_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
>prophage 13
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	1701488	1764852	5015823	plate,transposase	Ralstonia_phage(42.86%)	50	NA	NA
WP_115862266.1|1701488_1702454_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_041182195.1|1702818_1702998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756692.1|1703437_1704400_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011408980.1|1704652_1705636_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011408979.1|1706075_1706333_+	stress-induced protein	NA	NA	NA	NA	NA
WP_011257310.1|1707631_1708867_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_044757376.1|1709623_1710394_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_044756695.1|1710763_1712056_+	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011259625.1|1712039_1713302_-	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408975.1|1713313_1713745_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408974.1|1713803_1714169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408973.1|1714268_1715030_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_012445389.1|1715251_1715899_+	response regulator	NA	NA	NA	NA	NA
WP_094187765.1|1716002_1716765_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756696.1|1717291_1720993_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_011259619.1|1721403_1722390_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_041182194.1|1722422_1724213_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_011408968.1|1724561_1724822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408967.1|1724848_1725082_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_011259617.1|1725097_1725520_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408966.1|1725516_1725873_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_011408965.1|1725961_1726561_+	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_041182192.1|1726574_1728398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756697.1|1729055_1731890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465604.1|1731920_1732664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756990.1|1734568_1735525_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.6	6.2e-42
WP_044749647.1|1735980_1737357_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_144408321.1|1737349_1737586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409560.1|1737599_1738562_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_042465640.1|1738718_1739465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756701.1|1739482_1741474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|1741526_1742483_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756703.1|1742502_1743738_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1743886_1744855_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109182069.1|1745054_1746374_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_024711387.1|1747690_1748197_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_044756705.1|1748189_1749704_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011259605.1|1749803_1750307_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011259604.1|1750342_1751176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259603.1|1751163_1751667_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012444494.1|1751670_1753548_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_044756708.1|1753511_1754522_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_044756710.1|1754554_1757260_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	1.5e-80
WP_027703476.1|1757448_1757946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168760.1|1758011_1758506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408952.1|1758894_1759353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444497.1|1759617_1761555_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
WP_011408951.1|1761563_1762103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756713.1|1762099_1763518_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_044756715.1|1763514_1764852_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 14
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	1874550	1886325	5015823	tRNA	Pseudomonas_phage(22.22%)	12	NA	NA
WP_011408886.1|1874550_1876227_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
WP_011408885.1|1876315_1876957_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408884.1|1877129_1878164_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_012444556.1|1878466_1878955_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_044756742.1|1879056_1881705_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_003481884.1|1881844_1882057_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_103057523.1|1882659_1883187_+	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	57.4	1.2e-34
WP_012444559.1|1883574_1883874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756743.1|1884059_1884755_+	DNA helicase	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_011259505.1|1884759_1885509_+	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011259504.1|1885752_1885983_+	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259503.1|1886025_1886325_+	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
>prophage 15
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	1911415	1969965	5015823	tRNA,transposase	Staphylococcus_prophage(16.67%)	45	NA	NA
WP_044756746.1|1911415_1912390_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.2	6.0e-32
WP_069960338.1|1912458_1912824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259476.1|1913716_1914283_-	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_011259475.1|1914404_1915175_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	3.4e-14
WP_011408867.1|1915313_1916210_-	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	32.7	8.5e-33
WP_011259473.1|1916280_1916670_-	VOC family protein	NA	NA	NA	NA	NA
WP_011259472.1|1916666_1917464_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408865.1|1917578_1917827_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_011408864.1|1917823_1919683_+	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259469.1|1919684_1919939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408863.1|1919998_1920223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259467.1|1920250_1920559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259466.1|1920792_1921995_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_011259465.1|1921991_1922711_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|1922763_1923526_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756747.1|1923936_1924653_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_011259464.1|1924892_1926017_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.2	7.8e-44
WP_012444585.1|1926016_1926460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259463.1|1926468_1929711_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_011408858.1|1929707_1930184_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_011259461.1|1930200_1931121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408857.1|1931117_1932857_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	27.8	1.3e-42
WP_109182069.1|1933403_1934723_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|1936386_1937343_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011408855.1|1937637_1938015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259457.1|1938175_1938877_-|transposase	DDE transposase	transposase	A9YX10	Burkholderia_phage	32.9	1.9e-16
WP_044756748.1|1941684_1942632_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014503214.1|1942885_1944010_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.7	9.4e-05
WP_044756749.1|1944214_1945732_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.9	2.3e-86
WP_011408849.1|1945873_1947010_+	two-component system response regulator	NA	NA	NA	NA	NA
WP_011259451.1|1947374_1949552_+	response regulator	NA	A0A1V0SGX0	Hokovirus	32.8	3.0e-47
WP_011408848.1|1949563_1950433_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259449.1|1950609_1952292_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	7.1e-33
WP_044756750.1|1952941_1955710_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_003486316.1|1955857_1956106_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259444.1|1956102_1956513_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_012444596.1|1956578_1959170_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_011259442.1|1959523_1960339_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011408846.1|1960994_1963238_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011259440.1|1963346_1964423_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011259439.1|1964419_1965016_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_011408845.1|1965012_1965879_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_044756751.1|1966133_1968518_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	7.8e-09
WP_044756752.1|1968602_1968986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187758.1|1969166_1969965_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	1986780	2061253	5015823	transposase	uncultured_Caudovirales_phage(16.67%)	47	NA	NA
WP_115840174.1|1986780_1987746_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187736.1|1987870_1988633_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756756.1|1989058_1991401_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	1.2e-09
WP_011408833.1|1991414_1992176_-	transporter	NA	NA	NA	NA	NA
WP_103073514.1|1992491_1993178_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.2	2.8e-12
WP_011408830.1|1994860_1995115_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011408829.1|1995282_1997292_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_002806565.1|1997325_1997691_-	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011259421.1|1997687_1997996_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_042465006.1|1998096_1999119_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259419.1|1999115_1999898_-	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_011408827.1|1999899_2000874_-	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_011259417.1|2000880_2001621_-	flagellar motor protein	NA	NA	NA	NA	NA
WP_027703781.1|2001709_2002063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408826.1|2002059_2002551_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011408825.1|2002597_2002990_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_044756757.1|2003141_2003849_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	8.4e-52
WP_125168759.1|2003924_2004272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756758.1|2004273_2006079_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042465003.1|2006333_2006786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465618.1|2007775_2010877_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_082341205.1|2011035_2012034_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	41.4	8.5e-42
WP_011407913.1|2011996_2013211_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_041182545.1|2013392_2014349_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756759.1|2014788_2015232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070344089.1|2015228_2015645_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_115862267.1|2016749_2018069_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|2018296_2018611_-	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_157724569.1|2018543_2019497_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182637.1|2019657_2020047_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_012444637.1|2027701_2028631_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_012444638.1|2028627_2031465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182640.1|2031489_2032224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|2034303_2035260_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_115862268.1|2035505_2036894_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2037093_2038062_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_012444645.1|2038728_2040006_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_011259402.1|2040183_2041926_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_011259401.1|2042084_2043041_-	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_041182172.1|2043037_2045554_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_011408798.1|2045714_2046710_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011257851.1|2047416_2048382_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012444648.1|2049357_2052528_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_012444649.1|2052540_2053845_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027703873.1|2053859_2054519_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756763.1|2054796_2059821_+	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_044756764.1|2060269_2061253_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.2	1.6e-96
>prophage 17
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	2087995	2150430	5015823	protease,tRNA,transposase	Bacillus_virus(18.18%)	49	NA	NA
WP_115801894.1|2087995_2089315_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408779.1|2089821_2091024_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_011408778.1|2091020_2092607_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408777.1|2092611_2094105_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_075240820.1|2094250_2095498_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011259369.1|2095817_2096648_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_041182453.1|2096803_2097214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013286.1|2097468_2098833_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011259367.1|2098984_2099986_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_011259366.1|2100001_2101282_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_012444677.1|2101278_2102157_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011408769.1|2102251_2102770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703624.1|2102769_2103255_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011259362.1|2103309_2103972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408767.1|2104383_2105370_-	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_044756769.1|2105793_2107248_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011259357.1|2109183_2110170_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_011259356.1|2110699_2111344_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011259355.1|2111343_2112603_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_027703625.1|2112595_2113354_+	cytochrome c1	NA	NA	NA	NA	NA
