The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP034200	Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 chromosome, complete genome	5361371	82741	119604	5361371	tail,integrase,terminase	Salmonella_phage(43.9%)	51	75036:75051	88215:88230
75036:75051	attL	ATGAAACTTGATCGCG	NA	NA	NA	NA
WP_040025481.1|82741_83992_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.6	1.3e-204
WP_040025484.1|84008_84200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040025485.1|84196_84790_-	adenine methylase	NA	T1SA14	Salmonella_phage	90.4	1.8e-108
WP_040025486.1|84786_85437_-	hypothetical protein	NA	R9VWB9	Serratia_phage	47.8	1.7e-51
WP_040025488.1|85433_85592_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	80.0	5.6e-17
WP_040025490.1|85584_85878_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	70.1	8.9e-32
WP_004144294.1|85987_86236_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_040025492.1|86284_87220_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	76.7	2.0e-141
WP_040025495.1|87216_88038_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.6	5.6e-132
WP_040025497.1|88034_88334_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	55.6	9.4e-21
88215:88230	attR	ATGAAACTTGATCGCG	NA	NA	NA	NA
WP_040025499.1|88700_89282_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	3.5e-64
WP_004152538.1|89436_89670_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|89816_90026_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|90025_90793_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_052915161.1|90789_91575_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.0	1.2e-131
WP_062920554.1|91694_92039_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	85.1	5.3e-52
WP_064144943.1|92231_92678_+	hypothetical protein	NA	K7P858	Enterobacteria_phage	41.8	1.1e-17
WP_062920556.1|92674_92881_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	97.1	5.3e-31
WP_062921080.1|92997_93381_+	hypothetical protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	77.5	7.0e-37
WP_062920557.1|93381_93762_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	94.4	1.8e-64
WP_062920559.1|94408_94660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064144922.1|94656_94851_+	hypothetical protein	NA	C6ZR26	Salmonella_phage	76.7	2.2e-10
WP_062920561.1|95218_95557_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.9	4.7e-45
WP_140595450.1|97136_97388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418540.1|97539_97797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032457429.1|97874_98459_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	89.1	5.8e-91
WP_062920562.1|98455_99931_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.4	7.1e-279
WP_004152473.1|99974_100496_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
WP_004225268.1|100991_101180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152472.1|101201_101405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152471.1|101408_103088_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	58.9	3.4e-192
WP_004152470.1|103084_103390_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152469.1|103432_103630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152468.1|103671_104070_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_004197367.1|104082_105090_+	bbp17	NA	T1S9H9	Salmonella_phage	92.8	2.1e-181
WP_004152466.1|105099_105492_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_004152465.1|105484_105763_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
WP_004153043.1|105811_106423_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	1.2e-46
WP_004152463.1|106422_108900_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.5	3.6e-267
WP_004152462.1|108901_109372_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	7.3e-44
WP_004152461.1|109364_109862_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	40.5	5.7e-23
WP_004152460.1|109874_112619_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.2	9.1e-94
WP_004152459.1|112618_116008_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	6.3e-121
WP_004152458.1|116017_116632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004221292.1|116664_116817_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	85.7	1.9e-14
WP_004152457.1|116906_117305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152456.1|117309_117492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152455.1|117682_118378_-	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	52.7	4.4e-61
WP_004152454.1|118758_118956_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	69.8	2.0e-19
WP_004152453.1|118959_119217_-	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	2.3e-12
WP_004152452.1|119307_119604_-	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	6.2e-25
>prophage 2
NZ_CP034200	Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 chromosome, complete genome	5361371	1431914	1442797	5361371		Escherichia_phage(85.71%)	8	NA	NA
WP_062923782.1|1431914_1435022_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_140595523.1|1435076_1436339_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|1436368_1437457_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_062920746.1|1437543_1437804_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	4.6e-40
WP_001620095.1|1438100_1438961_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|1438981_1439743_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|1440003_1440906_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210516.1|1442176_1442797_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 3
NZ_CP034200	Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 chromosome, complete genome	5361371	1732714	1782037	5361371	tail,holin,integrase,terminase	Klebsiella_phage(22.45%)	62	1722155:1722170	1779343:1779358
1722155:1722170	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_087831371.1|1732714_1735849_-	SGNH/GDSL hydrolase family protein	NA	A0A1I9SEN3	Klebsiella_phage	32.3	1.7e-104
WP_039110596.1|1735943_1739012_-	kinase	NA	A0A286S259	Klebsiella_phage	97.2	0.0e+00
WP_004152651.1|1739008_1739389_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_039110595.1|1739398_1739881_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	95.6	4.1e-82
WP_039110593.1|1740061_1740526_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	1.5e-57
WP_039110591.1|1740525_1743408_-|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.0	1.7e-98
WP_032416607.1|1743481_1743850_-	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	42.9	3.3e-15
WP_004217333.1|1743960_1744317_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_008807842.1|1744393_1744600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008807841.1|1744737_1745220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031591823.1|1745273_1746446_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	9.4e-24
WP_004190640.1|1746469_1746862_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_039110587.1|1746858_1747410_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	2.3e-28
