The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	7692	78816	4867200	protease,transposase	Ralstonia_phage(30.0%)	56	NA	NA
WP_011407164.1|7692_8529_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011407165.1|8715_9522_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9798_10992_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011257014.1|11145_11817_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|11901_12663_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12709_13132_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13135_13549_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011407166.1|13844_14612_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14622_14892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407167.1|14966_16427_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|17073_18084_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18355_19558_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19699_21838_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|22048_22342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296734.1|22373_22871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113085515.1|23117_24098_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	56.2	5.3e-89
WP_011257025.1|24145_25312_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_069959658.1|25458_26025_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_069959660.1|27499_28708_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|29335_30358_-	sugar kinase	NA	NA	NA	NA	NA
WP_041181893.1|30938_31178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407175.1|31180_32149_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_146770128.1|32543_33773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129215536.1|33769_34477_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.6e-05
WP_012443646.1|35078_36455_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	4.1e-79
WP_012443643.1|39467_39710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443642.1|39651_39975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257128.1|40440_41421_-|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
WP_011407184.1|42039_43329_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
WP_011407185.1|43768_44104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407187.1|44378_44810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|45158_46568_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041181902.1|46845_47061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|47885_48146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|48162_48495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080256644.1|48494_48953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407913.1|49312_50527_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187731.1|51047_51845_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182053.1|53560_54526_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_125168734.1|54522_54801_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_115840378.1|54944_56264_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407197.1|56381_57428_+	methylamine utilization protein	NA	NA	NA	NA	NA
WP_011407198.1|57568_58066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703730.1|58229_58862_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_011257110.1|58878_61041_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011407199.1|61155_61341_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011257109.1|61363_63967_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_094187819.1|63963_65853_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_011257107.1|65909_67667_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_011407200.1|67669_69904_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_027703733.1|69900_71484_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_011257104.1|71957_73586_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_011257103.1|73582_74947_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011257102.1|75139_76081_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_011407202.1|76321_78046_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
WP_109181945.1|78052_78816_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	109332	135584	4867200	transposase	Ralstonia_phage(50.0%)	23	NA	NA
WP_011257031.1|109332_110301_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_115840379.1|110513_111833_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407219.1|112021_113005_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_041181898.1|113726_116135_+	serine kinase	NA	NA	NA	NA	NA
WP_011257061.1|117010_118639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407223.1|119196_119580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407224.1|119576_120062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407225.1|120065_120428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407226.1|120544_121981_-	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.7	1.5e-10
WP_011407227.1|122222_123074_+	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
WP_011257053.1|123533_123851_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011257052.1|124156_125044_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_011407229.1|125750_126701_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	3.0e-97
WP_125168735.1|126814_127024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407230.1|127091_127352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257048.1|127404_127686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407231.1|127824_128883_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011407232.1|129023_129971_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
WP_011407233.1|130225_130537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|132003_132474_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011257042.1|132643_133336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257041.1|133427_133826_+	host attachment protein	NA	NA	NA	NA	NA
WP_011407237.1|134627_135584_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
>prophage 3
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	221031	384908	4867200	transposase,tRNA,holin	Bacillus_phage(16.67%)	111	NA	NA
WP_011257198.1|221031_222936_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_075239321.1|223196_223376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407290.1|223509_223977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257199.1|224134_225094_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_011407291.1|225078_225696_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011257200.1|225738_226158_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_011257201.1|226410_227316_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	39.2	4.4e-37
WP_011257202.1|227564_228449_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011257203.1|228512_229295_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407292.1|229339_230101_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_011257206.1|230264_230594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407293.1|230912_232004_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_011407294.1|232072_233671_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_011407295.1|233835_235080_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_011257210.1|235531_236161_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	3.3e-52
WP_011257211.1|236367_238344_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
WP_011407298.1|239730_240396_-	YceH family protein	NA	NA	NA	NA	NA
WP_011257214.1|240675_241686_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_011257215.1|241682_242414_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_011257216.1|242767_244297_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.0e-46
WP_011407300.1|244406_247439_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257218.1|247737_250776_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257219.1|250940_251993_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_075240491.1|252161_252407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407301.1|252405_253371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257221.1|253370_256031_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_008573820.1|257849_258053_-	YdcH family protein	NA	NA	NA	NA	NA
WP_011257226.1|261693_262338_-	DUF4375 domain-containing protein	NA	NA	NA	NA	NA
WP_011257227.1|262478_263369_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_011407307.1|263496_263979_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257232.1|267014_267548_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_011407313.1|270363_271422_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
WP_011257237.1|271729_272803_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257238.1|273565_274618_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257239.1|275265_276396_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011407314.1|276650_276965_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_011257241.1|277712_278102_+	YchJ family protein	NA	NA	NA	NA	NA
WP_011407316.1|278309_278516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|278747_279716_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011257243.1|279969_282132_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407318.1|282679_283984_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011407319.1|284043_284646_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011257245.1|284642_286547_+	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407325.1|295865_296681_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_041182297.1|297027_297990_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182012.1|298094_298857_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257253.1|300656_301715_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011257254.1|301725_302016_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257255.1|302005_302668_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_012446379.1|302664_303216_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257257.1|303227_303977_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407332.1|303976_304771_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257259.1|305155_305443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703982.1|305461_306019_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182061.1|306036_307002_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407336.1|307846_308803_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	2.9e-39
WP_109182012.1|308874_309637_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182062.1|309676_310475_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407338.1|310606_311821_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
WP_109182063.1|311880_312711_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407798.1|312873_314109_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011257271.1|315507_315936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407344.1|315946_316396_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257273.1|316376_316604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407346.1|316911_318666_-	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_109182012.1|319565_320328_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703800.1|320381_320966_-	gluconokinase	NA	NA	NA	NA	NA
WP_011407349.1|321123_322506_+	MFS transporter	NA	NA	NA	NA	NA
WP_011407350.1|322508_324908_+	NdvB protein	NA	NA	NA	NA	NA
WP_011407351.1|325011_327654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257279.1|328401_331851_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011407353.1|332043_332628_-	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011407354.1|333104_333881_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407355.1|334061_335363_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011257283.1|335365_335725_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_011257284.1|336161_337643_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_109182027.1|337835_338801_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407357.1|339627_341790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042464365.1|341916_344085_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011407359.1|344722_345352_-|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_011407360.1|345354_345786_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011407361.1|345842_346421_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_027703865.1|346516_347269_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_011257292.1|347493_347883_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011257293.1|347996_349670_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_044757204.1|349666_350311_-	sterol-binding protein	NA	NA	NA	NA	NA
WP_069959688.1|350320_350515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407366.1|353995_354280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182066.1|354631_355430_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|355489_356253_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182067.1|360206_361172_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042464374.1|362232_363339_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465421.1|365132_366071_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_080493948.1|366189_366978_-	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	4.5e-54
WP_012446343.1|366941_367733_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257314.1|367750_368746_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
WP_075242284.1|368782_369610_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_027703501.1|369694_370684_-	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_011407380.1|370749_371022_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_153296754.1|371142_371304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465424.1|371507_372095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257320.1|372091_372292_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011407383.1|372352_373954_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024712051.1|373985_374732_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
WP_011407385.1|374728_375922_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407386.1|376331_377354_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_041181930.1|377493_379059_-	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
WP_011257326.1|379069_380083_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407388.1|380072_380774_-	SapC family protein	NA	NA	NA	NA	NA
WP_011407389.1|380957_383972_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_109181945.1|384145_384908_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	567532	617030	4867200	integrase,transposase,tRNA	Sinorhizobium_phage(14.29%)	44	575683:575699	613818:613834
WP_109181928.1|567532_568498_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_115840162.1|568965_570285_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257475.1|570814_571330_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011407490.1|571732_573955_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_103057279.1|574423_575449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959707.1|575432_576035_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
575683:575699	attL	GCGTAGTGCTGCGTCAT	NA	NA	NA	NA
WP_069959708.1|576365_577310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407493.1|577828_579205_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011407494.1|579289_581191_+	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
WP_011257482.1|581376_581592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407495.1|581698_582475_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407496.1|582636_583311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407497.1|583307_584081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257486.1|584304_584868_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011257487.1|584878_587371_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
WP_011257488.1|587553_588828_-	RDD family protein	NA	NA	NA	NA	NA
WP_069959711.1|588869_589592_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_011257490.1|589632_590106_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_011257491.1|590148_591291_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_011407499.1|591362_592499_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_011257493.1|592631_593144_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_011257494.1|593537_594461_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_011407500.1|594460_595774_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011257496.1|595824_597546_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011257497.1|597710_598988_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257498.1|599185_600010_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011407501.1|600013_601069_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_011257500.1|601234_602701_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_042465436.1|602697_603201_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_011257502.1|603310_604444_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_011407503.1|604686_605208_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011407504.1|605407_606322_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011257505.1|606422_606863_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_011407505.1|606971_608846_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_011407506.1|609038_609359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960144.1|609510_609729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257519.1|609987_611262_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.4e-110
WP_011257520.1|611395_611602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257521.1|611598_611871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407508.1|611867_612113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257523.1|612256_612385_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011407512.1|614048_615284_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
613818:613834	attR	ATGACGCAGCACTACGC	NA	NA	NA	NA
WP_011407513.1|615352_615742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|616064_617030_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	764458	800777	4867200	transposase,tRNA	Enterobacteria_phage(36.36%)	32	NA	NA
WP_109182077.1|764458_765778_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407609.1|766093_767278_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_011407610.1|767807_769121_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
WP_011407611.1|769110_769929_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257674.1|770151_771093_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011257675.1|771092_771839_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011407612.1|772064_773120_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011407613.1|773175_774063_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407614.1|774059_774617_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