WP_011259353.1|2113746_2114382_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_011259352.1|2114460_2114901_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
WP_011408764.1|2114933_2115260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465594.1|2115470_2115815_-	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_109181970.1|2120379_2121345_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2121925_2123110_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_012445118.1|2123513_2124482_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.5e-99
WP_041182719.1|2124883_2125840_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_080256628.1|2126100_2126289_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408759.1|2126773_2127052_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_027703932.1|2127039_2127330_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_015463309.1|2127931_2128111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259345.1|2128974_2129376_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011408756.1|2130468_2131560_-	ribonuclease D	NA	NA	NA	NA	NA
WP_041182165.1|2131831_2133667_+	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
WP_094187754.1|2133983_2134730_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259340.1|2134947_2136210_+	virulence factor	NA	NA	NA	NA	NA
WP_011408753.1|2136505_2137843_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.3e-37
WP_011408752.1|2137988_2139056_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011259337.1|2139080_2140568_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_011259336.1|2140564_2141065_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_011408751.1|2141117_2142851_+	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_011259334.1|2142988_2144866_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_041182163.1|2144865_2145813_+	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011408749.1|2145846_2146818_+	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_011259331.1|2146991_2147567_-	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408747.1|2147726_2148467_-	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_044756773.1|2148554_2149454_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011259328.1|2149551_2150430_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 18
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	2182649	2223476	5015823	tRNA,transposase	Streptococcus_phage(25.0%)	35	NA	NA
WP_094187753.1|2182649_2183448_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|2184435_2185404_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_115862269.1|2185540_2186860_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444728.1|2187083_2187572_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_011259294.1|2187943_2188207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756777.1|2189078_2189918_-	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.4e-13
WP_011259290.1|2189917_2191267_-	dihydroorotase	NA	NA	NA	NA	NA
WP_033013281.1|2191263_2191551_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075239108.1|2191635_2192664_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_011259288.1|2192806_2193868_+	S41 family peptidase	NA	NA	NA	NA	NA
WP_011259287.1|2193935_2195186_-	MFS transporter	NA	NA	NA	NA	NA
WP_011408724.1|2195182_2195620_-	SufE family protein	NA	NA	NA	NA	NA
WP_012444736.1|2196117_2197542_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_027703614.1|2197718_2198213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259283.1|2198525_2199551_+	N-acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_011408723.1|2199622_2200864_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_011408722.1|2201105_2201558_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259280.1|2201563_2202664_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_044756778.1|2202703_2204047_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_044756779.1|2204659_2205610_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_011408717.1|2205733_2207029_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_011408716.1|2207028_2207394_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011259275.1|2207393_2207654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756780.1|2207667_2208822_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.2	1.0e-46
WP_011408714.1|2209091_2210336_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
WP_044756781.1|2210703_2212617_+	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_044756783.1|2212597_2213863_-	MFS transporter	NA	NA	NA	NA	NA
WP_011259269.1|2214083_2214194_-	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_011259267.1|2214572_2214836_-	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_044756785.1|2214884_2215985_-	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_075239845.1|2216136_2217873_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	8.2e-16
WP_011408708.1|2217869_2219555_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
WP_011408707.1|2219723_2221022_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_115801893.1|2221028_2221994_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_044749647.1|2222099_2223476_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
>prophage 19
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	2332080	2377897	5015823	protease,transposase,tRNA	uncultured_Mediterranean_phage(11.11%)	33	NA	NA
WP_011408666.1|2332080_2333217_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_011408665.1|2333213_2333672_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_005914463.1|2333922_2334243_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_011408664.1|2334386_2336669_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.5	4.3e-174
WP_002813418.1|2336949_2337168_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_042465566.1|2337248_2338001_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_011408662.1|2339428_2340550_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259181.1|2340607_2341576_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011259180.1|2341859_2344220_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_011259179.1|2344382_2346311_+	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_027703232.1|2346375_2347047_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011259177.1|2347159_2351326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259176.1|2351562_2352939_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
WP_011259175.1|2352970_2353297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|2353293_2353701_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011408659.1|2353732_2354083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259173.1|2354079_2355411_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
WP_011259172.1|2355731_2356937_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011259171.1|2357094_2359467_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259170.1|2359491_2360124_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002812972.1|2360343_2360769_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259169.1|2360787_2361993_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_011408658.1|2362003_2362792_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011259167.1|2362788_2363649_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044756799.1|2363719_2364358_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011408657.1|2364357_2365575_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259164.1|2365585_2366983_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011259163.1|2367297_2368518_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_044756800.1|2368714_2369773_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_162828830.1|2370411_2370666_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_115862270.1|2374040_2375360_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_115862271.1|2375478_2376954_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	1.6e-76
WP_109181928.1|2376931_2377897_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	2477878	2545237	5015823	tRNA,transposase	Xanthomonas_phage(57.14%)	49	NA	NA
WP_011258918.1|2477878_2478937_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258919.1|2478988_2479555_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011408473.1|2479551_2480778_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011408474.1|2480898_2482164_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_011408475.1|2482144_2482876_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_094187744.1|2483016_2484180_-	MFS transporter	NA	NA	NA	NA	NA
WP_082322979.1|2484342_2485299_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.1	3.7e-42
WP_012444969.1|2485858_2485993_-	aspartate racemase	NA	NA	NA	NA	NA
WP_012444967.1|2486183_2487095_-	DMT family transporter	NA	NA	NA	NA	NA
WP_011408479.1|2487088_2488141_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_011258927.1|2488137_2489193_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_027703856.1|2489198_2489972_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408481.1|2489968_2490253_-	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_044756815.1|2490841_2492374_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011408482.1|2493676_2496184_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_011258933.1|2496180_2497149_+	homoserine kinase	NA	NA	NA	NA	NA
WP_024710669.1|2500095_2500410_-	EthD family reductase	NA	NA	NA	NA	NA
WP_011258935.1|2500571_2501876_+	threonine synthase	NA	NA	NA	NA	NA
WP_041182115.1|2501978_2502722_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_012444952.1|2503986_2505399_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
WP_094187743.1|2505904_2506703_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258940.1|2507016_2507343_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258941.1|2507352_2508267_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258942.1|2508263_2509559_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_027703958.1|2509555_2510647_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011258944.1|2510643_2511771_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_011258945.1|2511767_2512370_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011258946.1|2512366_2513101_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011258947.1|2513094_2513871_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011258948.1|2513860_2514481_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_044756818.1|2515066_2518921_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408491.1|2519144_2519444_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_012444931.1|2519447_2519642_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
WP_144408324.1|2519910_2523405_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_113022320.1|2526738_2527665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057499.1|2528201_2528954_-	Type II secretory pathway, component ExeA	NA	NA	NA	NA	NA
WP_033013458.1|2529231_2531097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444939.1|2531086_2531812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|2531918_2532875_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_094187742.1|2532875_2533620_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_125168751.1|2533654_2533966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408511.1|2534087_2534270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075239627.1|2534893_2534992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756821.1|2535033_2535813_+	pectate lyase	NA	NA	NA	NA	NA
WP_044756822.1|2536343_2539640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444931.1|2539908_2540103_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
WP_011408491.1|2540106_2540406_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_044756823.1|2540629_2544385_+	avirulence protein	NA	NA	NA	NA	NA
WP_094187715.1|2544474_2545237_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	2550429	2617202	5015823	transposase	uncultured_Caudovirales_phage(25.0%)	55	NA	NA
WP_012444927.1|2550429_2550606_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011408520.1|2550602_2551274_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_011409560.1|2552452_2553415_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|2554227_2555184_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756826.1|2556235_2557135_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.4	9.7e-37
WP_012444921.1|2557301_2557808_+	glyoxalase	NA	NA	NA	NA	NA
WP_011258968.1|2558282_2558915_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011258969.1|2558914_2560771_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_012444920.1|2560767_2562186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258971.1|2562209_2562674_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_011258972.1|2562670_2563450_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258973.1|2563741_2564782_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258974.1|2564778_2566548_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258975.1|2566544_2567009_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011408526.1|2567012_2567675_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011408527.1|2567703_2570112_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_115862272.1|2570365_2571331_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011258980.1|2572724_2573459_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_010378794.1|2573451_2574693_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014503500.1|2574716_2575169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756828.1|2575119_2575368_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_011408532.1|2575478_2576261_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_012444910.1|2576277_2576487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444909.1|2576490_2578281_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_011258984.1|2578315_2578702_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_011258985.1|2578698_2579094_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_012444907.1|2579153_2579420_-	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_011408533.1|2579363_2580236_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_011258986.1|2580364_2581462_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408534.1|2581893_2583324_+	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258988.1|2583320_2584328_+	glucokinase	NA	NA	NA	NA	NA
WP_011258989.1|2584324_2585044_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011258990.1|2585146_2587063_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011408535.1|2587118_2587778_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_044756829.1|2587998_2589375_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	1.3e-77
