The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041934	Klebsiella pneumoniae strain KP14003 chromosome, complete genome	5293274	1671561	1678466	5293274	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1671561_1672425_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|1672435_1673209_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_032415700.1|1673449_1674343_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	3.6e-15
WP_004144192.1|1674588_1675950_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1676268_1676991_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1676987_1678466_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 2
NZ_CP041934	Klebsiella pneumoniae strain KP14003 chromosome, complete genome	5293274	1718929	1731207	5293274		Enterobacteria_phage(22.22%)	12	NA	NA
WP_062955058.1|1718929_1720336_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
WP_004189145.1|1720559_1721624_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.6e-105
WP_094315849.1|1721650_1722520_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	7.5e-111
WP_094315850.1|1722551_1723442_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_021313307.1|1723456_1724011_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_004175261.1|1724191_1725358_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004144151.1|1725780_1725903_-	small membrane protein	NA	NA	NA	NA	NA
WP_021313308.1|1726303_1727308_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
WP_071787386.1|1727263_1727458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071787387.1|1727820_1728105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004180506.1|1728386_1729802_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_024264496.1|1729824_1731207_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.6	9.4e-31
>prophage 3
NZ_CP041934	Klebsiella pneumoniae strain KP14003 chromosome, complete genome	5293274	2675827	2686714	5293274		Escherichia_phage(87.5%)	9	NA	NA
WP_118890946.1|2675827_2678935_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.4	0.0e+00
WP_004176258.1|2678989_2680255_+	MFS transporter	NA	NA	NA	NA	NA
WP_025368140.1|2680285_2681374_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.4e-210
WP_004183954.1|2681460_2681721_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_011117369.1|2682018_2682879_+	class A extended-spectrum beta-lactamase SHV-5	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_004209817.1|2682899_2683661_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.6	5.5e-134
WP_118890948.1|2683921_2684824_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	1.0e-158
WP_004190239.1|2684835_2686101_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
WP_117044491.1|2686093_2686714_+	aldolase	NA	A0A077SK32	Escherichia_phage	99.5	4.0e-114
>prophage 4
NZ_CP041934	Klebsiella pneumoniae strain KP14003 chromosome, complete genome	5293274	2947073	2954843	5293274	transposase	uncultured_Caudovirales_phage(16.67%)	8	NA	NA
WP_060415579.1|2947073_2947742_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	3.1e-80
WP_060415578.1|2947873_2948122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065697050.1|2948300_2949566_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.0	2.6e-205
WP_002901812.1|2949567_2949987_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_015065615.1|2950066_2951575_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.2	1.1e-24
WP_004194725.1|2952021_2953242_+|transposase	ISL3-like element ISCfr12 family transposase	transposase	NA	NA	NA	NA
WP_044783991.1|2953794_2954217_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	2.8e-26
WP_087638350.1|2954294_2954843_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	90.1	1.1e-86
>prophage 5
NZ_CP041934	Klebsiella pneumoniae strain KP14003 chromosome, complete genome	5293274	2959128	3005451	5293274	holin,tail,integrase,terminase	Klebsiella_phage(21.57%)	64	2958801:2958815	3003190:3003204
2958801:2958815	attL	CTGCTGGCGATTATC	NA	NA	NA	NA
WP_065805046.1|2959128_2962197_-	kinase	NA	A0A286S259	Klebsiella_phage	97.1	0.0e+00
WP_065799740.1|2962193_2962574_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	94.4	1.5e-68
WP_032416167.1|2962583_2963069_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	95.0	1.0e-80
WP_117044577.1|2963249_2963714_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	1.9e-57
WP_117044578.1|2964028_2964364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117044579.1|2964447_2967327_-|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.5	1.0e-100
WP_077254381.1|2967428_2967770_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	43.3	2.6e-06
WP_121593206.1|2967864_2968062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023313117.1|2968199_2968682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087866595.1|2968736_2969909_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.3	7.2e-24
WP_080884186.1|2969932_2970325_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_117044580.1|2970321_2970873_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.0e-28
WP_064155819.1|2970874_2971258_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004184451.1|2971244_2971478_-	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	49.2	1.3e-09
WP_004190649.1|2971487_2971742_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_040225382.1|2971743_2972139_-	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	42.5	4.7e-12
WP_004190653.1|2972460_2973414_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_117044581.1|2973424_2974210_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.4	3.9e-66
WP_040244174.1|2974294_2975407_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	54.9	3.7e-110
WP_008807834.1|2975390_2976791_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.3	9.2e-127
WP_004190663.1|2976790_2978098_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_058330843.1|2978075_2979080_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	2.0e-38
WP_004244013.1|2979628_2979814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218558.1|2979942_2980188_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_019405025.1|2981001_2981196_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	1.4e-25