WP_011407615.1|774613_775522_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
WP_011257680.1|775638_777042_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011407616.1|777088_778435_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011407617.1|778568_779300_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_011257683.1|779299_779929_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_011407618.1|779986_782074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446093.1|782070_783720_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_011257686.1|783835_784444_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	31.4	1.8e-23
WP_011257687.1|784994_785639_-	ABC transporter	NA	NA	NA	NA	NA
WP_011257688.1|785635_786562_-	MCE family protein	NA	NA	NA	NA	NA
WP_113055139.1|786564_787407_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	7.0e-13
WP_011407620.1|787492_788605_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257691.1|788774_790034_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_011407621.1|790095_790557_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011257693.1|790699_792394_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011257694.1|792505_792910_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011407623.1|793041_793815_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011257696.1|793825_794293_+	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_011407624.1|794289_794772_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182079.1|795330_796650_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182080.1|796807_798127_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407627.1|798339_799308_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_109182081.1|799457_800777_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	867967	912025	4867200	protease,transposase	Ralstonia_phage(25.0%)	38	NA	NA
WP_069963827.1|867967_868933_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257750.1|869323_869899_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_011407659.1|870011_870521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010368401.1|870619_870814_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_113055129.1|870903_871881_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011257753.1|872110_872551_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_011257754.1|872828_873773_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_011407660.1|873855_874599_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
WP_010368407.1|874803_875043_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_011407661.1|875184_876420_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011407662.1|876590_877946_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_011257758.1|878006_879080_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_011257759.1|879076_880036_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_011257760.1|880032_880386_+	type IV fimbriae assembly protein	NA	NA	NA	NA	NA
WP_011407663.1|880909_881383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407665.1|882403_882730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181972.1|882965_884564_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_011257763.1|884709_885606_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_011407667.1|885681_886836_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_011257765.1|887016_889608_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_011407669.1|889930_890068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407670.1|890340_891540_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_011409545.1|891989_892958_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407672.1|893199_895416_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407673.1|895494_896493_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_103057250.1|896602_896785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464512.1|897764_900752_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041181973.1|900926_901874_+	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
WP_011407676.1|902377_902914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407677.1|902984_904304_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407678.1|904648_905611_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.7e-42
WP_011257778.1|905744_906305_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011257779.1|906347_906830_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_011407679.1|906992_907469_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257781.1|907879_908779_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011257782.1|909018_909405_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011407680.1|910034_911162_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257784.1|911161_912025_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 7
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	917325	1080687	4867200	protease,transposase,integrase	Ralstonia_phage(21.43%)	116	1008861:1008879	1077798:1077816
WP_011257788.1|917325_918108_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_115840190.1|918218_919595_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	4.3e-76
WP_011257791.1|919838_920474_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103057263.1|921100_921634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257793.1|921759_921957_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_011407685.1|921966_923079_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011257795.1|923059_924394_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257796.1|924627_925548_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
WP_011257797.1|925624_926941_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_011257798.1|927213_928593_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011407686.1|928613_929270_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011257800.1|929398_930052_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407687.1|930322_930784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703665.1|931843_932728_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257806.1|932848_934297_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_011257807.1|934364_935012_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011257808.1|935828_936902_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011407690.1|937232_938795_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_011407691.1|938791_939916_-	threonine dehydratase	NA	NA	NA	NA	NA
WP_011257810.1|939991_940249_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_011257811.1|940232_941954_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257812.1|941997_942999_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011407693.1|944275_946153_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011407694.1|946578_948930_+	biopolymer transporter Tol	NA	NA	NA	NA	NA
WP_011407695.1|949040_949934_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407696.1|949982_952949_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
WP_011257817.1|953563_954712_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011257818.1|954825_955362_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_011407697.1|955558_956041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182067.1|958316_959282_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182120.1|959278_959452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446005.1|959736_960228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257827.1|961907_963164_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011257828.1|963323_963887_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_011257829.1|964253_965612_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_027703752.1|965611_966208_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_011257831.1|966354_967239_+	membrane protein	NA	NA	NA	NA	NA
WP_011257834.1|969220_969835_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257835.1|969917_970904_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|971019_971514_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|971758_973588_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011407704.1|973606_974077_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|974999_976127_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|976227_977610_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_011257842.1|977857_979981_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407706.1|980509_981028_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_115801872.1|981734_982836_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.6e-41
WP_011257570.1|983351_984587_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_103057209.1|985200_986049_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_012445986.1|986180_986321_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_011407713.1|989880_991116_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109182089.1|992098_993418_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182948.1|994163_995087_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
WP_109182121.1|996149_997115_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|997416_998994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|999061_999825_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1002493_1003462_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011407721.1|1003722_1004184_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011257866.1|1004732_1004975_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_109182012.1|1004968_1005732_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049756327.1|1005764_1006496_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
WP_109182091.1|1008315_1009068_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1008861:1008879	attL	GCGACAGCGGCTACACCGG	NA	NA	NA	NA
WP_109181948.1|1009069_1010035_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257874.1|1010298_1011306_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011257875.1|1011449_1012211_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_002806026.1|1016912_1017539_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|1017663_1018950_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_012445937.1|1019093_1021565_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_002806049.1|1021778_1022051_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_011407728.1|1022882_1024853_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011407729.1|1025565_1026744_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011257886.1|1026740_1027508_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011257887.1|1027520_1028177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257888.1|1028204_1028657_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257889.1|1028665_1029400_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_011257891.1|1029835_1030540_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_041181989.1|1031365_1031995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445927.1|1032886_1033087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082325231.1|1033482_1036206_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.2	2.8e-71
WP_069960070.1|1036273_1038424_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
WP_044757078.1|1038420_1040118_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_011257897.1|1040437_1042642_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
WP_011257898.1|1042638_1044333_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|1044329_1044593_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_109182093.1|1044654_1046862_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-19
WP_011407737.1|1046858_1048538_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|1048534_1048798_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_011257899.1|1048859_1049417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182094.1|1049499_1050465_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407739.1|1050563_1051250_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
WP_011257902.1|1051360_1051765_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011407740.1|1051975_1053025_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257904.1|1053045_1053795_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257905.1|1053794_1054544_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257906.1|1054543_1055575_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257907.1|1055592_1055952_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011407742.1|1055976_1056474_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257909.1|1056470_1056716_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011257910.1|1056712_1057159_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257911.1|1057720_1059817_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_011257912.1|1059823_1060144_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011257913.1|1060241_1060835_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_011407744.1|1060936_1061287_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257915.1|1061406_1061940_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011257916.1|1061936_1063889_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257917.1|1063881_1064838_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407746.1|1064843_1065797_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_012445908.1|1065835_1067704_+	membrane protein	NA	NA	NA	NA	NA
WP_011407749.1|1069219_1069735_+	peptide deformylase	NA	NA	NA	NA	NA
WP_103057268.1|1070251_1071010_+	cellulase	NA	NA	NA	NA	NA
WP_041182379.1|1071482_1072229_+	cellulase	NA	NA	NA	NA	NA
WP_011407751.1|1072845_1074447_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_011257570.1|1075435_1076671_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258188.1|1077499_1078468_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
1077798:1077816	attR	CCGGTGTAGCCGCTGTCGC	NA	NA	NA	NA
WP_075241901.1|1078935_1079286_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_011407756.1|1079367_1080687_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	1119417	1161864	4867200	transposase	Leptospira_phage(25.0%)	41	NA	NA
WP_109182097.1|1119417_1120519_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
WP_011407778.1|1121949_1122573_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_011257965.1|1122596_1122836_+	rubredoxin	NA	NA	NA	NA	NA
WP_011257966.1|1122885_1123767_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011407780.1|1123916_1124366_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_011407781.1|1124516_1125164_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_011257969.1|1125255_1125726_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_011407783.1|1125722_1126313_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_011257971.1|1126921_1127221_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_011407784.1|1127217_1127439_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_011407785.1|1127674_1128217_+	YecA family protein	NA	NA	NA	NA	NA
WP_011257974.1|1128227_1129568_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_162013040.1|1130085_1130244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187736.1|1130275_1131039_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257975.1|1131271_1132597_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_011257976.1|1132795_1133143_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011407789.1|1133139_1135548_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011257978.1|1135726_1136884_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_011257979.1|1136899_1137499_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.8	3.8e-13
WP_011257980.1|1137495_1137891_-	glyoxalase	NA	NA	NA	NA	NA
WP_011257981.1|1137887_1138613_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_011257982.1|1138722_1139583_+	YicC family protein	NA	NA	NA	NA	NA
WP_011257983.1|1139699_1140311_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	30.9	3.1e-10
WP_099051298.1|1140491_1141289_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407791.1|1141437_1141737_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_011257986.1|1141865_1144037_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011257987.1|1144116_1144497_+	RidA family protein	NA	NA	NA	NA	NA
WP_011407792.1|1144517_1146671_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011257989.1|1146796_1147735_+	inosine-uridine preferring nucleoside hydrolase	NA	NA	NA	NA	NA
WP_005911911.1|1147806_1148049_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011407793.1|1148262_1149552_+	citrate synthase	NA	NA	NA	NA	NA
WP_011407794.1|1149929_1150580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257992.1|1150889_1153319_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_011407795.1|1153534_1154593_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257994.1|1154592_1155351_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011257995.1|1155347_1156013_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_011257996.1|1156009_1156543_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011407796.1|1156562_1158512_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_094187763.1|1158582_1159381_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257854.1|1159523_1160759_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011407799.1|1160829_1161864_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	1201081	1232922	4867200	transposase	Feldmannia_irregularis_virus(16.67%)	25	NA	NA
WP_109181945.1|1201081_1201844_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115801876.1|1201933_1202899_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027704076.1|1203008_1204328_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011407833.1|1204790_1205468_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704066.1|1205547_1205937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407835.1|1206150_1207038_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
WP_113081219.1|1207471_1208456_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	6.3e-98
WP_011407838.1|1208630_1210718_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011407839.1|1210869_1211529_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_094187758.1|1211609_1212407_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407841.1|1212429_1212609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258045.1|1212627_1213032_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258046.1|1213065_1213425_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258047.1|1213668_1214541_-	ion transporter	NA	NA	NA	NA	NA
WP_011258048.1|1214613_1215840_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
WP_011407842.1|1216085_1216703_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_042464589.1|1218239_1219847_+	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_011258050.1|1219843_1220269_+	cytochrome c	NA	NA	NA	NA	NA