WP_004217344.1|1747411_1747795_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_040246471.1|1747781_1748015_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	4.4e-10
WP_004190649.1|1748024_1748279_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_004190653.1|1748995_1749949_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_032423789.1|1749959_1750745_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.7e-66
WP_039110586.1|1751275_1752388_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	55.1	2.5e-111
WP_008807834.1|1752371_1753772_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.3	9.2e-127
WP_004190663.1|1753771_1755079_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_008807832.1|1755056_1756049_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	35.3	1.3e-29
WP_004244013.1|1756597_1756783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218558.1|1756911_1757157_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_039110585.1|1757970_1758165_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	87.5	1.2e-24
WP_023313108.1|1758115_1758391_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	43.8	4.7e-11
WP_039110584.1|1758387_1758735_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	69.6	1.6e-35
WP_023301209.1|1758731_1759271_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	7.4e-101
WP_031281240.1|1759267_1759567_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	98.0	1.9e-45
WP_049001106.1|1760179_1760626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805457.1|1760531_1760789_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	96.5	5.4e-41
WP_023287514.1|1761123_1761945_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
WP_020804605.1|1762060_1762417_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	63.2	3.3e-41
WP_020804598.1|1762413_1762710_-	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	74.5	1.7e-35
WP_032416515.1|1762712_1762919_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	72.7	1.1e-23
WP_099130634.1|1763548_1763785_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	77.5	1.4e-27
WP_064145045.1|1764877_1765177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804596.1|1765272_1765701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804600.1|1765704_1765926_-	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.3e-11
WP_020804604.1|1765922_1766177_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.6	1.4e-09
WP_020804603.1|1766169_1766373_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	84.8	3.8e-26
WP_039110576.1|1766369_1767155_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	4.8e-64
WP_032417027.1|1767147_1767483_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	1.3e-10
WP_136444623.1|1768241_1769150_-	DNA-binding protein	NA	V5URT9	Shigella_phage	54.1	2.9e-89
WP_020804480.1|1769164_1769353_-	ClpX C4-type zinc finger	NA	NA	NA	NA	NA
WP_023287506.1|1769440_1769977_-	bacteriophage regulatory protein CII	NA	K7PJT7	Enterobacteria_phage	70.4	2.1e-63
WP_029503646.1|1769979_1770213_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	61.6	2.1e-20
WP_039110572.1|1770317_1770713_+	helix-turn-helix transcriptional regulator	NA	K7PM35	Enterobacteria_phage	74.0	1.4e-48
WP_136085610.1|1770730_1770829_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_016831735.1|1770934_1771054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631177.1|1772221_1772530_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	62.2	1.7e-25
WP_022631176.1|1772621_1772720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004179600.1|1772826_1773018_+	YebW family protein	NA	NA	NA	NA	NA
WP_012967861.1|1773026_1773182_+	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	75.0	1.2e-14
WP_039110567.1|1773319_1776358_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.0	3.0e-292
WP_062920787.1|1776369_1777479_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	86.4	6.5e-184
WP_071836884.1|1777519_1777759_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	67.5	8.8e-22
WP_071836885.1|1777768_1778083_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	2.1e-10
WP_085388913.1|1777979_1779167_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.2	7.1e-120
WP_004151901.1|1779343_1780234_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
1779343:1779358	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|1780233_1781226_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|1781227_1782037_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 4
NZ_CP034200	Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 chromosome, complete genome	5361371	2159914	2251842	5361371	integrase,plate,terminase,head,lysis,tail,protease,tRNA,capsid,portal	Salmonella_phage(57.38%)	93	2198512:2198527	2254275:2254290
WP_002898139.1|2159914_2161207_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_032419141.1|2161297_2162641_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|2162649_2163261_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_140595595.1|2163383_2167637_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	4.0e-88
WP_000228469.1|2167772_2168267_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002898019.1|2168799_2169768_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_062920822.1|2169882_2171649_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	26.2	1.0e-21
WP_062920823.1|2171649_2173371_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.0	9.0e-15
WP_002898014.1|2173415_2174117_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2174470_2174689_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|2174812_2177092_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|2177122_2177440_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|2177765_2177987_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|2178063_2180004_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|2180000_2181116_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004176693.1|2181262_2182921_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|2183340_2184036_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|2184151_2185051_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_004176696.1|2185194_2186847_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_140595598.1|2186857_2187826_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_062920824.1|2188037_2188472_-	DoxX family protein	NA	NA	NA	NA	NA
WP_004176700.1|2188623_2190342_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_004176702.1|2190380_2191382_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_062920825.1|2191392_2192835_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|2192922_2193936_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004209681.1|2193932_2194763_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_062920826.1|2194794_2195934_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|2196811_2197327_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896390.1|2198304_2199036_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