WP_094187715.1|2589408_2590172_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703995.1|2590214_2590418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444899.1|2590989_2591166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258994.1|2591433_2591814_+	response regulator	NA	NA	NA	NA	NA
WP_044756830.1|2592028_2595424_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_012444894.1|2596418_2599379_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_026144156.1|2600374_2600731_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_044756831.1|2600994_2602299_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	58.9	2.0e-128
WP_012444891.1|2602317_2603043_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	3.1e-86
WP_012444890.1|2603039_2603453_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	68.2	8.6e-41
WP_012444889.1|2603463_2603994_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	42.6	1.8e-27
WP_027703900.1|2603990_2604338_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027703901.1|2605548_2607129_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012444885.1|2607412_2608432_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_044756832.1|2608482_2609958_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	65.7	4.3e-98
WP_044756833.1|2610208_2611423_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_012444882.1|2611504_2613733_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_080256634.1|2613729_2614854_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	32.3	2.6e-15
WP_128415445.1|2615325_2615832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115862273.1|2615882_2617202_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	2735818	2876388	5015823	transposase,tRNA	uncultured_Mediterranean_phage(26.09%)	101	NA	NA
WP_011259079.1|2735818_2737213_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	4.5e-81
WP_011259080.1|2737214_2737472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408599.1|2737468_2737774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259081.1|2737770_2738097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408603.1|2738817_2739480_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_024744799.1|2739568_2740099_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_011408604.1|2740162_2740759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162531723.1|2740884_2741097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259087.1|2742299_2743571_+	kynureninase	NA	NA	NA	NA	NA
WP_011259088.1|2743742_2745110_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_012444800.1|2745413_2746859_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_044756855.1|2746855_2747542_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_011259091.1|2747514_2748534_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011259092.1|2748575_2749136_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_011259093.1|2749156_2750113_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_011408609.1|2750280_2751057_-	NAD kinase	NA	NA	NA	NA	NA
WP_011408610.1|2751540_2753676_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_027703372.1|2753672_2753864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259098.1|2755637_2756144_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259099.1|2756184_2756712_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408612.1|2756708_2757200_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_012444795.1|2757223_2757799_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011259101.1|2757875_2758829_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_012444794.1|2758917_2759790_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_027703371.1|2759786_2760626_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_162828804.1|2760506_2760746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408617.1|2760738_2761437_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_044756856.1|2761600_2762383_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408619.1|2762391_2762772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259107.1|2762768_2763479_+	endonuclease III	NA	NA	NA	NA	NA
WP_012444789.1|2764790_2765339_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_094187715.1|2765465_2766229_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444787.1|2767062_2768313_+	porin	NA	NA	NA	NA	NA
WP_012444786.1|2768501_2769521_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.7	2.1e-48
WP_012444785.1|2769706_2770798_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_011259112.1|2770910_2771885_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_011259113.1|2771884_2772754_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259114.1|2772776_2773607_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011408630.1|2773735_2774446_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_012444782.1|2774578_2774974_+	RcnB family protein	NA	NA	NA	NA	NA
WP_011259117.1|2775257_2775893_+	ribonuclease T	NA	NA	NA	NA	NA
WP_115862274.1|2775963_2777283_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044756859.1|2777519_2778581_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082341214.1|2778631_2779816_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_115862275.1|2780065_2781454_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408636.1|2784071_2784434_+	recombinase	NA	NA	NA	NA	NA
WP_011259122.1|2784514_2785483_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	30.3	1.4e-28
WP_011259123.1|2785577_2787422_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_011259124.1|2787618_2787972_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_011259125.1|2788103_2789249_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_027703908.1|2789318_2790389_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259127.1|2790554_2790986_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259128.1|2791109_2792606_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011408639.1|2792565_2792880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259129.1|2792950_2793658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258529.1|2795825_2796794_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_044749647.1|2797397_2798774_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_041182545.1|2798933_2799890_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756862.1|2800503_2802846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|2802870_2803599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756864.1|2803627_2806462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259405.1|2806458_2807388_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_044756866.1|2807396_2810159_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.6	3.3e-43
WP_082341208.1|2811724_2814316_-	avirulence protein	NA	NA	NA	NA	NA
WP_041182637.1|2814355_2814745_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_157724569.1|2814905_2815859_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|2815791_2816106_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_082356336.1|2817620_2818577_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.7	1.4e-41
WP_011408645.1|2820025_2821147_-	phytase	NA	NA	NA	NA	NA
WP_041182147.1|2823413_2823881_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011259142.1|2824031_2824664_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_094187735.1|2825060_2825823_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259143.1|2826103_2827135_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408648.1|2827141_2828935_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_012444765.1|2828931_2829216_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_027703974.1|2829447_2829945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259147.1|2829991_2830498_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_011259148.1|2830494_2831115_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011408651.1|2831355_2833260_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_115862276.1|2834504_2835824_+|transposase	IS701-like element ISXo15 family transposase	transposase	NA	NA	NA	NA
WP_144408326.1|2836028_2839427_+	avirulence protein	NA	NA	NA	NA	NA
WP_082356333.1|2842619_2846222_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_041182100.1|2846490_2846685_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_044756872.1|2846688_2846988_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	90.2	2.5e-45
WP_044756873.1|2847211_2850517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296780.1|2850929_2851196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258825.1|2851886_2852900_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011258824.1|2852999_2853584_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_011259046.1|2853647_2854616_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_011258822.1|2855169_2856519_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_012445101.1|2856630_2857290_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_027704061.1|2857650_2858118_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_094187738.1|2858304_2859406_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.6e-36
WP_044756878.1|2863192_2864407_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.7	6.2e-55
WP_044756879.1|2864753_2865953_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_011258799.1|2866101_2866284_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|2868297_2869254_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_109181957.1|2871449_2872415_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187737.1|2872415_2873169_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445118.1|2873999_2874968_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.5e-99
WP_011258442.1|2875152_2876388_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	2907060	2983401	5015823	transposase,coat	Streptococcus_phage(15.38%)	56	NA	NA
WP_041182545.1|2907060_2908017_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_094187736.1|2908681_2909445_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258759.1|2912468_2913836_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_011258758.1|2914082_2914583_+	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_011258757.1|2914862_2915153_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_012445147.1|2915464_2916961_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011258755.1|2916957_2917890_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011258754.1|2918070_2920899_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_044756893.1|2920941_2922144_+	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_011258752.1|2922385_2923822_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
WP_044756895.1|2924020_2924614_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	2.1e-11
WP_041183174.1|2924872_2925475_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	1.4e-15
WP_011408359.1|2925471_2927241_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
WP_044756896.1|2927579_2928185_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756897.1|2928314_2929241_+	TolC family protein	NA	NA	NA	NA	NA
WP_115862277.1|2929575_2930895_+|transposase	IS701-like element ISXo15 family transposase	transposase	NA	NA	NA	NA
WP_011408356.1|2931264_2932386_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_011408355.1|2932382_2933291_-	pyridoxal kinase	NA	NA	NA	NA	NA
WP_011258743.1|2933819_2934950_-	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	30.0	1.4e-24
WP_011258742.1|2935109_2937035_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.0	7.6e-148
WP_011258741.1|2937176_2937695_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_012445153.1|2937795_2938827_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_012445154.1|2938964_2940629_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_011408351.1|2941071_2941482_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_011258737.1|2941586_2941982_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_011258736.1|2942328_2942604_-	RnfH family protein	NA	NA	NA	NA	NA
WP_011258735.1|2942617_2943049_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_011258734.1|2943109_2943613_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.6	3.4e-23
WP_011258733.1|2944325_2944802_+	LEA type 2 family protein	NA	NA	NA	NA	NA
WP_044756898.1|2944839_2946633_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011258731.1|2946898_2947588_+	HNH endonuclease	NA	F5B475	Synechococcus_phage	40.2	5.4e-11
WP_011258730.1|2947985_2949902_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_011258729.1|2949938_2950931_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_011258728.1|2951173_2951437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115862278.1|2952537_2953503_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011258724.1|2954948_2955197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|2955391_2956154_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703878.1|2956151_2956886_-	serine hydrolase	NA	NA	NA	NA	NA
WP_011258722.1|2956936_2958517_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_027703877.1|2958523_2959717_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012445166.1|2959727_2961245_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_012445167.1|2961241_2961682_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011258718.1|2961803_2962655_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011258717.1|2962715_2964959_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.7	1.1e-81
WP_033013399.1|2965414_2965951_-	bacterioferritin	NA	NA	NA	NA	NA
WP_012445169.1|2966046_2968464_+	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_011258714.1|2969843_2971970_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_027703366.1|2972400_2973453_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_011258712.1|2973521_2975216_-	asparagine synthase B	NA	E5ERH5	Ostreococcus_lucimarinus_virus	38.6	2.5e-86
WP_044756901.1|2975510_2976641_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_011408335.1|2976645_2977146_-	GNAT family N-acetyltransferase	NA	A0A1X9I687	Streptococcus_phage	41.7	2.3e-27
WP_011408334.1|2977142_2977499_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_012445174.1|2977961_2979158_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_011408332.1|2979174_2981784_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_011258707.1|2981780_2982557_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_033003618.1|2982876_2983401_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 24
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	2986544	3045852	5015823	protease,tRNA,transposase,coat	Acidithiobacillus_phage(40.0%)	43	NA	NA