WP_004190672.1|2981146_2981422_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|2981418_2981763_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004218565.1|2981759_2982299_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|2982295_2982595_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_008807830.1|2983245_2983935_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	1.9e-56
WP_023279926.1|2983931_2984072_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004177081.1|2984068_2984431_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	81.5	2.1e-51
WP_004146340.1|2984427_2984718_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	89.6	1.8e-45
WP_072040895.1|2984720_2984927_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	63.2	3.2e-20
WP_023300913.1|2984926_2985523_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.1	3.8e-90
WP_072031785.1|2985557_2985806_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	69.1	3.8e-28
WP_004184503.1|2985911_2986145_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_047670651.1|2986147_2986387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029602865.1|2987601_2987895_-	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_004184518.1|2988408_2988663_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.7	5.3e-09
WP_040243767.1|2988655_2988859_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	84.8	1.7e-26
WP_117044582.1|2988855_2989641_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	8.1e-64
WP_023307407.1|2989633_2989969_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	7.6e-11
WP_032417026.1|2989976_2990726_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
WP_032417025.1|2990728_2991643_-	DNA-binding protein	NA	V5URT9	Shigella_phage	54.1	1.0e-89
WP_071887734.1|2991657_2991846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023287506.1|2991933_2992470_-	bacteriophage regulatory protein CII	NA	K7PJT7	Enterobacteria_phage	70.4	2.1e-63
WP_040243773.1|2992472_2992706_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	61.6	2.1e-20
WP_040243776.1|2992810_2993206_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	73.3	3.1e-48
WP_040243778.1|2993376_2994225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040243780.1|2994221_2995028_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_040243782.1|2995076_2995280_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	74.6	1.4e-20
WP_040243785.1|2995563_2995872_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	61.2	2.9e-25
WP_114140013.1|2995962_2996061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065954358.1|2996167_2996359_+	YebW family protein	NA	NA	NA	NA	NA
WP_022631175.1|2996367_2996523_+	DNA breaking-rejoining protein	NA	K7PGY4	Enterobacteria_phage	71.2	1.5e-14
WP_117044583.1|2996660_2999771_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.0	5.3e-292
WP_117044584.1|2999783_3000893_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	86.4	6.5e-184
WP_022631172.1|3000933_3001173_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	67.5	6.8e-22
WP_004190725.1|3001182_3001497_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
WP_117044585.1|3001393_3002581_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.2	1.4e-120
WP_004151901.1|3002757_3003648_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3003190:3003204	attR	CTGCTGGCGATTATC	NA	NA	NA	NA
WP_004140266.1|3003647_3004640_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3004641_3005451_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 6
NZ_CP041934	Klebsiella pneumoniae strain KP14003 chromosome, complete genome	5293274	3131220	3225398	5293274	capsid,tRNA,transposase,tail,portal,head,holin,integrase,terminase	Klebsiella_phage(45.45%)	103	3123750:3123767	3233430:3233447
3123750:3123767	attL	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
WP_087791445.1|3131220_3131721_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3131837_3132284_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3132267_3133059_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023312957.1|3133159_3134344_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004224192.1|3134375_3135068_-	CTP synthase	NA	NA	NA	NA	NA
WP_004176547.1|3135213_3135723_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3135709_3136066_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004176548.1|3136055_3136295_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004176549.1|3136595_3137609_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
WP_004150782.1|3137666_3137768_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|3137767_3137842_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3137959_3138085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3138144_3138408_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3138538_3139177_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3139266_3140181_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004179363.1|3140842_3141886_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004140494.1|3142188_3143397_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004213090.1|3143470_3145255_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_021313530.1|3145261_3146152_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3146272_3147781_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|3148012_3148699_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140501.1|3149096_3149276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021313533.1|3149315_3149948_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3150514_3150712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|3150827_3151838_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140511.1|3151834_3153241_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3153296_3154184_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3154200_3154707_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004148027.1|3154733_3155228_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3155318_3155504_-	general stress protein	NA	NA	NA	NA	NA
WP_023286245.1|3156126_3157320_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3157432_3157660_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_040244743.1|3157680_3157866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008807712.1|3158109_3158433_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_023159861.1|3158425_3158818_+	ACT domain protein	NA	NA	NA	NA	NA