WP_011407846.1|1220293_1220797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407850.1|1222239_1222689_+	azurin	NA	NA	NA	NA	NA
WP_011407853.1|1225935_1227225_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_011407854.1|1227510_1230690_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258055.1|1231186_1232056_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
WP_115840380.1|1232077_1232749_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_012444927.1|1232745_1232922_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	1452532	1589614	4867200	transposase,tRNA	uncultured_Caudovirales_phage(16.0%)	108	NA	NA
WP_109181897.1|1452532_1453498_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182392.1|1453850_1454555_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005926176.1|1455092_1455317_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_113055187.1|1455316_1457389_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_011407980.1|1457620_1458478_+	pirin family protein	NA	NA	NA	NA	NA
WP_082323236.1|1459513_1461916_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	4.6e-41
WP_027704078.1|1461970_1462831_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_075241467.1|1462899_1463478_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_044757488.1|1463467_1464880_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_044757009.1|1464889_1467313_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	2.4e-37
WP_011258248.1|1467309_1468257_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_162828935.1|1468469_1468856_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_041182394.1|1469250_1469799_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_075245366.1|1470193_1470751_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407990.1|1470800_1472909_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_069964947.1|1472930_1474832_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.9e-30
WP_027704078.1|1474886_1475747_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_075251795.1|1475815_1476394_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258251.1|1476857_1477091_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407994.1|1477311_1477878_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407995.1|1478080_1478668_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_162013049.1|1479020_1479455_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_069959784.1|1479451_1481860_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011407999.1|1482204_1482666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408000.1|1482912_1483803_-	pirin family protein	NA	NA	NA	NA	NA
WP_125168744.1|1483980_1484499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444354.1|1484570_1485284_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_011258259.1|1485387_1486137_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_042465485.1|1486497_1486749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407587.1|1486933_1487968_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011408003.1|1488197_1490255_+	M13 family peptidase	NA	A0A1V0SHG2	Klosneuvirus	28.6	1.2e-79
WP_069960076.1|1492202_1493324_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_012444362.1|1493338_1494145_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_069959785.1|1494149_1495433_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011408007.1|1495459_1495975_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_069959786.1|1495985_1498142_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
WP_011408009.1|1498209_1500207_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|1500225_1500555_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_125168745.1|1500594_1500813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756996.1|1501044_1504509_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_011258270.1|1504911_1505454_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408011.1|1505865_1506774_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_094187763.1|1507119_1507918_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042464653.1|1508061_1508781_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_109181900.1|1508936_1509971_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258276.1|1509991_1510804_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408014.1|1511539_1511923_+	membrane protein	NA	NA	NA	NA	NA
WP_011408015.1|1512045_1513215_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
WP_011408016.1|1513209_1514268_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.1e-71
WP_011408017.1|1514328_1515141_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408018.1|1515656_1516040_+	membrane protein	NA	NA	NA	NA	NA
WP_011408019.1|1516189_1517353_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
WP_011408020.1|1517383_1518196_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408021.1|1518426_1519014_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_011407237.1|1519312_1520269_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_075242217.1|1520342_1521074_+	nitrilase	NA	NA	NA	NA	NA
WP_069960180.1|1521095_1522199_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_011258289.1|1522267_1523671_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408024.1|1523684_1524191_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408025.1|1524596_1525055_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|1525832_1526036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258293.1|1527597_1528083_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|1528310_1528526_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_011408030.1|1528776_1529256_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011408031.1|1529387_1529816_-	cytochrome c	NA	NA	NA	NA	NA
WP_011258297.1|1529888_1530719_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_011408032.1|1530780_1531548_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011258299.1|1531547_1531763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408033.1|1531908_1532700_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258301.1|1532845_1534021_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011408036.1|1536254_1536893_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011258305.1|1537068_1539009_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_011258306.1|1539225_1539780_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_113055181.1|1540001_1541432_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_012444398.1|1541534_1542953_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	3.3e-47
WP_011258309.1|1543369_1544095_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_011408038.1|1544193_1544604_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041182034.1|1544655_1545612_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	1.0e-39
WP_011408040.1|1545855_1548237_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258314.1|1550884_1551295_+	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_011408042.1|1551594_1551777_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258316.1|1551909_1552950_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011258317.1|1553022_1554468_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_011258802.1|1555998_1556967_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408046.1|1557317_1557863_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_011408047.1|1557859_1559323_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011258323.1|1560783_1561038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258324.1|1561440_1561974_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_011258325.1|1561999_1562401_+	membrane protein	NA	NA	NA	NA	NA
WP_011408050.1|1562369_1562750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258326.1|1562746_1562989_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_075242556.1|1563025_1563679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258329.1|1564355_1566260_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_011408052.1|1566523_1568920_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_011408053.1|1569069_1569792_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011258334.1|1572711_1573212_+	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
WP_075241746.1|1573153_1574830_+	serine hydrolase	NA	NA	NA	NA	NA
WP_011258336.1|1574976_1576242_+	potassium transporter	NA	NA	NA	NA	NA
WP_011408056.1|1576300_1577494_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	5.2e-22
WP_011408057.1|1577490_1578180_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_011408058.1|1578285_1579755_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011258340.1|1579774_1580611_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011258341.1|1580636_1581740_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011408060.1|1581736_1584793_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011258343.1|1584858_1585449_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_011258344.1|1585580_1587413_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_094187715.1|1587488_1588252_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181904.1|1588294_1589614_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	1720428	1786289	4867200	transposase,tRNA	Bacillus_phage(20.0%)	42	NA	NA
WP_011257310.1|1720428_1721664_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|1721714_1722478_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069959795.1|1722544_1723921_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	1.1e-58
WP_008578058.1|1724299_1724974_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_011408164.1|1725604_1726009_-	response regulator	NA	NA	NA	NA	NA
WP_011408165.1|1726087_1726585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959808.1|1726723_1728520_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	2.6e-81
WP_011408166.1|1729075_1729621_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_069959809.1|1729722_1733844_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
WP_011408167.1|1734064_1736707_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182063.1|1738148_1739663_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_094187715.1|1739833_1740596_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408171.1|1740907_1741420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408172.1|1741482_1742601_-	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_011408173.1|1742597_1742876_-	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_011408174.1|1742872_1743625_-	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_011258497.1|1743621_1744521_-	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_002812057.1|1744604_1744685_-	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_042464698.1|1744974_1747161_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_042465507.1|1747457_1748900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756949.1|1749232_1751335_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_069959810.1|1751576_1754021_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_011408178.1|1754034_1754559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408179.1|1754758_1756786_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	4.6e-95
WP_011408180.1|1756799_1757519_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011258505.1|1757515_1758430_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	48.5	1.2e-63
WP_011258506.1|1758724_1759600_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_044756943.1|1759596_1760547_-	glutathione synthase	NA	NA	NA	NA	NA
WP_005913706.1|1760796_1761198_+	response regulator	NA	NA	NA	NA	NA
WP_011258508.1|1761215_1761578_+	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
WP_003482487.1|1761577_1762108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258510.1|1762147_1764184_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
WP_069963843.1|1764297_1771224_+	response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
WP_011408184.1|1771231_1772434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258512.1|1772467_1772944_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011258513.1|1773194_1773818_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408185.1|1773829_1774912_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258518.1|1779533_1780598_+	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_011258519.1|1780594_1781326_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011408189.1|1781350_1783309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258521.1|1783450_1784554_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_011408191.1|1785053_1786289_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	1894441	1953838	4867200	protease,transposase	Tupanvirus(18.18%)	52	NA	NA
WP_011408249.1|1894441_1896028_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	6.5e-28
WP_041182078.1|1896208_1897999_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.5	3.5e-22
WP_011258600.1|1898105_1898906_+	signal peptidase I	NA	NA	NA	NA	NA
WP_011258601.1|1898936_1899314_+	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011258602.1|1899303_1899984_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.4	1.7e-17
WP_011258603.1|1899980_1900880_+	GTPase Era	NA	NA	NA	NA	NA
WP_011258604.1|1901103_1901826_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011408250.1|1901974_1902697_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011408251.1|1902855_1904190_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	27.2	1.0e-29
WP_011258607.1|1904364_1904862_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_011257310.1|1904957_1906193_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011408252.1|1906421_1907798_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_041182416.1|1907917_1908601_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_011408254.1|1908617_1909652_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011408255.1|1909832_1911410_+	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	25.6	2.2e-44
WP_011408256.1|1911527_1912532_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_011408257.1|1912531_1913086_+	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011408258.1|1913171_1913924_+	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_003488188.1|1914010_1914217_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_014504008.1|1915727_1916372_-	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_011408263.1|1916361_1918863_-	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_011408264.1|1918859_1920464_-	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	36.6	4.9e-15
WP_011258619.1|1920460_1920694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408265.1|1920690_1921713_-	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_011258621.1|1922049_1922415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408267.1|1922411_1923002_-	cell shape determination protein CcmA	NA	NA	NA	NA	NA
WP_011408268.1|1923099_1924809_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	2.1e-16
WP_011258624.1|1924917_1925244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408269.1|1925473_1925818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408270.1|1925940_1927116_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011258626.1|1927271_1930100_+|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011258627.1|1930160_1931261_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_041182081.1|1931728_1932256_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258629.1|1932657_1932831_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011258630.1|1932991_1933246_-	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258631.1|1933420_1933687_+	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_041182418.1|1933877_1934444_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_109181915.1|1935931_1937251_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258635.1|1937643_1937829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445232.1|1938018_1939395_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_011408277.1|1939534_1940008_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408279.1|1941679_1942729_-	cation transporter	NA	NA	NA	NA	NA
WP_011408280.1|1942843_1943179_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_075239156.1|1943467_1943758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408282.1|1944648_1945767_-	alkene reductase	NA	NA	NA	NA	NA
WP_103057305.1|1945987_1947199_+	MFS transporter	NA	NA	NA	NA	NA
WP_011258643.1|1949121_1949577_+	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_011408284.1|1949850_1950453_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011258645.1|1950488_1951097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258646.1|1951156_1951351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408285.1|1951420_1952791_+	virulence factor family protein	NA	NA	NA	NA	NA
WP_109181916.1|1953075_1953838_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	1969880	2028983	4867200	protease,coat,transposase,tRNA	Acidithiobacillus_phage(25.0%)	44	NA	NA
WP_011258663.1|1969880_1971965_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408302.1|1972189_1972639_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_011408304.1|1973402_1974461_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408305.1|1974731_1976129_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_011408306.1|1976125_1977103_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_113055166.1|1977284_1979222_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258669.1|1979642_1980419_-	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258670.1|1980423_1981098_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_082323429.1|1982728_1984105_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.0e-78
WP_011408311.1|1984144_1984540_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_069959817.1|1984582_1986058_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.5	2.2e-102
WP_128415338.1|1986819_1987272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256646.1|1987285_1987456_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_011258676.1|1991150_1991714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445197.1|1992186_1993530_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_011408316.1|1993670_1994273_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408317.1|1994346_1994793_+	membrane protein	NA	NA	NA	NA	NA
WP_012445196.1|1994870_1995137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258681.1|1997238_1998651_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011258682.1|1998647_1999385_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
WP_042464756.1|1999384_2001565_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258685.1|2002404_2003364_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_011408321.1|2003539_2007130_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
WP_011408322.1|2007587_2008328_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