WP_011258703.1|2986544_2987579_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_044756904.1|2987625_2987958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408326.1|2987960_2988686_+	molecular chaperone	NA	NA	NA	NA	NA
WP_044756905.1|2989061_2989865_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011258700.1|2990034_2990913_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_011408325.1|2991040_2991418_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258698.1|2991474_2992197_+	UMP kinase	NA	NA	NA	NA	NA
WP_011258697.1|2992377_2992935_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_027703358.1|2992952_2993714_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258695.1|2993710_2994538_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258694.1|2994540_2995731_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_044756906.1|2995757_2997104_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_012445188.1|2997187_2999554_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_044756907.1|2999922_3000936_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|3000932_3001394_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_011258689.1|3001417_3002209_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_027703356.1|3002247_3003504_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011408322.1|3003500_3004241_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
WP_011408321.1|3004698_3008289_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
WP_011258685.1|3008464_3009424_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_044756908.1|3010263_3012444_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044756909.1|3012443_3013181_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
WP_044756910.1|3013177_3014590_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_044749647.1|3016605_3017982_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_044749647.1|3018124_3019501_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_012445196.1|3019729_3019996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757443.1|3020073_3020520_-	membrane protein	NA	NA	NA	NA	NA
WP_011408316.1|3020593_3021196_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012445197.1|3021336_3022680_+	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_012445198.1|3023152_3023716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256646.1|3027417_3027588_+	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_011408313.1|3027601_3028018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756912.1|3028816_3030292_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.8	3.7e-102
WP_011408311.1|3030334_3030730_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_044756913.1|3030769_3032146_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	6.6e-77
WP_011258670.1|3033781_3034456_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_011258669.1|3034460_3035237_+	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258668.1|3036509_3038447_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258667.1|3038628_3039606_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_044756914.1|3039602_3041000_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_044756915.1|3041271_3042330_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012445211.1|3043093_3043543_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_011258663.1|3043767_3045852_+|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 25
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	3076928	3122381	5015823	protease,transposase	Tupanvirus(15.38%)	41	NA	NA
WP_094187731.1|3076928_3077727_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115862279.1|3077843_3079163_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259046.1|3079375_3080344_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_011258631.1|3080600_3080867_-	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_011258630.1|3081041_3081296_+	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258629.1|3081456_3081630_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_012445235.1|3082031_3082559_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258627.1|3083027_3084128_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_011258626.1|3084188_3087017_-|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011408270.1|3087172_3088348_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011408269.1|3088470_3088815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258624.1|3089044_3089371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408268.1|3089479_3091189_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	2.1e-16
WP_011408267.1|3091286_3091877_+	cell shape determination protein CcmA	NA	NA	NA	NA	NA
WP_011258621.1|3091873_3092239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445237.1|3092575_3093598_+	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_044756920.1|3093594_3093828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756921.1|3093824_3095429_+	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	36.6	6.4e-15
WP_044756922.1|3095425_3097927_+	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_012445240.1|3097916_3098561_+	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_003488188.1|3100071_3100278_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_044756923.1|3100364_3101117_-	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_011408257.1|3101202_3101757_-	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_044757445.1|3101756_3102761_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_012445245.1|3102877_3104455_-	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	25.6	2.2e-44
WP_012445246.1|3104635_3105670_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_041182416.1|3105686_3106370_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_109182069.1|3106553_3107873_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|3107973_3108930_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756425.1|3109024_3110401_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.2	1.9e-79
WP_044756924.1|3110629_3111865_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258607.1|3111960_3112458_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_027703339.1|3112632_3113967_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	26.8	1.7e-29
WP_011408250.1|3114125_3114848_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011258604.1|3114996_3115719_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011258603.1|3115942_3116842_-	GTPase Era	NA	NA	NA	NA	NA
WP_012445253.1|3116838_3117519_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.4	9.9e-18
WP_011258601.1|3117508_3117886_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011258600.1|3117916_3118717_-	signal peptidase I	NA	NA	NA	NA	NA
WP_041182078.1|3118823_3120614_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.5	3.5e-22
WP_011408249.1|3120794_3122381_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	6.5e-28
>prophage 26
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	3215903	3375920	5015823	tRNA,transposase	Staphylococcus_prophage(19.23%)	102	NA	NA
WP_011407237.1|3215903_3216860_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_059317522.1|3217011_3217395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756939.1|3218300_3219545_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012445311.1|3219541_3219820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075242902.1|3219897_3220299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408199.1|3220581_3220953_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_041183382.1|3220949_3221216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|3221517_3222474_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011258527.1|3222840_3224304_+	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_011408197.1|3224439_3226782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408196.1|3227061_3228903_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_027703763.1|3228952_3231484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408193.1|3232101_3232302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445314.1|3232359_3232680_-	RebB family R body protein	NA	NA	NA	NA	NA
WP_011258521.1|3233059_3234163_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_080493519.1|3234305_3236264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703765.1|3236373_3237105_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_027703766.1|3237101_3238166_-	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_115862280.1|3242814_3244134_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044757453.1|3244266_3245349_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_044756940.1|3245360_3245984_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_044756941.1|3246234_3246711_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011408184.1|3246744_3247947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756942.1|3247954_3254881_-	response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
WP_011258510.1|3254994_3257031_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
WP_003482487.1|3257070_3257601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258508.1|3257600_3257963_-	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
WP_005913706.1|3257980_3258382_-	response regulator	NA	NA	NA	NA	NA
WP_044756943.1|3258631_3259582_+	glutathione synthase	NA	NA	NA	NA	NA
WP_011258506.1|3259578_3260454_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_044757457.1|3260748_3261699_-	ADP-ribosylglycohydrolase	NA	A0A1S6UB21	Serratia_phage	48.8	1.4e-65
WP_012445327.1|3261661_3262381_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_044756945.1|3262394_3264422_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	2.7e-95
WP_044756946.1|3264623_3265148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756947.1|3265160_3267605_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_044756949.1|3267846_3269949_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_044757459.1|3270281_3271724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756951.1|3272013_3274200_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002812057.1|3274489_3274570_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_044756952.1|3274653_3275553_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_011408174.1|3275549_3276302_+	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_012445334.1|3276298_3276577_+	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_012445335.1|3276573_3277692_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_011408171.1|3277754_3278267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703396.1|3278695_3280210_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_044756953.1|3281651_3284306_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044756954.1|3284526_3288648_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
WP_011408166.1|3288749_3289295_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_011258487.1|3289851_3291648_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.5	1.5e-81
WP_011408165.1|3291786_3292284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703393.1|3292362_3292767_+	response regulator	NA	NA	NA	NA	NA
WP_008578058.1|3293397_3294072_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_044756955.1|3294450_3295827_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	1.4e-58
WP_094187715.1|3295893_3296656_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012443979.1|3296707_3297943_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011408117.1|3298062_3298746_-	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	39.5	1.5e-37
WP_011258440.1|3298788_3299607_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_011408116.1|3299613_3300132_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_041182054.1|3300189_3301509_-	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_044756956.1|3301768_3302809_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_011408114.1|3302798_3303248_-	protein TolR	NA	NA	NA	NA	NA
WP_012445351.1|3303404_3304184_-	protein TolQ	NA	NA	NA	NA	NA
WP_011258434.1|3304195_3304654_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_010363979.1|3304706_3305744_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	2.7e-06
WP_011258433.1|3305872_3307780_-	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.1	3.4e-79
WP_011258432.1|3307979_3308564_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_011258431.1|3308721_3309246_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_011258430.1|3309360_3310089_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_044756957.1|3310178_3310856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258428.1|3310955_3311483_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408113.1|3311994_3313761_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011258426.1|3313918_3314695_+	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_012445361.1|3315192_3315486_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_044756958.1|3315926_3317165_+	MFS transporter	NA	NA	NA	NA	NA
WP_044756961.1|3319748_3321305_-	membrane protein	NA	NA	NA	NA	NA
WP_011258418.1|3322693_3324085_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_041182545.1|3325455_3326412_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011258414.1|3328047_3330669_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	1.4e-30
WP_094187728.1|3332548_3333347_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_052658715.1|3334390_3336214_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_041182545.1|3336484_3337441_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756968.1|3337516_3338485_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.1e-99
WP_082322985.1|3338399_3339098_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.8	8.6e-25
WP_011258802.1|3339149_3340118_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_082322930.1|3340246_3340609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182069.1|3340675_3341995_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3342194_3343163_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115862281.1|3343299_3344619_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|3347238_3348195_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_157724567.1|3353391_3353664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182622.1|3355243_3355819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756972.1|3355822_3360517_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	48.6	1.5e-24
WP_044756973.1|3360660_3362280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444470.1|3362303_3364550_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.3	4.4e-54