WP_032414785.1|3158814_3159528_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3159800_3159953_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_032418058.1|3160107_3161604_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	69.6	9.5e-138
WP_087803997.1|3161672_3173006_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	49.6	0.0e+00
WP_032418056.1|3173068_3173659_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	73.9	3.7e-77
WP_077255072.1|3173705_3174389_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_032418054.1|3174443_3175154_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.6	1.2e-135
WP_032444809.1|3175155_3175911_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.1	5.1e-124
WP_032418052.1|3175907_3176246_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	90.2	2.2e-58
WP_032418062.1|3176245_3179602_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	86.7	0.0e+00
WP_071603425.1|3179601_3179814_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	88.9	3.7e-32
WP_014228914.1|3179834_3180200_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_032444808.1|3180257_3180719_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	86.3	8.7e-66
WP_032418050.1|3180750_3181152_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	93.2	8.6e-62
WP_032418049.1|3181148_3181538_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	7.3e-58
WP_014228910.1|3181518_3181857_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_032418048.1|3181853_3182171_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	88.8	5.8e-45
WP_014907814.1|3182151_3182412_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	1.5e-22
WP_087804001.1|3182470_3183757_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
WP_032418047.1|3183834_3184755_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	1.6e-148
WP_087804003.1|3184791_3186051_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.2	8.1e-223
WP_032418045.1|3186050_3186230_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	4.0e-11
WP_032418044.1|3186223_3187945_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	6.5e-191
WP_012542168.1|3187944_3188379_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_017898991.1|3188628_3189060_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.3	1.8e-41
WP_014228902.1|3189056_3189374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017898990.1|3189325_3189688_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	81.7	3.4e-57
WP_017898989.1|3189841_3190063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017898988.1|3190169_3190358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017898986.1|3191437_3191788_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.8	1.8e-10
WP_023279523.1|3191784_3192282_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	85.8	1.9e-79
WP_017880269.1|3192281_3192497_-|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
WP_032432828.1|3193909_3194512_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.1	4.2e-76
WP_064149226.1|3194528_3195560_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.3	2.4e-95
WP_017898980.1|3195559_3195763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032439849.1|3195759_3196152_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_050597314.1|3196192_3196432_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	58.6	1.9e-16
WP_012542186.1|3196494_3196728_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	1.7e-25
WP_135724074.1|3196981_3197584_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_128971767.1|3197876_3198848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087804007.1|3199220_3200957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023289981.1|3201189_3202083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087804009.1|3202718_3203618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049245401.1|3203641_3203890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087804011.1|3204753_3205194_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032439843.1|3205207_3205672_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	69.5	2.2e-61
WP_065811835.1|3205664_3206648_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	56.4	4.3e-46
WP_014907826.1|3206699_3207254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012542199.1|3207256_3207472_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
WP_012542200.1|3207573_3207963_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
WP_099501482.1|3208577_3208796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039103071.1|3208805_3209000_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_087804013.1|3209042_3209387_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_087804015.1|3209528_3211667_+	exonuclease	NA	S4TNL0	Salmonella_phage	43.7	4.3e-99
WP_012542206.1|3211719_3211965_+	excisionase	NA	NA	NA	NA	NA
WP_032439840.1|3211945_3213073_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.1	1.3e-118
WP_004150800.1|3213190_3214441_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3214681_3215332_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_023282363.1|3215349_3215808_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3215864_3216971_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004140557.1|3217025_3217667_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_004176557.1|3217670_3219041_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	1.2e-107
WP_015958193.1|3219095_3219458_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004179353.1|3219541_3220348_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004150807.1|3220631_3221303_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_004147969.1|3221302_3222769_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_083565148.1|3222854_3223976_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_085955203.1|3224034_3225398_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
3233430:3233447	attR	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
>prophage 7