WP_027703356.1|2008324_2009581_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011258689.1|2009619_2010411_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|2010434_2010896_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_069959820.1|2010892_2011906_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_012445188.1|2012305_2014672_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_011408324.1|2014755_2016102_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011258694.1|2016128_2017319_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_011258695.1|2017321_2018149_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027703358.1|2018145_2018907_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258697.1|2018924_2019482_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011258698.1|2019662_2020385_-	UMP kinase	NA	NA	NA	NA	NA
WP_011408325.1|2020441_2020819_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258700.1|2020946_2021825_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011258701.1|2021994_2022798_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011408326.1|2023173_2023899_-	molecular chaperone	NA	NA	NA	NA	NA
WP_041182086.1|2023901_2024234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258703.1|2024280_2025315_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_011258704.1|2025311_2027663_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011408330.1|2027679_2028450_-	molecular chaperone	NA	NA	NA	NA	NA
WP_011408331.1|2028458_2028983_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 14
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	2080200	2200690	4867200	transposase,tRNA	Ralstonia_phage(17.39%)	90	NA	NA
WP_011408357.1|2080200_2081520_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408358.1|2081854_2082781_-	TolC family protein	NA	NA	NA	NA	NA
WP_011258748.1|2082910_2083516_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408359.1|2083854_2085624_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
WP_027703751.1|2085620_2086223_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	4.8e-16
WP_011258751.1|2086481_2087075_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
WP_011258752.1|2087273_2088710_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
WP_011258753.1|2088951_2090154_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_011258754.1|2090196_2093025_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_011408361.1|2093205_2094138_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408362.1|2094134_2095634_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_012445146.1|2095644_2095821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182090.1|2095971_2096235_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011258758.1|2096514_2097015_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_011258759.1|2097256_2098624_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_109181925.1|2101647_2102410_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408367.1|2103862_2105266_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_042464794.1|2105388_2105811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258770.1|2106443_2107280_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_075242602.1|2107289_2108276_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011258772.1|2108272_2109148_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_011408371.1|2109144_2109507_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042464800.1|2109509_2109758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408372.1|2109893_2110451_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_027703707.1|2110542_2111508_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408374.1|2111533_2112883_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
WP_011258777.1|2112875_2113112_+	protein SlyX	NA	NA	NA	NA	NA
WP_042464803.1|2113112_2113865_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_042464805.1|2114198_2115044_+	transporter	NA	NA	NA	NA	NA
WP_041182423.1|2115184_2116360_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011408378.1|2116373_2117684_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011408379.1|2117680_2118667_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011408380.1|2118663_2119869_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_011408381.1|2120255_2123009_-	methionine synthase	NA	NA	NA	NA	NA
WP_103057265.1|2123151_2124291_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
WP_011258786.1|2124287_2125283_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_011408383.1|2125371_2126553_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464808.1|2126552_2126693_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464810.1|2127064_2128510_+	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
WP_011258790.1|2129076_2131605_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
WP_109181926.1|2131815_2132614_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258793.1|2133684_2134452_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_011408388.1|2134453_2134801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|2134959_2135928_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109181928.1|2137280_2138246_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2138690_2139875_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011408398.1|2139929_2141405_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
WP_011258799.1|2141726_2141909_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_011258800.1|2142057_2143257_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_011258802.1|2144117_2145086_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258803.1|2145277_2146246_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_109181933.1|2147422_2148525_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
WP_027704061.1|2148711_2149179_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408403.1|2149539_2150199_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258822.1|2150310_2151660_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_094187728.1|2151809_2152608_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408404.1|2153047_2154367_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407175.1|2154579_2155548_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011408405.1|2155611_2156196_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_011258825.1|2156295_2157309_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153296745.1|2157999_2158272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082336051.1|2158678_2162278_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_011408408.1|2162417_2162717_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_042464821.1|2162720_2162915_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_115840382.1|2163183_2166906_-	avirulence protein	NA	NA	NA	NA	NA
WP_115840383.1|2170173_2174301_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408412.1|2174589_2175909_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464827.1|2177740_2178826_-	peptidase C13	NA	NA	NA	NA	NA
WP_011408416.1|2179153_2179852_-	acireductone synthase	NA	NA	NA	NA	NA
WP_011408417.1|2179854_2180421_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_011408418.1|2180432_2181110_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_069959832.1|2181198_2182629_-	amino acid permease	NA	NA	NA	NA	NA
WP_033013325.1|2182705_2184178_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258841.1|2184323_2184911_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011258842.1|2185066_2186308_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
WP_011258843.1|2186516_2187935_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011408424.1|2187969_2188269_+	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_011258845.1|2188265_2190137_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_041182103.1|2190426_2191440_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011258848.1|2191439_2191871_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011258849.1|2191867_2192470_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_011408426.1|2192462_2194400_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011258851.1|2194568_2195039_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011258852.1|2195035_2195206_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011408427.1|2195202_2195955_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_011258853.1|2196049_2196745_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_011408428.1|2196741_2197386_-	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
WP_011408429.1|2197612_2198761_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011408430.1|2198900_2199704_+	amidohydrolase	NA	NA	NA	NA	NA
WP_109181928.1|2199724_2200690_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	2256251	2386174	4867200	protease,transposase,tRNA	Staphylococcus_prophage(15.79%)	103	NA	NA
WP_011258902.1|2256251_2256764_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	40.4	2.9e-06
WP_011258903.1|2256836_2257421_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	36.2	9.1e-20
WP_011258904.1|2257632_2258619_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011258905.1|2258618_2261012_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	2.0e-174
WP_011408465.1|2261153_2261975_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_011258907.1|2262180_2262690_+	DUF1249 domain-containing protein	NA	NA	NA	NA	NA
WP_041182110.1|2262774_2263263_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_075240038.1|2263659_2263851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959840.1|2263971_2264379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258803.1|2264554_2265523_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_109181940.1|2265619_2266939_+|transposase	IS701-like element ISXo15 family transposase	transposase	NA	NA	NA	NA
WP_011258910.1|2267480_2268239_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_011408468.1|2268371_2268986_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_012444981.1|2269041_2270268_+	class III poly(R)-hydroxyalkanoic acid synthase subunit PhaE	NA	NA	NA	NA	NA
WP_011258913.1|2270264_2271341_+	class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC	NA	NA	NA	NA	NA
WP_011258914.1|2271455_2271653_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_011408470.1|2271793_2272138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258915.1|2272095_2273307_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011408471.1|2273496_2273724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959841.1|2273826_2276187_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_011258919.1|2277508_2278075_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011408473.1|2278071_2279298_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011258921.1|2279418_2280684_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_011258922.1|2280664_2281402_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011258923.1|2281542_2282706_-	MFS transporter	NA	NA	NA	NA	NA
WP_041182113.1|2282868_2283825_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	2.4e-41
WP_012444969.1|2284384_2284519_-	aspartate racemase	NA	NA	NA	NA	NA
WP_012444967.1|2284709_2285621_-	DMT family transporter	NA	NA	NA	NA	NA
WP_011408479.1|2285614_2286667_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_011258927.1|2286663_2287719_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_011408480.1|2287724_2288492_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408481.1|2288494_2288779_-	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_011258930.1|2289367_2290900_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011408482.1|2292203_2294711_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_011258933.1|2294707_2295676_+	homoserine kinase	NA	NA	NA	NA	NA
WP_024710669.1|2298611_2298926_-	EthD family reductase	NA	NA	NA	NA	NA
WP_011258935.1|2299087_2300392_+	threonine synthase	NA	NA	NA	NA	NA
WP_041182115.1|2300494_2301238_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_012444952.1|2302502_2303915_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
WP_094187798.1|2304420_2305219_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258940.1|2305532_2305859_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258941.1|2305868_2306783_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258942.1|2306779_2308075_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_012444927.1|2310338_2310515_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011408520.1|2310511_2311183_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_125168753.1|2312208_2312454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|2312437_2313394_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258802.1|2313808_2314777_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_041182129.1|2314921_2315887_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182130.1|2315864_2319965_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011408522.1|2320273_2321458_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_041182131.1|2321508_2322408_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
WP_011408524.1|2322574_2323081_+	glyoxalase	NA	NA	NA	NA	NA
WP_011258968.1|2323555_2324188_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011258969.1|2324187_2326044_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011258970.1|2326040_2327459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258971.1|2327482_2327947_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_011258972.1|2327943_2328723_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258973.1|2329014_2330055_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258974.1|2330051_2331821_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258975.1|2331817_2332282_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011408526.1|2332285_2332948_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011408527.1|2332976_2335385_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_109181948.1|2335638_2336604_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258980.1|2337997_2338732_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_010378794.1|2338724_2339966_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014503500.1|2339989_2340442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408531.1|2340392_2340641_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_011408532.1|2340751_2341534_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_012444910.1|2341550_2341760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258983.1|2341763_2343554_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_011258984.1|2343588_2343975_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_011258985.1|2343971_2344367_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_012444907.1|2344426_2344693_-	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_011408533.1|2344636_2345509_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_011258986.1|2345637_2346735_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408534.1|2347164_2348595_+	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258988.1|2348591_2349599_+	glucokinase	NA	NA	NA	NA	NA
WP_011258989.1|2349595_2350315_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011258990.1|2350417_2352334_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011408535.1|2352389_2353049_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_027703995.1|2354675_2354879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258994.1|2355894_2356275_+	response regulator	NA	NA	NA	NA	NA
WP_011408539.1|2356489_2359885_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_094187715.1|2361450_2362213_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408544.1|2364108_2364342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259000.1|2364508_2365483_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.6	2.0e-19
WP_075242412.1|2366246_2367128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408549.1|2368828_2369962_+	phospholipase A	NA	NA	NA	NA	NA
WP_011408550.1|2370390_2370843_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011259006.1|2371161_2372679_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_011259007.1|2373012_2374893_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.0	2.3e-24
WP_011408551.1|2375081_2375861_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011259009.1|2376011_2376497_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_027703343.1|2378953_2379193_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_011259011.1|2379444_2380158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259013.1|2381682_2382183_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_044757420.1|2382344_2382923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259015.1|2383014_2383515_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259016.1|2383581_2384415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408556.1|2384465_2384780_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259018.1|2384963_2385152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408557.1|2385565_2386174_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 16
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	2476287	2524383	4867200	transposase,tRNA	Moumouvirus(16.67%)	44	NA	NA
WP_011408598.1|2476287_2477682_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	7.6e-81
WP_011259080.1|2477683_2477941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408599.1|2477937_2478243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408600.1|2478239_2478566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408603.1|2479292_2479955_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_024744799.1|2480043_2480574_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_011408606.1|2482797_2484069_+	kynureninase	NA	NA	NA	NA	NA
WP_011408607.1|2484240_2485608_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011259089.1|2485911_2487357_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_011259090.1|2487353_2488040_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_011259091.1|2488012_2489032_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011259092.1|2489073_2489634_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_011259093.1|2489654_2490611_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_011408609.1|2490778_2491555_-	NAD kinase	NA	NA	NA	NA	NA
WP_011408610.1|2492038_2494174_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_027703372.1|2494170_2494362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259098.1|2496136_2496643_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259099.1|2496683_2497211_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408612.1|2497207_2497699_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_011408613.1|2497722_2498298_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011259101.1|2498374_2499328_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259102.1|2499416_2500289_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011408616.1|2500285_2501131_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_011408617.1|2501243_2501942_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408618.1|2502105_2502888_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408619.1|2502896_2503277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259107.1|2503273_2503984_+	endonuclease III	NA	NA	NA	NA	NA