WP_012444469.1|3364774_3366655_-	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_010365831.1|3366821_3367157_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_033013172.1|3367156_3367783_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_011408097.1|3367785_3369786_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011258402.1|3369785_3370721_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_011258401.1|3371234_3372185_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_011408096.1|3372273_3372774_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_011258399.1|3373088_3375920_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
>prophage 27
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	3426552	3439000	5015823	transposase	uncultured_marine_virus(33.33%)	9	NA	NA
WP_115862282.1|3426552_3427872_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082322932.1|3428432_3428603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756487.1|3428723_3429938_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.7	8.2e-55
WP_011257031.1|3430109_3431078_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_128415435.1|3431129_3431618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756978.1|3431617_3434380_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_041182545.1|3434403_3435360_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_115862283.1|3436875_3438195_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3438237_3439000_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	3479836	3520133	5015823	tRNA,transposase	Staphylococcus_prophage(18.18%)	35	NA	NA
WP_059317479.1|3479836_3480808_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.5	1.2e-32
WP_094187725.1|3480859_3481270_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011258309.1|3481368_3482094_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_012444398.1|3482510_3483929_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	3.3e-47
WP_011408037.1|3484031_3485462_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_011258306.1|3485683_3486238_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011258305.1|3486454_3488395_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_027704133.1|3488570_3489209_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_027704134.1|3491442_3492618_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011408033.1|3492763_3493555_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258299.1|3493700_3493916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258298.1|3493915_3494683_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011258297.1|3494744_3495575_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_027704135.1|3495647_3496076_+	cytochrome c	NA	NA	NA	NA	NA
WP_011408030.1|3496207_3496687_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|3496937_3497153_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_011258293.1|3497380_3497866_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|3499427_3499631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408025.1|3500408_3500867_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408024.1|3501272_3501779_-	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_011258289.1|3501792_3503196_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_075242217.1|3504381_3505113_-	nitrilase	NA	NA	NA	NA	NA
WP_044756990.1|3505186_3506143_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.6	6.2e-42
WP_011408020.1|3506616_3507429_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_011258802.1|3507491_3508460_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115862284.1|3508659_3509979_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_161795362.1|3511300_3511426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408018.1|3511461_3511845_-	membrane protein	NA	NA	NA	NA	NA
WP_011258280.1|3512360_3513173_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_044756991.1|3513233_3514292_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	7.6e-73
WP_044756992.1|3514286_3515456_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	8.3e-97
WP_011408014.1|3515632_3516016_-	membrane protein	NA	NA	NA	NA	NA
WP_012444370.1|3516750_3517563_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_115862285.1|3517633_3518953_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044756993.1|3519074_3520133_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	3574716	3643289	5015823	transposase	Bacillus_phage(12.5%)	53	NA	NA
WP_115862286.1|3574716_3575682_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044757015.1|3578191_3579676_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.9	1.1e-13
WP_011258239.1|3579958_3580495_-	single-stranded DNA-binding protein	NA	A0A1B1W281	Salmonella_phage	58.5	3.6e-31
WP_044757016.1|3580770_3581769_+	octaprenyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_044757017.1|3581953_3582748_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011258236.1|3583064_3584471_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_011258235.1|3584451_3585807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258234.1|3585803_3586262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757019.1|3586245_3588855_-	bifunctional aspartate kinase/diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_012445697.1|3589954_3590836_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_027703692.1|3591934_3592534_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258228.1|3592686_3593121_-	OsmC family protein	NA	NA	NA	NA	NA
WP_011258227.1|3593623_3594571_-	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_011407969.1|3594584_3595052_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_011258225.1|3595044_3595611_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_011407966.1|3596875_3597448_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_041182545.1|3597515_3598472_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044757021.1|3599090_3600221_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_011258220.1|3600334_3601372_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_011407962.1|3601735_3602428_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011407961.1|3602471_3603332_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_011258216.1|3605366_3605792_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_044757022.1|3605897_3606539_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_027703896.1|3606596_3606938_+	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_011258213.1|3606995_3607538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258212.1|3607593_3608190_+	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_099051294.1|3608307_3608688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407955.1|3608794_3609013_-	peptidase	NA	NA	NA	NA	NA
WP_003487757.1|3609117_3609585_-	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_011407954.1|3609756_3610215_+	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_044757023.1|3610230_3611688_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_011407952.1|3611945_3612710_+	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	28.9	1.6e-11
WP_011258208.1|3612709_3613972_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_011258207.1|3613968_3615213_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.9	2.3e-92
WP_153296749.1|3615290_3615446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258206.1|3615456_3615996_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011258205.1|3615992_3616322_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_109181895.1|3618257_3619223_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_125168743.1|3619943_3620210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075239693.1|3620487_3621642_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_011258200.1|3621641_3622964_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_011407948.1|3622990_3624031_+	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_011407947.1|3624048_3624909_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_011407946.1|3624943_3625543_+	LysE family translocator	NA	NA	NA	NA	NA
WP_082322940.1|3625609_3626545_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_075239694.1|3626610_3627963_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_082322987.1|3628054_3629239_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	6.5e-41
WP_011257310.1|3630927_3632163_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_044757028.1|3633348_3635673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757029.1|3635697_3637566_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.2	4.4e-15
WP_011258190.1|3637778_3639209_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011407938.1|3639970_3640762_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_044757030.1|3641813_3643289_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.4	2.9e-99
>prophage 30
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	3649914	3717640	5015823	tRNA,transposase	Acinetobacter_phage(42.86%)	45	NA	NA
WP_082322988.1|3649914_3650871_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_011258179.1|3652872_3653313_+	VOC family protein	NA	NA	NA	NA	NA
WP_011258178.1|3653586_3655974_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.9	9.2e-10
WP_012445735.1|3656306_3658706_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	33.3	4.9e-11
WP_012445737.1|3659804_3661514_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_162531725.1|3661677_3662779_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.3	5.0e-43
WP_011258173.1|3662923_3663685_+	4-hydroxy-2-oxovalerate aldolase	NA	NA	NA	NA	NA
WP_044757032.1|3663685_3665827_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_011258171.1|3666062_3667289_+	siderophore biosynthesis protein PvsA	NA	NA	NA	NA	NA
WP_011258170.1|3667285_3669088_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_011258169.1|3669084_3670281_+	MFS transporter	NA	NA	NA	NA	NA
WP_027703817.1|3670258_3672028_+	iron transporter	NA	NA	NA	NA	NA
WP_027703818.1|3672024_3673221_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011258166.1|3673395_3674130_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_011258165.1|3674126_3674717_-	fructose 2,6-bisphosphatase	NA	NA	NA	NA	NA
WP_011407923.1|3674713_3675760_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258163.1|3675756_3676278_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_011258162.1|3676791_3677403_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_027703819.1|3677399_3677999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258160.1|3677998_3678592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258158.1|3680364_3682242_-	TonB-dependent vitamin B12 receptor	NA	A0A0P0I887	Acinetobacter_phage	29.5	4.9e-06
WP_109181892.1|3685299_3685449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757036.1|3685479_3686391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407916.1|3686515_3689101_-	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.4	3.8e-126
WP_011258151.1|3689546_3689852_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_012445759.1|3689881_3690157_+	glutathione transferase	NA	NA	NA	NA	NA
WP_094187788.1|3690842_3691640_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407913.1|3692334_3693549_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_011407912.1|3693968_3694376_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_044757505.1|3694716_3696207_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_044757038.1|3696832_3697240_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_044757039.1|3697363_3698143_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_011407909.1|3698243_3698756_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_011258141.1|3698799_3699057_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_011407908.1|3699166_3699964_-	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_044757040.1|3699954_3701025_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_011407905.1|3702597_3703974_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_011407903.1|3705533_3706325_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_027704032.1|3706612_3707662_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_044757042.1|3707909_3709493_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
WP_115862287.1|3709990_3710956_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_162828831.1|3711646_3712444_-	HutD family protein	NA	NA	NA	NA	NA
WP_005919170.1|3714236_3714569_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407897.1|3714768_3716262_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_044757045.1|3716581_3717640_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	3746797	3900629	5015823	transposase	Xanthomonas_phage(36.36%)	114	NA	NA
WP_011257570.1|3746797_3748033_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258091.1|3748454_3749843_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258090.1|3750598_3751540_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_011407882.1|3751853_3752618_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407881.1|3752810_3754193_+	APC family permease	NA	NA	NA	NA	NA
WP_011258087.1|3754632_3756030_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_012445797.1|3756592_3756991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258085.1|3757135_3758140_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011258084.1|3758177_3759695_-	tryptophan 7-halogenase	NA	A0A1D7SEI2	Cyanophage	32.3	8.1e-52
WP_044757048.1|3759735_3760782_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407875.1|3760792_3761545_-	SapC family protein	NA	NA	NA	NA	NA
WP_011407874.1|3761876_3765035_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044757049.1|3766081_3768088_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258079.1|3768307_3768754_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_011258077.1|3770781_3771948_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.1	5.8e-74
WP_011407870.1|3771949_3772522_-	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	27.7	1.1e-09
WP_011407869.1|3772534_3772939_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_027703609.1|3772976_3773654_-	YjfK family protein	NA	NA	NA	NA	NA
WP_027703610.1|3773650_3774733_-	potassium channel protein	NA	NA	NA	NA	NA
WP_011258072.1|3774758_3775532_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_012445807.1|3775544_3775961_-	YjfI family protein	NA	NA	NA	NA	NA
WP_011258070.1|3776141_3776741_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_011258069.1|3776907_3777450_+	shikimate kinase	NA	NA	NA	NA	NA
WP_011258068.1|3777446_3778559_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_011407864.1|3778860_3779112_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_011258066.1|3779126_3780191_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_044757050.1|3781662_3785379_+	avirulence protein	NA	NA	NA	NA	NA