NZ_CP041934	Klebsiella pneumoniae strain KP14003 chromosome, complete genome	5293274	3457012	3466475	5293274	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_118890956.1|3457012_3458734_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3458778_3459480_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3459833_3460052_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3460171_3462451_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3462481_3462799_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3463124_3463346_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3463422_3465363_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3465359_3466475_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP041938	Klebsiella pneumoniae strain KP14003 plasmid pNDM-KP14003, complete sequence	60125	9833	40013	60125	transposase	Escherichia_phage(35.71%)	34	NA	NA
WP_032723026.1|9833_12821_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.6	9.9e-296
WP_000470624.1|12987_13623_+	recombinase family protein	NA	NA	NA	NA	NA
WP_009652884.1|13650_14487_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000235177.1|14552_14951_-	VOC family protein	NA	NA	NA	NA	NA
WP_000842086.1|14992_16102_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.1	3.7e-30
WP_001141270.1|16132_16408_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000510385.1|17245_17500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000557557.1|17517_17793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080287663.1|17855_18068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004221702.1|18025_18211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117063138.1|18240_18441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|19300_20509_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_004199413.1|21213_24231_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_004201164.1|24622_25435_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|25438_25804_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|25808_26447_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|26457_27489_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201171.1|27493_27823_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201172.1|28016_28307_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201176.1|28362_30003_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_015056392.1|30191_31721_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017480460.1|31681_31876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032723058.1|31931_32207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|32236_32941_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071538079.1|32931_33114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002904004.1|33077_33938_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|33958_34720_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_023148136.1|34710_34944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|35560_36265_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004199403.1|36298_36655_-	hypothetical protein	NA	A0A222YZE2	Escherichia_phage	46.6	5.5e-20
WP_001549892.1|36657_36897_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_000343760.1|36998_38219_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001549893.1|38307_38970_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000516402.1|39350_40013_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
>prophage 1
NZ_CP041935	Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence	287790	7802	15404	287790		Escherichia_phage(37.5%)	14	NA	NA
WP_004026417.1|7802_8123_+	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
WP_004026416.1|8203_8518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197205.1|8638_8890_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
WP_004026415.1|9055_9274_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
WP_004026414.1|9366_9864_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	67.1	2.6e-23
WP_004026413.1|9860_10049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197209.1|10526_10754_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.5e-10
WP_004026412.1|10750_11395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197237.1|11395_11719_+	hypothetical protein	NA	E5AGF3	Erwinia_phage	46.9	1.6e-13
WP_024198083.1|11811_12198_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
WP_004197183.1|12476_12692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032451279.1|14347_14542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197220.1|14841_15048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197207.1|15131_15404_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	48.9	1.5e-12
>prophage 2
NZ_CP041935	Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence	287790	114413	170180	287790	transposase	Enterobacteria_phage(36.36%)	50	NA	NA
WP_000427619.1|114413_115418_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_129773426.1|115995_117087_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	97.2	3.6e-187
WP_145015263.1|117194_120254_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	95.6	0.0e+00
WP_088250992.1|120305_121559_+	lactose permease	NA	NA	NA	NA	NA
WP_003846919.1|121615_121786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032435793.1|122950_123277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118106.1|123357_124254_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048268711.1|124418_125495_-	dihydroorotase	NA	NA	NA	NA	NA
WP_004118110.1|125491_126748_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_004118113.1|126784_127726_-	dihydroorotate dehydrogenase	NA	A0A1V0SH91	Hokovirus	32.6	3.6e-18
WP_016151336.1|127718_128567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104158603.1|128931_130188_+	MFS transporter	NA	NA	NA	NA	NA
WP_004118118.1|131297_132563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016338361.1|133904_134828_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	6.2e-172
WP_004197062.1|135667_136189_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_050888047.1|136185_137139_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_145015265.1|137224_139549_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_032415038.1|139593_140496_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_032415039.1|140492_141491_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118246.1|141487_142444_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004152282.1|142444_143212_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_050489138.1|143310_143604_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	93.8	4.4e-47