WP_011408621.1|2505294_2505843_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_011258803.1|2506014_2506983_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011408623.1|2507587_2508823_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_041182144.1|2509386_2509707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259109.1|2510046_2511297_+	porin	NA	NA	NA	NA	NA
WP_011408625.1|2511485_2512505_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.7	1.6e-48
WP_011408626.1|2512692_2513784_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_069959864.1|2513896_2514871_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_069959865.1|2514870_2515740_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259114.1|2515762_2516593_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011408630.1|2516721_2517432_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011259116.1|2517564_2517972_+	RcnB family protein	NA	NA	NA	NA	NA
WP_011259117.1|2518255_2518891_+	ribonuclease T	NA	NA	NA	NA	NA
WP_011408631.1|2518961_2520281_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464912.1|2520517_2521579_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2521629_2522814_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181954.1|2523063_2524383_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	2531102	2603429	4867200	protease,transposase,tRNA	uncultured_Mediterranean_phage(33.33%)	53	NA	NA
WP_011259125.1|2531102_2532248_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_027703908.1|2532317_2533388_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259127.1|2533574_2534006_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408638.1|2534129_2535626_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011259129.1|2535970_2536678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259140.1|2540053_2541175_-	phytase	NA	NA	NA	NA	NA
WP_041182147.1|2543447_2543915_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011259142.1|2544065_2544698_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_094187715.1|2545094_2545857_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259143.1|2546137_2547169_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408648.1|2547175_2548969_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_012444765.1|2548965_2549250_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_027703974.1|2549481_2549979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259147.1|2550025_2550532_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_011259148.1|2550528_2551149_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011408651.1|2551389_2553294_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_109181955.1|2553381_2554439_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_109181956.1|2554536_2555856_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239722.1|2556089_2557247_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_109181957.1|2557523_2558489_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181958.1|2558466_2559942_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
WP_162013043.1|2559977_2560184_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2561758_2562727_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011257031.1|2563641_2564610_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_075245207.1|2564877_2565111_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011259163.1|2566991_2568212_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011259164.1|2568526_2569924_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011408657.1|2569934_2571152_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259166.1|2571151_2571790_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011259167.1|2571860_2572721_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011408658.1|2572717_2573506_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011259169.1|2573516_2574722_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002812972.1|2574740_2575166_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259170.1|2575385_2576018_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259171.1|2576042_2578415_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259172.1|2578572_2579778_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011259173.1|2580098_2581430_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
WP_011408659.1|2581426_2581777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|2581808_2582216_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011259175.1|2582212_2582539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259176.1|2582570_2583947_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
WP_011259177.1|2584183_2588350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703232.1|2588462_2589134_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011259179.1|2589198_2591127_-	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011259180.1|2591289_2593650_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_011259181.1|2593933_2594902_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011408662.1|2594959_2596081_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_042465566.1|2597508_2598261_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002813418.1|2598341_2598560_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011259186.1|2598840_2601123_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	8.7e-175
WP_005914463.1|2601266_2601587_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_011408665.1|2601837_2602296_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011259189.1|2602292_2603429_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 18
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	2685167	2710805	4867200	transposase	Bacillus_phage(50.0%)	13	NA	NA
WP_115801909.1|2685167_2686487_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|2686636_2687605_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_125168757.1|2689229_2689709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259260.1|2697833_2698226_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259261.1|2698234_2698696_+	cytochrome c	NA	NA	NA	NA	NA
WP_153296779.1|2699116_2699515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115801893.1|2701218_2702184_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_082323190.1|2702190_2703489_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408708.1|2703657_2705343_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
WP_075239845.1|2705339_2707076_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	8.2e-16
WP_082325289.1|2707675_2708632_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.8e-41
WP_011259267.1|2709434_2709698_+	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_115840191.1|2709839_2710805_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	2727689	2788285	4867200	protease,transposase,tRNA	Moumouvirus(10.0%)	53	NA	NA
WP_012444736.1|2727689_2729114_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_011408724.1|2729611_2730049_+	SufE family protein	NA	NA	NA	NA	NA
WP_011259287.1|2730045_2731296_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259288.1|2731363_2732425_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_075242610.1|2732567_2733608_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_011408727.1|2733692_2733980_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_011408728.1|2733976_2735326_+	dihydroorotase	NA	NA	NA	NA	NA
WP_011408729.1|2735325_2736165_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.4e-13
WP_094187715.1|2737063_2737826_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259294.1|2737852_2738116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444728.1|2738487_2738976_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_011408734.1|2739199_2740519_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2740655_2741624_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181979.1|2741823_2743140_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444725.1|2743499_2744681_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_011259303.1|2746269_2747940_+	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
WP_011259304.1|2748156_2748846_-	phytoene synthase	NA	NA	NA	NA	NA
WP_011408736.1|2748874_2749579_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_011259306.1|2749652_2750372_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_027703270.1|2750402_2751740_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_041182450.1|2751759_2752563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002802373.1|2752754_2753321_-	elongation factor P	NA	NA	NA	NA	NA
WP_011408738.1|2753422_2754451_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_011259310.1|2754669_2756787_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011259311.1|2756783_2757713_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011408739.1|2757764_2758529_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_011408740.1|2758647_2759481_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_011259314.1|2759733_2760345_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	69.8	1.1e-79
WP_011259315.1|2760599_2761040_+	ribonuclease	NA	NA	NA	NA	NA
WP_011259316.1|2761036_2761462_+	barstar family protein	NA	NA	NA	NA	NA
WP_011259317.1|2761910_2763806_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.8	1.4e-48
WP_103057284.1|2763895_2765272_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	2.1e-54
WP_011259319.1|2765374_2765935_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.2	1.6e-29
WP_011408741.1|2766032_2767589_-	YdiU family protein	NA	NA	NA	NA	NA
WP_011408742.1|2767872_2768748_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408743.1|2768948_2769647_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011408744.1|2769817_2770027_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	62.3	2.8e-16
WP_011408745.1|2770296_2770782_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_011259325.1|2770852_2771401_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_011259326.1|2771397_2772579_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012444707.1|2772802_2774872_+	GGDEF and EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011259328.1|2774971_2775850_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_011259329.1|2775947_2776847_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011408747.1|2776934_2777675_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011259331.1|2777834_2778410_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408749.1|2778583_2779555_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_011408750.1|2779588_2780530_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259334.1|2780529_2782407_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_012444702.1|2782544_2784278_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_011259336.1|2784330_2784831_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_075243426.1|2784827_2786315_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_069959886.1|2786339_2787407_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_094187715.1|2787521_2788285_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	2791480	2877342	4867200	protease,transposase,tRNA	Bacillus_phage(18.18%)	58	NA	NA
WP_094187754.1|2791480_2792228_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182165.1|2792544_2794380_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
WP_041182166.1|2794651_2795743_+	ribonuclease D	NA	NA	NA	NA	NA
WP_011259345.1|2796835_2797237_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_015463309.1|2798100_2798280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004541336.1|2798423_2798621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703932.1|2798881_2799172_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011408759.1|2799159_2799438_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_080256628.1|2799922_2800111_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408760.1|2800883_2802068_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_109181928.1|2802648_2803614_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042465594.1|2808178_2808523_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_011408764.1|2808733_2809060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259352.1|2809092_2809533_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
WP_011259353.1|2809611_2810247_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_011259354.1|2810640_2811399_-	cytochrome c1	NA	NA	NA	NA	NA
WP_011259355.1|2811391_2812651_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_011259356.1|2812650_2813295_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011259357.1|2813824_2814811_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_011408766.1|2816746_2818201_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011408767.1|2818624_2819611_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_011259362.1|2820022_2820685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259363.1|2820739_2821225_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011408769.1|2821224_2821743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408770.1|2821837_2822716_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011259366.1|2822712_2823993_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011259367.1|2824008_2825010_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_011408772.1|2825161_2826526_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011408773.1|2826780_2827191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408774.1|2827346_2828177_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075240820.1|2828490_2829738_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011408777.1|2829883_2831377_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408778.1|2831381_2832968_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408779.1|2832964_2834167_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_115840172.1|2834673_2836062_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408781.1|2836295_2837681_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_011259377.1|2838588_2839968_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_011408783.1|2839967_2841284_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011259379.1|2841366_2842665_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	2.7e-19
WP_011408784.1|2842972_2844253_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_011408785.1|2844558_2844837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259381.1|2844826_2847175_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_011259382.1|2847171_2848017_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_069964545.1|2848023_2849733_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_075242096.1|2849875_2850058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182012.1|2850090_2850853_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259384.1|2851078_2852431_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011408787.1|2852491_2855629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408788.1|2855795_2856650_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
WP_011408789.1|2856820_2858125_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_011408790.1|2858266_2862361_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.1e-55
WP_011259389.1|2862394_2863381_+	response regulator	NA	W8CYM9	Bacillus_phage	26.8	2.8e-05
WP_011408791.1|2863505_2864489_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.4e-97
WP_011408792.1|2864937_2869962_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_011408793.1|2870239_2870899_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408794.1|2870913_2872218_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259395.1|2872230_2875401_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_109181969.1|2876376_2877342_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	2886364	2961009	4867200	transposase	uncultured_Caudovirales_phage(53.33%)	49	NA	NA
WP_011407587.1|2886364_2887399_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011258802.1|2887812_2888781_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_069959892.1|2889075_2891421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182891.1|2891438_2892170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325293.1|2892201_2894544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|2894568_2895297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959894.1|2895325_2897668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465604.1|2897692_2898436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115840173.1|2898466_2901301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964550.1|2901297_2902227_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069964551.1|2902235_2904998_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.2	1.5e-43
WP_041182637.1|2909882_2910272_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_157724569.1|2910432_2911386_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|2911318_2911633_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_011408815.1|2911860_2913180_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259409.1|2914284_2914701_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_011259410.1|2914697_2915144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259411.1|2915386_2916022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|2916521_2917490_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258802.1|2918068_2919037_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_125168758.1|2919306_2919807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465618.1|2920115_2923217_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042465003.1|2924206_2924659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756758.1|2924913_2926719_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_125168759.1|2926720_2927068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756757.1|2927143_2927851_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	8.4e-52
WP_011408825.1|2928002_2928395_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011408826.1|2928441_2928933_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703781.1|2928929_2929283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259417.1|2929371_2930112_+	flagellar motor protein	NA	NA	NA	NA	NA
WP_011408827.1|2930118_2931093_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_011259419.1|2931094_2931877_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_042465006.1|2931873_2932896_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259421.1|2932996_2933305_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_002806565.1|2933301_2933667_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011408829.1|2933700_2935710_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011408830.1|2935877_2936132_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075242680.1|2937810_2938500_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.3	8.3e-12