WP_041182100.1|3785647_3785842_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408408.1|3785845_3786145_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_044757051.1|3786368_3790817_+	avirulence protein	NA	NA	NA	NA	NA
WP_042464821.1|3791085_3791280_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011407858.1|3791283_3791583_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	1.4e-45
WP_082322945.1|3791722_3795217_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_041182763.1|3795485_3795680_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	92.2	2.5e-19
WP_011407856.1|3795683_3795983_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	93.5	9.9e-47
WP_011407855.1|3796206_3799215_+	avirulence protein	NA	NA	NA	NA	NA
WP_041182763.1|3799483_3799678_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	92.2	2.5e-19
WP_011407856.1|3799681_3799981_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	93.5	9.9e-47
WP_044757053.1|3800204_3804332_+	avirulence protein	NA	NA	NA	NA	NA
WP_012444927.1|3804550_3804727_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012445821.1|3804723_3805395_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	36.8	3.1e-24
WP_012445822.1|3805416_3806286_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.0	1.2e-28
WP_044757054.1|3806782_3809962_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703881.1|3810247_3811537_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_011407850.1|3814927_3815377_-	azurin	NA	NA	NA	NA	NA
WP_011407846.1|3816819_3817323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258050.1|3817347_3817773_-	cytochrome c	NA	NA	NA	NA	NA
WP_044757055.1|3817769_3819377_-	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_011407842.1|3820913_3821531_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_011258048.1|3821777_3823004_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
WP_011258047.1|3823076_3823949_+	ion transporter	NA	NA	NA	NA	NA
WP_094187758.1|3825209_3826008_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407839.1|3826088_3826748_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_011407838.1|3826899_3828987_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_012445831.1|3829163_3830144_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	3.7e-98
WP_011407835.1|3830577_3831465_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
WP_094187728.1|3831507_3832305_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704066.1|3832530_3832920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407833.1|3832999_3833677_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704076.1|3834139_3835459_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_115801876.1|3835568_3836534_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3836622_3837386_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407830.1|3837773_3838775_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_153296750.1|3839431_3839572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445035.1|3840649_3841885_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_153296751.1|3842065_3842215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445839.1|3843965_3844739_+	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_011258028.1|3844752_3845583_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011407824.1|3845653_3846430_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011258026.1|3846440_3847133_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011407823.1|3847132_3847747_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-19
WP_011407822.1|3848089_3848674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703579.1|3848670_3849993_-	TonB family protein	NA	NA	NA	NA	NA
WP_011407820.1|3849982_3850348_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703580.1|3850447_3851809_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_044757056.1|3851826_3852525_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	9.8e-29
WP_044757057.1|3852547_3853210_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011407815.1|3853190_3854030_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407814.1|3854029_3854704_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_044757058.1|3854700_3856200_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_069960293.1|3856196_3856844_-	thermostable hemolysin	NA	NA	NA	NA	NA
WP_011258012.1|3859350_3860526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703583.1|3860655_3863370_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_133264561.1|3863430_3863670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407808.1|3863689_3864682_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_011258009.1|3864684_3865401_+	M23 family metallopeptidase	NA	A0A0M5M794	Arthrobacter_phage	34.2	2.7e-05
WP_011258007.1|3866219_3868220_-	transketolase	NA	NA	NA	NA	NA
WP_012445856.1|3868446_3869676_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_033013273.1|3869924_3870242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407804.1|3870537_3872295_-	membrane protein	NA	NA	NA	NA	NA
WP_027703586.1|3872291_3874109_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011258003.1|3874105_3875113_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011258002.1|3875109_3875571_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_011258001.1|3875573_3876536_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_012445859.1|3876556_3877576_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_115862288.1|3878198_3879233_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258092.1|3879303_3880539_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_094187728.1|3880681_3881479_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407796.1|3881550_3883500_-	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_011257996.1|3883519_3884053_-	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011257995.1|3884049_3884715_-	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_044757059.1|3884711_3885470_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407795.1|3885469_3886528_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257992.1|3886743_3889173_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_041182719.1|3889240_3890197_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_011407794.1|3890541_3891192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407793.1|3891568_3892858_-	citrate synthase	NA	NA	NA	NA	NA
WP_005911911.1|3893071_3893314_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_044757060.1|3893385_3894324_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011257988.1|3894449_3896603_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011257987.1|3896623_3897004_-	RidA family protein	NA	NA	NA	NA	NA
WP_011257986.1|3897083_3899255_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011407791.1|3899383_3899683_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_094187796.1|3899830_3900629_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	3959823	4028183	5015823	protease,integrase,transposase	Ralstonia_phage(23.53%)	54	3959261:3959320	4026306:4026370
3959261:3959320	attL	CCTAAGAACCTGTTCACGATCTCCTGAGCAGCAGTGCCAGGAACGCCAGGTGGATGAACT	NA	NA	NA	NA
WP_044757070.1|3959823_3961059_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_044757071.1|3962047_3963649_+	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_041182379.1|3964265_3965012_-	cellulase	NA	NA	NA	NA	NA
WP_113195645.1|3965484_3966243_-	cellulase	NA	NA	NA	NA	NA
WP_011407749.1|3966759_3967275_-	peptide deformylase	NA	NA	NA	NA	NA
WP_044757517.1|3967596_3968019_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	61.9	5.2e-41
WP_012445908.1|3968790_3970659_-	membrane protein	NA	NA	NA	NA	NA
WP_011407746.1|3970697_3971651_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_011257917.1|3971656_3972613_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011257916.1|3972605_3974558_+	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257915.1|3974554_3975088_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011407744.1|3975207_3975558_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257913.1|3975659_3976253_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_011257912.1|3976350_3976671_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_044757072.1|3976677_3978774_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_044757073.1|3979335_3979782_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257909.1|3979778_3980024_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011407742.1|3980020_3980518_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257907.1|3980542_3980902_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_044757074.1|3980919_3981951_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257905.1|3981950_3982700_-	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257904.1|3982699_3983449_-	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257903.1|3983469_3984519_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257902.1|3984729_3985134_-	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011407739.1|3985244_3985931_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
WP_115862289.1|3986029_3986995_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257899.1|3987077_3987635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239641.1|3987696_3987960_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_044757075.1|3987956_3989651_-	DUF2875 family protein	NA	NA	NA	NA	NA
WP_044757076.1|3989647_3991855_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-19
WP_075239641.1|3991916_3992180_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_044757077.1|3992176_3993871_-	DUF2875 family protein	NA	NA	NA	NA	NA
WP_011257897.1|3993867_3996072_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
WP_044757078.1|3996391_3998089_-	DUF2875 family protein	NA	NA	NA	NA	NA
WP_044757519.1|3998085_4000236_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.6e-27
WP_044757079.1|4000303_4003027_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.3	9.7e-72
WP_012445927.1|4003422_4003623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407730.1|4004515_4005145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445930.1|4005971_4006676_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011257889.1|4007111_4007846_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_011257888.1|4007854_4008307_-	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257887.1|4008334_4008991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257886.1|4009003_4009771_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_044757080.1|4009767_4010946_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011407728.1|4011644_4013615_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002806049.1|4014446_4014719_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_012445937.1|4014932_4017404_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_011257881.1|4017547_4018834_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_002806026.1|4018958_4019585_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_012445939.1|4019677_4020970_-	trigger factor	NA	NA	NA	NA	NA
WP_011257875.1|4024287_4025049_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_011257874.1|4025192_4026200_-	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_115862290.1|4026463_4027429_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
4026306:4026370	attR	CCTAAGAACCTGTTCACGATCTCCTGAGCAGCAGTGCCAGGAACGCCAGGTGGATGAACTGCAAG	NA	NA	NA	NA
WP_094187737.1|4027429_4028183_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	4072521	4182095	5015823	protease,transposase	Staphylococcus_prophage(12.5%)	75	NA	NA
WP_094187715.1|4072521_4073284_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409312.1|4074903_4075545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057581.1|4076777_4077506_+	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.4e-06
WP_011409560.1|4077551_4078514_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|4078618_4079381_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445975.1|4079375_4079618_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_011407721.1|4080166_4080628_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011258802.1|4080888_4081857_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187763.1|4083253_4084052_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257834.1|4084293_4084908_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257835.1|4084990_4085977_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|4086092_4086587_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|4086831_4088661_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011407704.1|4088679_4089150_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|4090072_4091200_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|4091300_4092683_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_044757084.1|4092930_4095054_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407706.1|4095582_4096101_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_011257570.1|4098424_4099660_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_044757085.1|4100273_4101164_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_115862291.1|4103763_4105083_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187858.1|4105827_4106751_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	5.8e-37
WP_094187763.1|4106938_4107736_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187736.1|4108646_4109409_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|4110765_4112343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|4112410_4113174_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044757086.1|4113240_4114455_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187798.1|4115825_4116623_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257831.1|4117595_4118480_-	membrane protein	NA	NA	NA	NA	NA
WP_027703752.1|4118626_4119223_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_044757531.1|4119222_4120581_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_011257828.1|4120947_4121511_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_011257827.1|4121670_4122927_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_012446005.1|4124607_4125099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182120.1|4125383_4125557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182780.1|4125553_4126519_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407697.1|4128760_4129243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257818.1|4129439_4129976_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_011257817.1|4130089_4131238_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|4131764_4132721_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011407696.1|4132910_4135877_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