WP_071527925.1|143934_144177_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427623.1|144474_145479_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_116439550.1|147243_148326_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	97.5	5.5e-188
WP_145015267.1|148433_151508_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.5	0.0e+00
WP_145015269.1|151559_152813_+	lactose permease	NA	NA	NA	NA	NA
WP_096903786.1|153971_154250_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004210286.1|154343_154556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118891041.1|154780_155017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129304347.1|155023_155257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017900807.1|155456_155909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001166628.1|156567_157023_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294656.1|157094_157460_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|157475_157751_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|157778_158204_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|158242_159928_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|159945_160311_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|160307_160544_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|160527_160647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|160609_160822_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|161020_161725_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|161957_162818_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|162830_163373_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|163854_164046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|164051_164297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|164347_165484_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000971921.1|165598_166969_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|167789_168650_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000427614.1|169175_170180_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP041935	Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence	287790	175037	214190	287790	integrase,transposase	Salmonella_phage(23.08%)	42	175856:175871	219370:219385
WP_001067858.1|175037_175742_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_118891048.1|175687_175870_-	hypothetical protein	NA	NA	NA	NA	NA
175856:175871	attL	CGAGAAAGGATTCATT	NA	NA	NA	NA
WP_000427623.1|176884_177889_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004883563.1|178070_178343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001993321.1|178361_178541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|178470_179310_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|179303_179651_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|179818_180607_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_050563329.1|180620_181085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777555.1|181123_181597_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
WP_000845048.1|182092_183106_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001447826.1|183050_183374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001162012.1|183411_183969_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|183971_186944_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_000427619.1|187022_188027_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_101992395.1|188942_189827_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	42.8	7.5e-50
WP_014386530.1|191226_192294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016946352.1|192379_192634_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_014386529.1|192810_193947_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004026552.1|194012_194330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016946351.1|194474_194804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181760.1|194800_195559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386528.1|195555_196515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409750.1|196557_196965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181762.1|196974_197439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181763.1|197486_197729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181765.1|198316_198535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181766.1|198679_199219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181767.1|199287_200532_-	topoisomerase	NA	A0A0H5AWB1	Pseudomonas_phage	25.5	1.8e-09
WP_004181768.1|200642_200873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145015273.1|200944_202954_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026538.1|203017_204094_-	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_004181771.1|204191_205244_-	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_004181772.1|205271_206093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181774.1|206154_206508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101992392.1|206652_207639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181776.1|207972_209772_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	23.1	1.8e-26
WP_004181777.1|210062_210311_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_004181778.1|210300_210585_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.1	4.7e-22
WP_145015275.1|210738_211965_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	77.2	1.3e-153
WP_077257669.1|212538_212967_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	54.6	1.6e-34
WP_040209642.1|213002_214190_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.0	3.5e-143
219370:219385	attR	AATGAATCCTTTCTCG	NA	NA	NA	NA
>prophage 4
NZ_CP041935	Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence	287790	265625	272817	287790		Burkholderia_phage(33.33%)	11	NA	NA
WP_094545052.1|265625_266204_+	HNH endonuclease	NA	W0LI46	Edwardsiella_phage	58.3	2.4e-41
WP_004181824.1|266194_266509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032451555.1|266633_267044_+	hypothetical protein	NA	Q71TH9	Escherichia_phage	60.0	3.9e-41