WP_011408833.1|2938815_2939577_+	transporter	NA	NA	NA	NA	NA
WP_011408834.1|2939590_2941933_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	4.5e-09
WP_115840174.1|2942429_2943395_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_044756755.1|2943634_2945881_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	2.9e-13
WP_042465628.1|2946609_2948721_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.2e-14
WP_069959907.1|2949405_2951481_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.3e-12
WP_011259431.1|2952073_2954335_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
WP_011408839.1|2954728_2956990_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_011408840.1|2957959_2958745_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_011408841.1|2958880_2959363_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_094187763.1|2960211_2961009_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	3040184	3051959	4867200	tRNA	Escherichia_phage(22.22%)	12	NA	NA
WP_011259503.1|3040184_3040484_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
WP_011259504.1|3040526_3040757_-	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259505.1|3041000_3041750_-	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011408881.1|3041754_3042450_-	hypothetical protein	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_012444559.1|3042635_3042935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113055152.1|3043322_3043850_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	57.4	1.5e-34
WP_003481884.1|3044452_3044665_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_011259507.1|3044804_3047453_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_012444556.1|3047554_3048043_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011408884.1|3048345_3049380_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_011408885.1|3049552_3050194_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408886.1|3050282_3051959_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 23
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	3092276	3171469	4867200	plate,transposase	Xanthomonas_phage(44.44%)	57	NA	NA
WP_011407237.1|3092276_3093233_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011259549.1|3093331_3094444_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_041182180.1|3094440_3095571_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011408908.1|3095692_3096391_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027703449.1|3096387_3097623_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_011259553.1|3097635_3098478_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011259554.1|3098758_3099610_-	chain-length determining protein	NA	NA	NA	NA	NA
WP_042465636.1|3099655_3100789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259555.1|3100785_3101736_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011408910.1|3101732_3102986_-	O-antigen translocase	NA	NA	NA	NA	NA
WP_011408911.1|3102982_3104095_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	28.4	1.4e-29
WP_011408912.1|3104094_3105027_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408913.1|3105013_3105967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408914.1|3105970_3106642_-	acetyltransferase	NA	NA	NA	NA	NA
WP_011408915.1|3106638_3107070_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_041182464.1|3107464_3107995_+	cytochrome-c oxidase	NA	NA	NA	NA	NA
WP_012444527.1|3108078_3109419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408918.1|3109444_3109837_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_033013216.1|3110279_3111068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408920.1|3111131_3111713_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012444524.1|3111709_3112366_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_011259567.1|3112362_3113688_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	39.2	2.4e-23
WP_011259568.1|3113698_3114457_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_011408923.1|3114453_3114660_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011259569.1|3114656_3115127_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011408924.1|3115190_3117179_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011259571.1|3117175_3117718_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_027703454.1|3117717_3118215_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011408926.1|3118214_3118919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959916.1|3119127_3122847_+	avirulence protein	NA	NA	NA	NA	NA
WP_042464821.1|3123115_3123310_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011408408.1|3123313_3123613_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_011408929.1|3123836_3128288_+	avirulence protein	NA	NA	NA	NA	NA
WP_012444931.1|3128556_3128751_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
WP_011408408.1|3128754_3129054_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_115840176.1|3129277_3133927_+	avirulence protein	NA	NA	NA	NA	NA
WP_012444515.1|3134989_3136465_-|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	5.4e-101
WP_011408934.1|3136547_3139136_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011259580.1|3139192_3140305_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259581.1|3140429_3141008_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042465046.1|3142494_3144582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959920.1|3144967_3146065_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_113055222.1|3146481_3149562_+	histidine kinase	NA	NA	NA	NA	NA
WP_033013236.1|3152597_3153305_+	response regulator	NA	NA	NA	NA	NA
WP_011259588.1|3153301_3154294_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259589.1|3154290_3156750_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_011259590.1|3156863_3157844_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408942.1|3157852_3158881_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_109181977.1|3159047_3159845_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115840384.1|3159907_3160705_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408943.1|3160765_3161092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408944.1|3161088_3163992_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_011408945.1|3163988_3164711_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011408946.1|3164707_3165355_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_011408947.1|3165351_3168810_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011408948.1|3168813_3170130_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_011408949.1|3170131_3171469_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 24
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	3180432	3251085	4867200	plate,transposase	Ralstonia_phage(71.43%)	52	NA	NA
WP_011408954.1|3180432_3181443_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011259602.1|3181406_3183284_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259603.1|3183287_3183791_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011259604.1|3183778_3184612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259605.1|3184647_3185151_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_027703472.1|3185250_3186765_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_024711387.1|3186757_3187264_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011257031.1|3188622_3189591_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_069964543.1|3189726_3191043_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260830.1|3191213_3192449_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3192634_3193603_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408960.1|3193654_3195571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259611.1|3195595_3196333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408961.1|3196363_3198706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465640.1|3198723_3199470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465052.1|3199498_3202333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465054.1|3202990_3204820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445381.1|3204833_3205433_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_012445382.1|3205520_3205877_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_012445383.1|3205873_3206296_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408967.1|3206311_3206545_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_069960235.1|3206571_3206832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704270.1|3207180_3208965_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_027704269.1|3208997_3209984_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_042465057.1|3210394_3214108_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_094187765.1|3214633_3215397_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445389.1|3215500_3216148_-	response regulator	NA	NA	NA	NA	NA
WP_011408973.1|3216369_3217131_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011258802.1|3217288_3218257_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408974.1|3218390_3218756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408975.1|3218814_3219246_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011259625.1|3219257_3220520_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408976.1|3220503_3221796_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011408977.1|3222165_3222936_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011259629.1|3223692_3224928_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011408979.1|3226227_3226485_-	stress-induced protein	NA	NA	NA	NA	NA
WP_011408980.1|3226924_3227908_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011258802.1|3228223_3229192_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408981.1|3229320_3230283_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_153296740.1|3230532_3230691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182195.1|3230722_3230902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|3231266_3232232_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408985.1|3233439_3234417_+	siroheme synthase	NA	NA	NA	NA	NA
WP_042465070.1|3235225_3235420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408987.1|3236813_3237176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408988.1|3237159_3237729_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_011259640.1|3237766_3239020_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011408989.1|3239225_3239603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408991.1|3241531_3242767_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|3243604_3244639_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011408994.1|3245314_3247690_-	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
WP_115840390.1|3249900_3251085_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	8.5e-41
>prophage 25
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	3385749	3446125	4867200	protease,transposase,tRNA	Burkholderia_virus(14.29%)	49	NA	NA
WP_094187736.1|3385749_3386513_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259756.1|3387536_3389903_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011409066.1|3389899_3390574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259758.1|3390783_3391722_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011259759.1|3391844_3393194_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259760.1|3393190_3394078_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011409067.1|3394395_3395202_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011259762.1|3395647_3396865_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011409068.1|3396970_3397939_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
WP_011259764.1|3398281_3398950_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_011259765.1|3398946_3399720_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_075241401.1|3400293_3402246_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|3402926_3403952_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409070.1|3404036_3405110_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259771.1|3405102_3406206_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_011259772.1|3406216_3407143_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011259773.1|3407223_3407874_+	SCO family protein	NA	NA	NA	NA	NA
WP_027703264.1|3407870_3408719_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_041182211.1|3409269_3410853_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_103057205.1|3412275_3413493_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_103057775.1|3413453_3413690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409076.1|3413851_3414358_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_011259780.1|3414479_3415880_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_012445553.1|3416142_3416718_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011409078.1|3416714_3417149_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259783.1|3418058_3418244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|3418278_3418848_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259785.1|3418940_3419792_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259787.1|3421179_3423195_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445555.1|3423465_3424164_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409081.1|3424204_3424612_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_011409082.1|3425049_3426012_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409084.1|3427295_3428546_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011409085.1|3428553_3429798_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011259794.1|3430025_3430505_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027704197.1|3430615_3431152_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259796.1|3431261_3432011_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_011259797.1|3432218_3432710_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011409088.1|3433823_3435143_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_069963877.1|3435286_3436993_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011409090.1|3437026_3438331_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259802.1|3438362_3438623_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011409091.1|3438624_3439500_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027704198.1|3441334_3441799_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|3441850_3442039_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_069963878.1|3442011_3442332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465665.1|3442328_3443696_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011409095.1|3443841_3444423_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_011259808.1|3444679_3446125_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 26
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	3465225	3513927	4867200	integrase,transposase,tRNA	Ralstonia_phage(33.33%)	37	3488044:3488103	3504714:3505377
WP_011409106.1|3465225_3467868_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_011259826.1|3467940_3468552_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011409107.1|3468756_3469614_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011409108.1|3469869_3470319_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_109181928.1|3470618_3471584_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3471708_3472471_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704065.1|3473081_3473375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259829.1|3473848_3474082_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_011409111.1|3474115_3475129_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259831.1|3475096_3475288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801901.1|3475378_3476698_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182217.1|3476785_3478000_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_011259834.1|3478145_3478673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115840178.1|3478669_3479635_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187771.1|3479875_3480638_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409116.1|3480940_3483073_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011258529.1|3483623_3484592_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011257031.1|3484783_3485752_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_115840192.1|3485896_3486862_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_048488802.1|3486908_3487241_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|3487237_3488001_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
3488044:3488103	attL	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTC	NA	NA	NA	NA
WP_094187763.1|3488872_3489670_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409118.1|3489703_3490096_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_027704094.1|3490186_3490579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239728.1|3492917_3493337_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
WP_012445601.1|3495053_3496838_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_011259851.1|3497028_3497229_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011409125.1|3497764_3498559_+	thiazole synthase	NA	NA	NA	NA	NA
WP_011259853.1|3498860_3499619_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011259854.1|3499694_3501557_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_011409127.1|3501614_3501956_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259856.1|3502215_3502491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409129.1|3505537_3506251_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
3504714:3505377	attR	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTCAGCACAAGCCCAAACGCGGATGACGGCGTACAACGGCGGCCACACGCAGCTGGGTGCCGGAGGAGTTGCGGATTGTGCATCGCCCCGAAGAAGTGCAGACGCGCTTGGTCCCAGGTCATTGGGAAGGCGACTTGATCAAGGGCGCATTCAATCGTTCTTGCGTGGGCACGTTGGTGGAACGCAAGACGCGCTTTGTCGTGCTGTGCCGCATGGATGGCTGCACGGCCGCAGATGCGCTGGAAGGGTTTACCCGGCAAATGAAGAAACTGCCGGCCTCAATGCGGACAAGTCTGACCTACGATCGCGGTACCGAGCTCACGTGCTACGCCGAGCTGATGCAAGGATTGAACATCGACGTGTGGTTCGCTGATCCACATGCGCCGTGGCAGCGGGGAAGTAACGAGAACACCAACGGCCTGCTGCGCCAATTCCTGCCCAAGGGCGCCGACCTGTCCACTGTCAGCCAAGAGTATCTCAATCACATCGCACTGCTGATGAATACCCGCCCTCGTCAGACGCTCGGATGGAAGACACCAAGCGAGGCAATGGAGGAAGAAATCGCAGCACTCAAATCACGTGTTGCACTTGAATCTTGAGACTGCCC	NA	NA	NA	NA
WP_012445603.1|3506311_3506734_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_094187715.1|3506865_3507629_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409134.1|3510702_3511614_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_115801902.1|3512961_3513927_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	3561377	3603316	4867200	transposase	Ralstonia_phage(44.44%)	29	NA	NA