WP_011407695.1|4135925_4136819_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407693.1|4139706_4141584_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011257812.1|4142860_4143862_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011257811.1|4143905_4145627_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257810.1|4145610_4145868_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_044757088.1|4145943_4147068_+	threonine dehydratase	NA	NA	NA	NA	NA
WP_011407690.1|4147064_4148627_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_011257808.1|4148957_4150031_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011257807.1|4150847_4151495_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011257806.1|4151562_4153011_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_027703665.1|4153131_4154016_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_115862292.1|4155007_4155973_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407687.1|4156141_4156603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257800.1|4156872_4157526_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407686.1|4157654_4158311_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011257798.1|4158331_4159711_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011257797.1|4159983_4161300_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_011257796.1|4161376_4162297_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
WP_011257795.1|4162530_4163865_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011407685.1|4163845_4164958_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011257793.1|4164967_4165165_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_103057263.1|4165290_4165824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257791.1|4166450_4167086_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011257788.1|4168816_4169599_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044757089.1|4169792_4172465_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.0	7.5e-77
WP_044757090.1|4172791_4174084_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	37.7	4.9e-74
WP_011257785.1|4174421_4174607_-	DUF2065 family protein	NA	NA	NA	NA	NA
WP_027703756.1|4174900_4175764_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_011407680.1|4175763_4176891_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257782.1|4177520_4177907_-	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011257781.1|4178146_4179046_-	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011407679.1|4179456_4179933_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257779.1|4180095_4180578_+	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_094187801.1|4181296_4182095_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	4214327	4283880	5015823	tRNA,transposase	Enterobacteria_phage(12.5%)	46	NA	NA
WP_059317495.1|4214327_4215293_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044757098.1|4215404_4217696_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_011257746.1|4217823_4218498_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_044757099.1|4218494_4220339_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_011257744.1|4220335_4221202_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_011257743.1|4221221_4221854_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_011407655.1|4221856_4222891_+	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_011257741.1|4222905_4223196_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_011407652.1|4230486_4231326_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011407650.1|4231936_4233094_+	phosphotransferase	NA	NA	NA	NA	NA
WP_044757100.1|4233129_4235292_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407648.1|4235667_4236243_+	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_011257733.1|4236348_4237077_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_011257732.1|4237507_4238347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257731.1|4238343_4240656_-	type II secretion system secretin GspD	NA	A7BJX1	Enterobacteria_phage	23.5	5.2e-10
WP_011407647.1|4240652_4241462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407646.1|4241451_4242105_-	general secretion pathway protein GspM	NA	NA	NA	NA	NA
WP_011407645.1|4242088_4243210_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407644.1|4243206_4244058_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_011257726.1|4244054_4244690_-	type II secretion system protein J	NA	NA	NA	NA	NA
WP_012446066.1|4244686_4245103_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011257724.1|4245099_4245609_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_011407642.1|4245618_4246050_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_044757101.1|4246317_4247535_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_041181968.1|4247534_4247714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257721.1|4247710_4249393_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_011407636.1|4251670_4255468_-	membrane protein	NA	NA	NA	NA	NA
WP_044757102.1|4256445_4260498_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.1	3.4e-121
WP_011257718.1|4260896_4261694_-	DsbC family protein	NA	NA	NA	NA	NA
WP_011257717.1|4262146_4263118_-	site-specific tyrosine recombinase XerD	NA	G1JX48	Mycobacterium_phage	27.9	6.4e-18
WP_011257716.1|4263544_4264012_+	RDD family protein	NA	NA	NA	NA	NA
WP_011407635.1|4264426_4265533_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_044757103.1|4265529_4266612_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_011257713.1|4266719_4268192_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	6.2e-49
WP_011257712.1|4268191_4268497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257711.1|4268537_4268963_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_044757104.1|4269170_4272113_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.8	8.4e-130
WP_027704099.1|4272120_4272423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187802.1|4273049_4274150_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.3	2.1e-41
WP_075244150.1|4274336_4274651_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_115862293.1|4274717_4276037_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|4276173_4277142_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_115862294.1|4277341_4278661_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044757108.1|4278980_4280021_+	pectate lyase	NA	NA	NA	NA	NA
WP_044757535.1|4280287_4282261_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	7.9e-15
WP_115862295.1|4282560_4283880_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	4305843	4316471	5015823		Enterobacteria_phage(42.86%)	10	NA	NA
WP_011407616.1|4305843_4307190_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011257680.1|4307236_4308640_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011257679.1|4308756_4309665_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.7	2.4e-27
WP_011257678.1|4309661_4310219_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	1.0e-44
WP_011407613.1|4310215_4311103_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407612.1|4311158_4312214_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011257675.1|4312439_4313186_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011257674.1|4313185_4314127_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011407611.1|4314349_4315168_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407610.1|4315157_4316471_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
>prophage 36
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	4444486	4478425	5015823	transposase	Staphylococcus_prophage(33.33%)	30	NA	NA
WP_094187763.1|4444486_4445284_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703947.1|4447149_4447422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757130.1|4447409_4449224_-	methyltransferase	NA	NA	NA	NA	NA
WP_011407528.1|4449344_4449725_+	response regulator	NA	NA	NA	NA	NA
WP_011257545.1|4449693_4449960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407527.1|4449959_4451240_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_044757132.1|4451386_4451602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407526.1|4452356_4453766_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_044757134.1|4453756_4454773_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_075240101.1|4454941_4455208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115862297.1|4456205_4457594_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|4457891_4458848_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_012443955.1|4458923_4459892_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.5e-99
WP_115862298.1|4460041_4461361_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_153296753.1|4461431_4461596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703827.1|4461595_4461829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013369.1|4462086_4463133_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_044757138.1|4463316_4464897_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011409570.1|4465285_4466182_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_011260477.1|4466184_4467348_-	heme A synthase	NA	NA	NA	NA	NA
WP_011260478.1|4467358_4467934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443950.1|4467961_4468681_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_012443949.1|4468741_4468960_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_011260481.1|4469059_4469935_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_012443948.1|4469973_4470570_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011260484.1|4470720_4472325_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_011260485.1|4472363_4473317_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_044757542.1|4473333_4473810_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_011260487.1|4474086_4477287_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_094187805.1|4477446_4478425_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
>prophage 37
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	4491706	4632814	5015823	integrase,tRNA,transposase	Staphylococcus_prophage(13.04%)	101	4501907:4501923	4550279:4550295
WP_094187806.1|4491706_4492808_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
WP_011409585.1|4493412_4495644_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_027704002.1|4495833_4497546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757142.1|4497694_4499071_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.9e-79
WP_041182574.1|4499365_4500322_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	4.5e-40
4501907:4501923	attL	GCGTAGTGCTGCGTCAT	NA	NA	NA	NA
WP_011257523.1|4503355_4503484_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011407508.1|4503627_4503873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257521.1|4503869_4504142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257520.1|4504138_4504345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257519.1|4504478_4505753_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.4e-110
WP_044757143.1|4506012_4506810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041181951.1|4506806_4508081_-	DNA cytosine methyltransferase	NA	A0A191SB20	Nostoc_phage	37.4	8.3e-58
WP_011257516.1|4508161_4508572_-	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	52.0	7.0e-35
WP_041181950.1|4510039_4510342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757144.1|4510348_4511434_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_044757145.1|4511435_4511696_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_044757146.1|4511692_4512172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757147.1|4512185_4512905_-	P-type DNA transfer protein VirB5	NA	NA	NA	NA	NA
WP_044757149.1|4513536_4514376_-	helix-turn-helix domain-containing protein	NA	R9TPU9	Vibrio_phage	40.0	8.0e-09
WP_076659458.1|4514372_4514606_-	plasmid-related protein	NA	NA	NA	NA	NA
WP_041181948.1|4514844_4515939_-|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	36.9	2.6e-52
WP_011407506.1|4516688_4517009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407505.1|4517201_4519076_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_011257505.1|4519184_4519625_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_011407504.1|4519725_4520640_+	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011407503.1|4520839_4521361_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011257502.1|4521603_4522737_+	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_042465436.1|4522846_4523350_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_044757151.1|4523346_4524852_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_044757545.1|4525017_4526073_-	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_011257498.1|4526076_4526901_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_044757153.1|4527098_4528376_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257496.1|4528540_4530262_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011407500.1|4530312_4531626_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011257494.1|4531625_4532549_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_011257493.1|4532942_4533455_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_011407499.1|4533587_4534724_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_011257491.1|4534795_4535938_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_011257490.1|4535980_4536454_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_041181947.1|4536494_4537217_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_011257488.1|4537258_4538533_+	RDD family protein	NA	NA	NA	NA	NA
WP_011257487.1|4538715_4541208_+	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
WP_011257486.1|4541218_4541782_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011407497.1|4542005_4542779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757155.1|4542775_4543450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407495.1|4543611_4544388_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011257482.1|4544494_4544710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181946.1|4544895_4546797_-	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
WP_041181945.1|4546881_4548258_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011257479.1|4548766_4549612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443959.1|4549942_4550545_-	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
4550279:4550295	attR	ATGACGCAGCACTACGC	NA	NA	NA	NA
WP_011257477.1|4550528_4551554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757158.1|4552019_4554242_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_011257475.1|4554644_4555160_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_115862299.1|4556615_4557581_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407487.1|4557765_4558098_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_041182799.1|4558103_4560428_+	cytochrome c biogenesis protein	NA	NA	NA	NA	NA