WP_004181826.1|267228_267588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026468.1|267818_268262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062826756.1|268303_268507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026466.1|268515_268776_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
WP_118891016.1|268808_269243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026464.1|269239_269983_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	49.6	1.8e-60
WP_004026463.1|270109_271525_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	3.1e-106
WP_004026461.1|271614_272817_-	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.1	1.1e-35
>prophage 1
NZ_CP041936	Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence	239167	1728	64772	239167	integrase,transposase	Escherichia_phage(25.0%)	49	NA	NA
WP_001515717.1|1728_2469_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004194725.1|2574_3795_+|transposase	ISL3-like element ISCfr12 family transposase	transposase	NA	NA	NA	NA
WP_004182028.1|4936_5884_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	2.3e-12
WP_071527918.1|5910_6222_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_040224081.1|6286_7210_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.0	2.4e-176
WP_074385101.1|7882_8140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032414915.1|8707_9631_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	8.4e-177
WP_074385103.1|9807_11262_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|12244_13522_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|13584_15582_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|16621_17829_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004114612.1|20483_20831_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
WP_004114613.1|20827_21205_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	91.3	1.6e-57
WP_004178091.1|21703_22135_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000555737.1|22385_23861_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000697969.1|23853_24534_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
WP_032414989.1|24723_26109_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|26137_26491_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004098959.1|26604_27897_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_032414991.1|27907_31054_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.6	6.1e-62
WP_074385031.1|31140_31581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032414993.1|31707_34155_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.6	1.3e-83
WP_000843497.1|34195_34393_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|34426_35164_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|35452_35902_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|36135_37953_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|37952_38849_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|38888_39269_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|39273_40203_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|40257_40938_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_032414995.1|40934_42335_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004118347.1|42550_42985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032414998.1|43281_44262_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	2.0e-184
WP_032415000.1|44674_45064_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_032413314.1|45455_46463_+	DUF1611 domain-containing protein	NA	NA	NA	NA	NA
WP_023328925.1|46464_47430_+	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_015065581.1|47445_49311_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	1.3e-14
WP_015065582.1|49333_50875_+	glutathione ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015065583.1|50956_51889_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_023328923.1|51885_52770_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_023328922.1|52772_53816_+	P1 family peptidase	NA	NA	NA	NA	NA
WP_015065586.1|53812_54634_+	M55 family metallopeptidase	NA	NA	NA	NA	NA
WP_032413424.1|55205_56114_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001118616.1|57294_58218_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_050489137.1|58541_59723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032415049.1|59768_60692_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	1.9e-176
WP_004118212.1|61293_62367_+	FUSC family protein	NA	NA	NA	NA	NA
WP_023280828.1|63323_64247_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	3.6e-172
WP_004118209.1|64508_64772_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP041936	Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence	239167	77205	143027	239167	integrase,transposase,protease	uncultured_Caudovirales_phage(19.05%)	57	80598:80626	112230:112258
WP_032238623.1|77205_78171_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_032415018.1|78195_79347_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	2.2e-25
WP_032415021.1|79571_80552_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	57.7	1.4e-92
80598:80626	attL	GGCTTTGTTGAATAAATCAGATTTCGGGT	NA	NA	NA	NA
WP_145015277.1|80653_81577_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	3.0e-174
WP_032415024.1|81712_82138_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	5.6e-51
WP_004187067.1|82150_83440_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.9	7.6e-168
WP_026005941.1|83484_83805_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.0e-20
WP_004187061.1|84533_85523_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	28.0	2.7e-08
WP_004187059.1|86344_88231_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_032415027.1|88227_90039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032415028.1|90460_92113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187050.1|92151_92946_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_077254682.1|93004_94351_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004098919.1|94559_95042_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032415032.1|95029_95296_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_001118645.1|95686_96610_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
WP_004187025.1|96863_97112_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_004187019.1|97101_97386_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	55.9	6.4e-19