WP_011407175.1|3561377_3562346_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407587.1|3563366_3564401_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011259895.1|3564784_3565510_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409154.1|3565641_3566103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704153.1|3569549_3571670_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_027704154.1|3571936_3572782_-	transporter	NA	NA	NA	NA	NA
WP_011257031.1|3573773_3574742_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011259903.1|3575066_3577037_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_011259904.1|3577465_3578863_+	endoproteinase ArgC	NA	NA	NA	NA	NA
WP_027704156.1|3578975_3579794_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011259907.1|3580104_3583356_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	6.1e-81
WP_011259908.1|3583537_3584956_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_011259909.1|3584965_3585616_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011409164.1|3585617_3586223_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
WP_011259911.1|3586372_3586594_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409165.1|3586603_3587029_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
WP_094187731.1|3587520_3588318_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409167.1|3589395_3590175_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409168.1|3590389_3591019_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027704159.1|3591079_3591835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182227.1|3592163_3592940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182229.1|3593348_3594923_+	protein kinase	NA	NA	NA	NA	NA
WP_011409172.1|3595171_3595438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409173.1|3595716_3598896_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.3	1.2e-73
WP_115840385.1|3598961_3599930_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.3e-100
WP_011409174.1|3600055_3600730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409175.1|3600729_3601476_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_075243738.1|3601472_3602282_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011258803.1|3602347_3603316_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
>prophage 28
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	3619580	3691822	4867200	plate,transposase	Ralstonia_phage(33.33%)	46	NA	NA
WP_069970072.1|3619580_3620537_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_082325322.1|3620511_3622950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182737.1|3622861_3623893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325323.1|3623901_3625839_-	DUF3784 domain-containing protein	NA	NA	NA	NA	NA
WP_011409194.1|3625750_3626770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325324.1|3626774_3628718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325325.1|3628629_3629652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409198.1|3631623_3632649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325327.1|3632652_3635520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465165.1|3635538_3636384_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_082325328.1|3636385_3639148_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	9.6e-43
WP_011259938.1|3639240_3639594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259939.1|3639624_3642354_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_011259940.1|3642439_3643531_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_069959967.1|3643494_3645330_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011409203.1|3645332_3645821_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003467612.1|3645968_3646466_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011409204.1|3646607_3648104_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467601.1|3648107_3648608_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_033005590.1|3648654_3649143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409206.1|3649529_3650138_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011409207.1|3650289_3651624_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011409208.1|3651623_3652412_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_109182112.1|3652518_3655140_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_075242365.1|3655136_3656114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168764.1|3656088_3656664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082325331.1|3656672_3658841_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011259950.1|3658865_3661760_+	calcium-binding protein	NA	A0A2D1GNI0	Pseudomonas_phage	27.5	7.5e-06
WP_011409552.1|3662415_3663378_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011259951.1|3663674_3665108_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011258802.1|3666872_3667841_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_129215583.1|3668501_3669047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082323406.1|3669088_3671341_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_080493944.1|3671400_3672885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182240.1|3673540_3674755_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	2.4e-54
WP_011259955.1|3674781_3675321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182241.1|3675429_3675735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113233861.1|3675731_3676811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075240702.1|3677795_3678584_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011259961.1|3680968_3681358_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_103067797.1|3681338_3683501_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011409212.1|3683569_3684166_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_041182243.1|3684158_3684983_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069963892.1|3684979_3687649_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.3	6.6e-41
WP_011258188.1|3688563_3689532_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258802.1|3690853_3691822_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 29
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	4058485	4153609	4867200	transposase	Ralstonia_phage(17.65%)	66	NA	NA
WP_115840193.1|4058485_4060093_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075242322.1|4060254_4060518_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_075242321.1|4060522_4061182_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
WP_011260279.1|4061368_4062733_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_011409411.1|4062948_4063644_+	VIT family protein	NA	NA	NA	NA	NA
WP_011409413.1|4064590_4065214_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011260283.1|4065358_4066156_+	cytochrome c4	NA	NA	NA	NA	NA
WP_011409415.1|4066249_4066900_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260284.1|4066991_4067807_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011409416.1|4067856_4068594_+	endonuclease	NA	NA	NA	NA	NA
WP_011409419.1|4070522_4071512_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_041182588.1|4071634_4074208_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_109182012.1|4074400_4075163_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|4075236_4076205_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011409421.1|4076938_4077205_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094187728.1|4078136_4078935_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|4080581_4081814_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_011409423.1|4081853_4082816_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|4082991_4083948_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258802.1|4084159_4085128_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187715.1|4085463_4086226_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182027.1|4089636_4090602_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012444134.1|4091063_4091294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409428.1|4091918_4093961_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_011409429.1|4093962_4095861_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011260297.1|4095862_4097116_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_011260298.1|4097112_4097718_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_011409430.1|4098137_4099292_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_011260300.1|4099294_4100323_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_011409431.1|4100319_4101396_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260302.1|4101436_4102714_-	sugar MFS transporter	NA	NA	NA	NA	NA
WP_011409432.1|4102758_4103526_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409433.1|4103740_4104907_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_011260306.1|4107450_4110348_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
WP_011409436.1|4110498_4113189_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409437.1|4113470_4114427_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.6e-42
WP_011409439.1|4114917_4116153_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_103057228.1|4117588_4118773_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011409442.1|4118840_4119578_+	pteridine reductase	NA	NA	NA	NA	NA
WP_011260313.1|4119746_4120262_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011260314.1|4120353_4121856_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
WP_011260315.1|4121859_4122300_-	response regulator	NA	NA	NA	NA	NA
WP_011409443.1|4122296_4124108_-	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
WP_011260317.1|4124393_4124765_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_011260318.1|4124915_4125968_+	oxidoreductase	NA	NA	NA	NA	NA
WP_011260319.1|4126307_4127249_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
WP_075239460.1|4127269_4128607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409446.1|4128778_4129159_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_012444115.1|4129283_4130045_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_011409450.1|4132293_4133697_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.5	8.1e-131
WP_011260326.1|4133819_4134875_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.3e-80
WP_103057229.1|4135047_4135902_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011260328.1|4136193_4138377_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.6	2.8e-82
WP_011260329.1|4138875_4139970_-	type II restriction enzyme	NA	NA	NA	NA	NA
WP_041182275.1|4139966_4141778_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_155296183.1|4141872_4142022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260331.1|4142022_4143036_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_011260332.1|4143050_4143749_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_011409453.1|4143736_4144015_-	YbeD family protein	NA	NA	NA	NA	NA
WP_011260334.1|4145080_4146286_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
WP_011260335.1|4146786_4148202_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_011260336.1|4148198_4149338_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_125168765.1|4150563_4151106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409455.1|4151077_4152352_-	DUF3380 domain-containing protein	NA	B3FJ91	Pseudomonas_phage	33.7	1.2e-21
WP_075242420.1|4152351_4152570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409456.1|4152646_4153609_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	4179578	4325288	4867200	protease,transposase,tRNA	Erwinia_phage(13.33%)	108	NA	NA
WP_011260359.1|4179578_4180946_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.1	6.2e-43
WP_011260360.1|4181056_4181608_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_011409475.1|4182123_4183041_-	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	27.7	2.2e-12
WP_011409476.1|4183240_4183912_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_011260363.1|4183908_4184763_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_011409477.1|4184752_4184989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409478.1|4185046_4185445_-	YbaN family protein	NA	NA	NA	NA	NA
WP_027703683.1|4185817_4187953_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	2.1e-29
WP_011409479.1|4188076_4189261_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011409480.1|4189586_4190018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409481.1|4190100_4192194_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409482.1|4192261_4192573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260370.1|4192960_4193530_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_011260371.1|4193638_4194604_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260372.1|4195162_4195963_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_011409484.1|4196513_4197428_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011409485.1|4197458_4198196_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011260375.1|4198226_4199279_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
WP_011260376.1|4199283_4199952_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011260377.1|4200103_4202041_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_094187780.1|4202767_4203530_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260378.1|4203844_4205494_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_011409489.1|4206884_4208372_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.7	1.0e-123
WP_069963930.1|4208579_4210034_+	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.3	7.5e-47
WP_011409492.1|4211268_4213893_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.6	1.9e-08
WP_011260383.1|4214148_4217019_+	insulinase family protein	NA	NA	NA	NA	NA
WP_011409493.1|4217566_4218496_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011409494.1|4218534_4219539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187782.1|4219781_4220545_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704042.1|4221592_4222378_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_011260388.1|4222631_4224305_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_011409497.1|4224848_4225295_-	autotransporter	NA	NA	NA	NA	NA
WP_012444053.1|4225625_4225910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260390.1|4226504_4227416_-	magnesium transporter	NA	NA	NA	NA	NA
WP_011409498.1|4227661_4228657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260392.1|4228750_4230127_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_082325347.1|4231293_4232994_+	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_082325348.1|4233402_4235175_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_011409500.1|4235450_4236326_-	DMT family transporter	NA	NA	NA	NA	NA
WP_027703846.1|4236523_4237402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260398.1|4239441_4240533_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_041182286.1|4242435_4244760_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260402.1|4244955_4246902_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409509.1|4247276_4247468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260404.1|4247858_4249442_+	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_027704189.1|4249789_4250386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409513.1|4251734_4252583_-	amino acid lyase	NA	NA	NA	NA	NA
WP_011409514.1|4252617_4254093_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
WP_011260408.1|4254683_4255613_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_011260409.1|4255847_4256339_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260410.1|4256335_4257007_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011409516.1|4257401_4257731_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_012444032.1|4257939_4258866_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.7	3.9e-49
WP_011407237.1|4259492_4260449_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_094187728.1|4260712_4261511_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|4261658_4262693_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409520.1|4265560_4266046_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_011409522.1|4266584_4269413_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_011409523.1|4269412_4269787_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_011409524.1|4269783_4271334_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_011409525.1|4271330_4271837_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_011409526.1|4271833_4272118_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_011260422.1|4272114_4272468_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
WP_103057261.1|4272915_4273254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409528.1|4273677_4275003_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_012444023.1|4275367_4276483_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_011260425.1|4276608_4277097_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409530.1|4277453_4278044_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011409531.1|4278055_4279564_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.6	2.9e-62
WP_011260428.1|4280006_4280900_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_011409533.1|4282282_4282948_+	pyruvate dehydrogenase E1 subunit alpha	NA	NA	NA	NA	NA
WP_109182021.1|4283580_4284546_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260435.1|4285078_4285459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080493654.1|4285661_4286564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409537.1|4286635_4287931_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_162828937.1|4288060_4288585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260439.1|4289010_4290276_-	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409539.1|4290272_4291250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444011.1|4291353_4292157_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011260442.1|4292332_4293142_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_109182023.1|4293149_4293948_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465763.1|4293990_4294608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409543.1|4294732_4295308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181902.1|4295519_4296839_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011409545.1|4296988_4297957_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409546.1|4298082_4298835_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011260447.1|4298872_4299313_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_011409547.1|4299519_4299861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260449.1|4300086_4300464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260450.1|4300674_4300872_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_011409548.1|4301178_4301925_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409549.1|4302017_4302824_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_012444005.1|4303047_4304460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260454.1|4304456_4305554_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_094187763.1|4305708_4306507_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099051302.1|4306560_4307359_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409552.1|4307578_4308541_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_115840184.1|4308988_4309752_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260456.1|4310033_4310810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409554.1|4310806_4312123_+	amino acid permease	NA	NA	NA	NA	NA