WP_044757162.1|4561261_4561708_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257470.1|4561806_4562292_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_011407484.1|4562324_4562732_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_010368143.1|4562767_4564135_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_011257468.1|4564273_4564639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187861.1|4564635_4565028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407482.1|4565096_4565561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257466.1|4566506_4567448_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_027703754.1|4567594_4568110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257464.1|4568253_4568631_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075239516.1|4569341_4570187_+	DUF3426 domain-containing protein	NA	NA	NA	NA	NA
WP_011257462.1|4570293_4570566_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_109181928.1|4571250_4572216_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012446211.1|4572212_4572407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756425.1|4572561_4573938_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.2	1.9e-79
WP_041182545.1|4573948_4574905_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_041182545.1|4575273_4576230_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_143690749.1|4578284_4578695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082322957.1|4578706_4589431_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	35.6	3.6e-37
WP_027704272.1|4589452_4591195_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.7	4.3e-33
WP_115862300.1|4591431_4592751_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075242920.1|4592980_4593385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407477.1|4595265_4596264_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_113085341.1|4595915_4596584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407476.1|4596584_4596986_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_044757167.1|4597803_4599387_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	45.6	2.0e-61
WP_011257455.1|4599436_4600672_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	25.9	1.3e-20
WP_011407473.1|4600671_4601286_+	DUF4276 family protein	NA	NA	NA	NA	NA
WP_011257454.1|4601306_4602596_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_011257453.1|4602748_4603942_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011407472.1|4603938_4604520_+	DUF4276 family protein	NA	NA	NA	NA	NA
WP_011257452.1|4604745_4606959_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_044757169.1|4609350_4611273_+	MFS transporter	NA	NA	NA	NA	NA
WP_011257450.1|4611733_4612114_+	CD225/dispanin family protein	NA	NA	NA	NA	NA
WP_075242191.1|4612116_4612524_+	DUF2752 domain-containing protein	NA	NA	NA	NA	NA
WP_011257449.1|4612845_4613736_-	membrane protein	NA	NA	NA	NA	NA
WP_011257448.1|4613809_4614700_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_011407465.1|4615006_4616287_-	lipase	NA	NA	NA	NA	NA
WP_011407463.1|4617213_4617600_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.9	1.1e-24
WP_052658702.1|4618108_4618897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407461.1|4619004_4619631_+	DUF4126 domain-containing protein	NA	NA	NA	NA	NA
WP_044757175.1|4619669_4621640_+	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011257440.1|4621640_4623950_+	response regulator	NA	A0A1V0SGX0	Hokovirus	40.8	7.7e-46
WP_011407458.1|4631602_4632814_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 38
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	4735777	4889855	5015823	holin,transposase,tRNA	Tupanvirus(10.53%)	103	NA	NA
WP_011257354.1|4735777_4736782_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_012446316.1|4737244_4737469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257351.1|4738189_4738765_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011257350.1|4738823_4740347_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.0	2.2e-97
WP_011257349.1|4741037_4741508_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012446321.1|4741469_4741658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407399.1|4742718_4742985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|4743065_4744034_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_044757197.1|4744418_4746551_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_011257344.1|4746828_4746978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407398.1|4747012_4747399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257342.1|4747400_4748252_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_041181934.1|4748304_4749186_+	TolB-like protein	NA	NA	NA	NA	NA
WP_011257339.1|4749808_4752343_-	iron-uptake factor	NA	NA	NA	NA	NA
WP_011407395.1|4752576_4753329_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.9	5.6e-22
WP_011407394.1|4753456_4754371_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407393.1|4755643_4756636_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_011257333.1|4757300_4757759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181932.1|4757858_4759649_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_027703506.1|4759857_4762095_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011257330.1|4762519_4763209_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_044757561.1|4763598_4766613_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407388.1|4766796_4767498_+	SapC family protein	NA	NA	NA	NA	NA
WP_011257326.1|4767487_4768501_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_041181930.1|4768511_4770077_+	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
WP_044757199.1|4770216_4771227_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257323.1|4771636_4772830_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012446337.1|4772826_4773573_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.5e-19
WP_027703503.1|4773604_4775206_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011257320.1|4775266_4775467_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027703502.1|4775463_4776051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153296754.1|4776254_4776416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407380.1|4776536_4776809_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_027703501.1|4776874_4777864_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_027703500.1|4777948_4778776_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011257314.1|4778812_4779808_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
WP_012446343.1|4779825_4780617_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257312.1|4780580_4781369_+	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	4.5e-54
WP_012446345.1|4781487_4782426_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_011257310.1|4782852_4784088_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_082322992.1|4784140_4785307_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187862.1|4787940_4789042_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	4.7e-41
WP_041182545.1|4789164_4790121_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_094187782.1|4790860_4791623_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187814.1|4791683_4792481_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407366.1|4792833_4793118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757202.1|4795464_4796574_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_044757204.1|4796808_4797453_+	sterol-binding protein	NA	NA	NA	NA	NA
WP_011257293.1|4797449_4799123_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_011257292.1|4799236_4799626_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_027703865.1|4799850_4800603_+	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_011407361.1|4800698_4801277_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_011407360.1|4801333_4801765_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011407359.1|4801767_4802397_+|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_044757206.1|4802426_4802627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464365.1|4803033_4805202_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011257286.1|4805328_4807491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|4808317_4809283_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257284.1|4809475_4810957_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_011257283.1|4811393_4811753_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_011407355.1|4811755_4813057_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011407354.1|4813237_4814014_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|4814142_4814906_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407353.1|4815306_4815891_+	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011257279.1|4816083_4819533_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_044757210.1|4820280_4822923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757567.1|4823026_4825426_-	NdvB protein	NA	NA	NA	NA	NA
WP_027703801.1|4825428_4826811_-	MFS transporter	NA	NA	NA	NA	NA
WP_027703800.1|4826968_4827553_+	gluconokinase	NA	NA	NA	NA	NA
WP_044757212.1|4828445_4830200_+	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_011257273.1|4830507_4830735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407344.1|4830715_4831165_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257271.1|4831175_4831604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115862301.1|4833098_4834418_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258188.1|4837289_4838258_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115862302.1|4839540_4840860_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012445230.1|4841152_4842388_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_059317507.1|4844069_4845026_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	1.0e-39
WP_115862304.1|4845870_4846836_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044757224.1|4846853_4847411_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011257259.1|4847429_4847717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407332.1|4848101_4848896_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257257.1|4848895_4849645_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012446379.1|4849656_4850208_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257255.1|4850204_4850867_+	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_011257254.1|4850856_4851147_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257253.1|4851157_4852216_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_094187817.1|4854014_4854778_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044757229.1|4854882_4855845_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407325.1|4856191_4857007_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_044757236.1|4866352_4868257_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407319.1|4868253_4868856_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011407318.1|4868915_4870220_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011257243.1|4870767_4872930_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407316.1|4873223_4873430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257241.1|4873637_4874027_-	YchJ family protein	NA	NA	NA	NA	NA
WP_011257239.1|4875385_4876516_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257238.1|4877163_4878216_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257237.1|4878978_4880052_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011407313.1|4880359_4881418_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
WP_011407913.1|4882648_4883863_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_041182826.1|4885591_4886125_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_094187728.1|4889056_4889855_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 39
NZ_CP031463	Xanthomonas oryzae pv. oryzae strain PX086 chromosome, complete genome	5015823	4943223	4988585	5015823	protease,transposase	Acidithiobacillus_phage(25.0%)	31	NA	NA
WP_115862307.1|4943223_4944189_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260840.1|4944364_4945780_-	amino acid permease	NA	NA	NA	NA	NA
WP_011260841.1|4946270_4948595_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_044757575.1|4948952_4949363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757577.1|4949740_4950286_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	33.9	2.6e-16
WP_044757259.1|4950381_4951758_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.1e-76
WP_011260845.1|4952794_4953922_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_011409820.1|4954777_4956118_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_011409821.1|4956334_4957027_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409822.1|4957150_4957471_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_011260850.1|4957470_4958463_+	D-2-hydroxyacid dehydrogenase family protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.4	8.5e-10
WP_011409823.1|4958769_4960293_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.7e-25
WP_011409824.1|4960397_4961633_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_011260853.1|4961793_4962450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757261.1|4962600_4964412_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_011409826.1|4964559_4964910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115862308.1|4965088_4966408_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465377.1|4967820_4969002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409829.1|4969099_4972531_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011409830.1|4972678_4973377_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_011409831.1|4973360_4974833_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_044757264.1|4974829_4975417_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_044757265.1|4975416_4976613_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_041182832.1|4976686_4977289_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	48.9	2.0e-46
WP_103057218.1|4977996_4978524_+	TolC family protein	NA	NA	NA	NA	NA
WP_011409837.1|4978520_4979087_+	FUSC family protein	NA	NA	NA	NA	NA
WP_011409838.1|4979362_4980724_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.9	8.3e-32
WP_082322996.1|4980985_4981942_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.7	2.4e-41
WP_011409842.1|4984031_4984238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409843.1|4984224_4985337_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_044749647.1|4987208_4988585_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