WP_122985329.1|97401_97554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087867040.1|97570_98742_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	95.7	2.8e-177
WP_004114613.1|98785_99163_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	91.3	1.6e-57
WP_004114612.1|99159_99507_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
WP_004118832.1|103330_105064_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004118225.1|105071_106019_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004152278.1|106063_107668_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118227.1|107680_108601_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118228.1|108600_109449_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032415034.1|109445_110039_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004118840.1|110035_111163_-	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118231.1|111447_111615_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_004197062.1|112717_113239_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
112230:112258	attR	ACCCGAAATCTGATTTATTCAACAAAGCC	NA	NA	NA	NA
WP_050888047.1|113235_114189_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_145015265.1|114274_116599_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_032415038.1|116643_117546_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_032415039.1|117542_118541_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118246.1|118537_119494_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004152282.1|119494_120262_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_050489138.1|120360_120654_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	93.8	4.4e-47
WP_071527925.1|120984_121227_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427619.1|121524_122529_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004152285.1|123964_124180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016831235.1|124402_125485_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.1	4.4e-185
WP_145015267.1|125606_128681_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.5	0.0e+00
WP_004182120.1|128732_129986_+	lactose permease	NA	NA	NA	NA	NA
WP_071527922.1|130042_130213_+	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
WP_023313931.1|131091_131352_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004182117.1|131408_133472_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_015065566.1|133554_133974_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_000427623.1|134334_135339_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000537151.1|136203_136488_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	47.1	4.7e-14
WP_077268707.1|136484_137339_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	53.8	1.1e-79
WP_004197483.1|137724_138045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019704338.1|138915_139104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|139247_139952_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001097412.1|141353_141917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348195.1|141940_142315_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_089586275.1|142379_143027_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP041936	Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence	239167	147470	156577	239167		uncultured_Caudovirales_phage(85.71%)	10	NA	NA
WP_004118534.1|147470_147845_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
WP_001549953.1|148373_149570_+	MFS transporter	NA	NA	NA	NA	NA
WP_004118529.1|149641_150469_-	universal stress protein	NA	NA	NA	NA	NA
WP_001549885.1|150487_151966_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_001549886.1|152449_152803_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549887.1|152898_154182_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
WP_001549888.1|154231_154660_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_004118521.1|154717_155440_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.0	1.5e-96
WP_001549890.1|155436_155769_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009309887.1|156265_156577_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	40.0	2.1e-15
>prophage 4
NZ_CP041936	Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence	239167	200924	211436	239167	transposase	uncultured_Caudovirales_phage(40.0%)	11	NA	NA
WP_104460535.1|200924_201983_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_135724303.1|201924_202443_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000323025.1|202326_202614_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|202613_202853_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_100280317.1|202877_203072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020277922.1|203115_204039_-	cation transporter	NA	NA	NA	NA	NA
WP_001515348.1|204238_204811_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_029497477.1|205286_206525_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	22.4	2.4e-09
WP_000589001.1|206945_208286_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_032414970.1|208374_209907_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
WP_085949440.1|210066_211436_-|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
>prophage 1
NZ_CP041937	Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence	70174	3930	11952	70174	transposase	Sodalis_phage(14.29%)	12	NA	NA
WP_065803191.1|3930_4884_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.7	6.4e-63
WP_022644914.1|4991_5579_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	36.5	2.6e-22
WP_072205881.1|5470_5695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644913.1|6118_6637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644912.1|6998_7646_+	P-loop NTPase	NA	A0A222YXS3	Escherichia_phage	43.5	9.7e-39
WP_032072061.1|7636_7912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644911.1|8104_8305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053390141.1|8406_9678_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.7	2.5e-147
WP_044596206.1|9689_10139_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.0	5.2e-31
WP_022644908.1|10135_10381_-	DinI-like family protein	NA	Q7Y3V9	Yersinia_phage	39.3	1.5e-08
WP_022644907.1|10584_10815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065803194.1|11250_11952_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	34.1	3.1e-22