WP_011408623.1|4312639_4313875_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260459.1|4314468_4314750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260461.1|4315310_4315745_-	membrane protein	NA	NA	NA	NA	NA
WP_011409559.1|4315919_4317098_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_069960023.1|4318093_4319056_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260467.1|4321389_4323561_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_011409563.1|4323788_4324145_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260469.1|4324223_4325288_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
>prophage 31
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	4348238	4406753	4867200	transposase,tRNA	Acinetobacter_phage(33.33%)	44	NA	NA
WP_094187805.1|4348238_4349217_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
WP_115840195.1|4349296_4350262_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_003483093.1|4350274_4350745_-	bacterioferritin	NA	NA	NA	NA	NA
WP_027703893.1|4351087_4351303_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011260490.1|4351383_4352001_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005990700.1|4352549_4352942_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260491.1|4352945_4353374_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_011260492.1|4353559_4354213_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_011409578.1|4354492_4354807_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260494.1|4354966_4355761_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_011260495.1|4355898_4356591_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_011409579.1|4356911_4357628_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011260497.1|4357620_4358418_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
WP_011409580.1|4358554_4359592_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_011260499.1|4359709_4360339_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011409581.1|4360490_4361072_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_011409585.1|4364206_4366438_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011409586.1|4366627_4368340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260506.1|4368488_4369865_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.4e-79
WP_094187777.1|4372072_4372871_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069964474.1|4373855_4374824_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_069960033.1|4374990_4375962_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
WP_011409594.1|4376154_4377339_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011260517.1|4377806_4378622_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_011409596.1|4379380_4380697_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011260520.1|4380956_4382201_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011260521.1|4382293_4385542_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_011409597.1|4385675_4388816_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011409598.1|4389105_4390473_-	VOC family protein	NA	NA	NA	NA	NA
WP_041182775.1|4391217_4392183_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_069964616.1|4392601_4393567_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027703675.1|4394029_4394500_+	thioesterase	NA	NA	NA	NA	NA
WP_011409601.1|4394528_4394951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260528.1|4395026_4395461_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011260529.1|4395570_4396086_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011409602.1|4396101_4397127_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011260531.1|4397449_4398046_-	Ax21 family protein	NA	NA	NA	NA	NA
WP_011260532.1|4398403_4400131_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_011260533.1|4400180_4401623_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011260534.1|4401607_4402954_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409603.1|4403144_4403894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260536.1|4403995_4404607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260537.1|4404711_4405935_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260538.1|4406276_4406753_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 32
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	4419620	4477552	4867200	transposase,integrase	Leptospira_phage(25.0%)	37	4419504:4419523	4433563:4433582
4419504:4419523	attL	AGTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
WP_011260549.1|4419620_4420997_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
WP_041182305.1|4421007_4421541_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409609.1|4421969_4423229_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_011260552.1|4423367_4424675_-	MFS transporter	NA	NA	NA	NA	NA
WP_011407587.1|4426759_4427794_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409611.1|4428144_4428690_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_011409612.1|4428715_4428982_-	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011260556.1|4429156_4430995_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011260557.1|4431225_4432101_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
WP_011409614.1|4434218_4435361_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	5.3e-96
4433563:4433582	attR	GGGGTTTTTCAGGGGCGACT	NA	NA	NA	NA
WP_011260560.1|4436487_4437387_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_011260561.1|4438334_4441136_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
WP_011409617.1|4441212_4441503_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_115840388.1|4441860_4442963_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	9.4e-42
WP_125168768.1|4443068_4443740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168769.1|4443799_4444705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409622.1|4444894_4447582_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_011409626.1|4450903_4454833_+	avirulence protein	NA	NA	NA	NA	NA
WP_011409629.1|4456521_4457034_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	68.8	1.6e-44
WP_075244060.1|4457030_4457258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129215547.1|4457542_4457959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409630.1|4458107_4460114_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_012443890.1|4460110_4460542_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_011260579.1|4460538_4460958_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_075240651.1|4461443_4462196_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_011409633.1|4462406_4462997_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_011409634.1|4463130_4464078_+	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_011409635.1|4464120_4464990_+	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
WP_011409636.1|4464986_4465487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409640.1|4468585_4469146_+	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	29.6	2.1e-13
WP_011409641.1|4469241_4472067_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_011260589.1|4472228_4472747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409642.1|4472746_4473667_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_011260591.1|4474095_4474719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443879.1|4474728_4474920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465296.1|4475016_4475637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964623.1|4476586_4477552_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	4555079	4613457	4867200	transposase,tRNA	Leptospira_phage(33.33%)	34	NA	NA
WP_109182036.1|4555079_4556045_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260658.1|4556145_4556571_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094187715.1|4556613_4557376_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260659.1|4557438_4558470_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.0e-70
WP_011260660.1|4559830_4561087_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011260661.1|4561083_4561974_+	allantoinase PuuE	NA	NA	NA	NA	NA
WP_012443820.1|4561970_4562366_+	DUF3225 domain-containing protein	NA	NA	NA	NA	NA
WP_075239612.1|4562385_4562964_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_115801912.1|4562849_4563707_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_011409690.1|4563639_4565028_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260667.1|4569813_4571898_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260668.1|4571997_4574025_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011260669.1|4574267_4575878_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_011260670.1|4575888_4577052_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011409694.1|4577180_4577801_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012443812.1|4578131_4578320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260672.1|4578362_4578698_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_075242289.1|4580322_4580634_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_011409699.1|4581752_4582271_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_011409700.1|4582542_4584261_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011260679.1|4584351_4584738_-	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_011260680.1|4584799_4586125_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_011260681.1|4586239_4587553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260682.1|4587651_4588377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409701.1|4588593_4589256_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409702.1|4589334_4590429_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011409705.1|4591933_4594693_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.9	3.5e-146
WP_011409706.1|4594945_4596535_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_011409707.1|4596534_4598772_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011409708.1|4599060_4599969_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011409709.1|4600058_4601873_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_011407756.1|4601994_4603314_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_153303324.1|4603735_4612561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182038.1|4612659_4613457_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	4623633	4699960	4867200	tail,transposase,tRNA	Arthrobacter_phage(27.27%)	48	NA	NA
WP_011260702.1|4623633_4624551_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_011259480.1|4625154_4626492_+	xylose isomerase	NA	NA	NA	NA	NA
WP_011409721.1|4626717_4627785_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409722.1|4627960_4630156_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409723.1|4630152_4632117_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409724.1|4632128_4633388_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_011260707.1|4633387_4635088_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011260708.1|4635090_4637805_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260709.1|4638027_4639500_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_011260711.1|4640477_4641533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260712.1|4641760_4643179_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_011409725.1|4643219_4644197_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_042465333.1|4645613_4646915_-	MFS transporter	NA	NA	NA	NA	NA
WP_011409727.1|4647376_4650310_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409728.1|4650408_4651896_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260718.1|4651927_4652962_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_094187716.1|4653378_4654176_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182039.1|4655482_4656439_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_109182040.1|4657166_4657929_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075242372.1|4657946_4659047_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011260725.1|4659112_4660234_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_011409734.1|4660243_4661320_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260727.1|4661412_4662093_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_109182041.1|4662125_4662924_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409735.1|4663052_4664372_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465802.1|4664474_4665431_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.4e-41
WP_011260733.1|4666897_4667356_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409738.1|4667457_4667886_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_069960048.1|4668132_4668996_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_042465346.1|4672172_4672439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260739.1|4672600_4672849_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011409743.1|4673057_4673816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465805.1|4673812_4674508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409745.1|4674606_4674939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409747.1|4675410_4675845_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_069960049.1|4675960_4676206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260743.1|4676541_4676874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113062041.1|4677323_4678718_-	type III secretion system effector protein	NA	NA	NA	NA	NA
WP_011260746.1|4679655_4679946_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	53.8	1.5e-15
WP_011260747.1|4679963_4680245_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	40.7	3.1e-10
WP_011409750.1|4680339_4682592_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	21.7	8.7e-10
WP_082325367.1|4682779_4686847_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	4.1e-10
WP_011409752.1|4686843_4690257_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_075244278.1|4690373_4690595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409756.1|4697170_4697716_+|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_011260754.1|4697784_4698312_+|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011260755.1|4698370_4698907_+|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
WP_109182045.1|4698994_4699960_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP031464	Xanthomonas oryzae pv. oryzae strain YC11 chromosome, complete genome	4867200	4782506	4855322	4867200	protease,transposase	Ralstonia_virus(20.0%)	52	NA	NA
WP_011260830.1|4782506_4783742_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260831.1|4784613_4785669_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_011260832.1|4785661_4786333_-	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_011260833.1|4786430_4787738_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409807.1|4787754_4789173_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011409808.1|4789744_4791139_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_011260838.1|4791486_4793673_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.7	2.2e-111
WP_012446438.1|4793848_4794073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182049.1|4794653_4795619_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409811.1|4795794_4797210_-	amino acid permease	NA	NA	NA	NA	NA
WP_075242296.1|4797700_4800025_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_041182970.1|4800430_4800793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409815.1|4801170_4801716_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	33.9	2.6e-16
WP_011260845.1|4804968_4806096_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_011409820.1|4806951_4808292_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_011409821.1|4808508_4809201_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409822.1|4809317_4809638_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_011260850.1|4809637_4810630_+	D-2-hydroxyacid dehydrogenase family protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.4	8.5e-10
WP_011409823.1|4810936_4812460_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.7e-25
WP_011409824.1|4812564_4813800_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_011260853.1|4813960_4814617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260854.1|4814767_4816579_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_011409826.1|4816726_4817077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115840389.1|4817255_4818575_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_027703798.1|4819987_4821169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409829.1|4821266_4824698_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011409830.1|4824845_4825544_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_011409831.1|4825527_4827000_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_011409832.1|4826996_4827584_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_011409833.1|4827583_4828780_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_041182832.1|4828853_4829456_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	48.9	2.0e-46
WP_069960057.1|4829631_4830075_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_113055205.1|4830330_4830954_+	TolC family protein	NA	NA	NA	NA	NA
WP_011409837.1|4830950_4831517_+	FUSC family protein	NA	NA	NA	NA	NA
WP_011409838.1|4831792_4833154_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.9	8.3e-32
WP_075242371.1|4833267_4833588_-	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_069960058.1|4835403_4835610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960059.1|4835596_4836709_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_049756351.1|4839060_4839813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409848.1|4839809_4840517_-	hypothetical protein	NA	A4PE25	Ralstonia_virus	34.6	2.0e-08
WP_041182345.1|4840530_4840872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757268.1|4840852_4841362_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	4.8e-09
WP_011409850.1|4841358_4841760_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_011407756.1|4842151_4843471_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_005921785.1|4844582_4844804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446478.1|4845700_4845886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757270.1|4846918_4848088_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	1.3e-41
WP_069960119.1|4848113_4849424_-	MFS transporter	NA	NA	NA	NA	NA
WP_069960063.1|4851337_4851658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960064.1|4851776_4852943_-	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
WP_011260885.1|4853205_4854162_+	TerC family protein	NA	K4F9T9	Cronobacter_phage	29.9	8.4e-31
WP_011260886.1|4854536_4855322_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