2198512:2198527	attL	GACAGCCTGATCCCGG	NA	NA	NA	NA
WP_002896386.1|2199042_2199759_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004191163.1|2199758_2200427_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_062920827.1|2200610_2201342_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019704675.1|2201428_2202901_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	1.8e-27
WP_002896380.1|2202897_2203614_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_062920828.1|2203692_2204820_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.8e-19
WP_002896376.1|2204861_2205350_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|2205407_2206253_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|2206249_2207203_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_140595845.1|2207213_2208344_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	33.5	6.7e-27
WP_140595601.1|2208507_2209569_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|2209970_2210450_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|2210538_2211441_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_008805812.1|2211615_2211903_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|2212105_2212369_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|2212375_2212759_-	membrane protein	NA	NA	NA	NA	NA
WP_004147745.1|2213025_2214711_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|2214932_2215151_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_021566199.1|2215241_2216342_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	5.5e-175
WP_000980414.1|2216338_2216824_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	1.8e-66
WP_062920830.1|2216820_2219898_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000763311.1|2219890_2220010_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|2220024_2220327_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|2220381_2220897_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001555854.1|2220906_2222079_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	4.6e-204
WP_001555853.1|2222221_2222788_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.8	2.2e-87
WP_001174919.1|2223215_2223656_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.7	1.5e-51
WP_001555895.1|2223627_2224230_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	2.5e-97
WP_021532224.1|2226378_2227287_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.2e-143
WP_000177580.1|2227273_2227633_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_038430657.1|2227629_2228208_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	84.9	3.0e-92
WP_038431118.1|2228334_2229846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031591600.1|2229933_2230398_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.6	5.5e-60
WP_038431116.1|2230390_2230822_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	2.2e-71
WP_077263505.1|2230784_2230988_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	78.5	2.6e-22
WP_038431114.1|2230917_2231346_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	91.5	1.9e-59
WP_038431112.1|2231342_2231858_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.2	1.8e-88
WP_000171568.1|2231838_2232054_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_038431109.1|2232057_2232261_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	3.0e-31
WP_000673530.1|2232260_2232725_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_021563628.1|2232820_2233471_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_032427925.1|2233474_2234530_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.7e-181
WP_002895967.1|2234546_2235380_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_031591583.1|2235522_2237289_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
WP_038431107.1|2237288_2238317_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	86.7	4.9e-170
WP_038431152.1|2238347_2240000_-	NTPase	NA	X2KLG0	Campylobacter_phage	27.8	2.1e-13
WP_016529210.1|2240201_2241044_-	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.5	1.3e-59
WP_016529211.1|2241043_2241262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088296112.1|2241548_2241854_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	89.6	1.1e-32
WP_001154434.1|2241792_2241981_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_140595604.1|2242081_2243566_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|2243565_2243817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038431106.1|2244043_2246458_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.8	0.0e+00
WP_032291301.1|2246454_2247312_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.5	4.3e-159
WP_000145290.1|2247308_2247611_-	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	42.1	9.8e-10
WP_000752613.1|2247607_2247835_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244228.1|2247834_2248068_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_001747374.1|2248135_2248477_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	6.6e-55
WP_000956187.1|2248594_2248891_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.3	2.2e-22
WP_000460893.1|2248898_2249408_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188450.1|2249472_2249676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346406.1|2249821_2250391_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	3.2e-38
WP_140595607.1|2250406_2250625_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	63.6	3.0e-08
WP_000290950.1|2250789_2251842_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
2254275:2254290	attR	GACAGCCTGATCCCGG	NA	NA	NA	NA
>prophage 5
NZ_CP034200	Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 chromosome, complete genome	5361371	2692014	2739471	5361371	integrase,terminase,lysis,tail,tRNA	uncultured_Caudovirales_phage(26.32%)	73	2690589:2690635	2736542:2736588
2690589:2690635	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_062920889.1|2692014_2693640_-	hypothetical protein	NA	A0A0C5AFR8	Klebsiella_phage	94.6	1.5e-309
WP_029498896.1|2695571_2696150_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	51.8	6.4e-50
WP_117073137.1|2696149_2696935_-|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	53.5	5.3e-31
WP_062920892.1|2696934_2697708_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	49.8	2.2e-66
WP_062920893.1|2697704_2698904_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	75.2	5.8e-162
WP_004152573.1|2698903_2699257_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_062920894.1|2699258_2699912_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	51.2	4.1e-61
WP_048322149.1|2699999_2700752_-	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	55.6	4.7e-61
WP_062920895.1|2700824_2701445_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	38.5	4.2e-31
WP_048322151.1|2701490_2701670_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_048322152.1|2701751_2701970_+	Arc family DNA-binding protein	NA	A0A0M5M1J2	Salmonella_phage	41.8	3.6e-06
WP_062920896.1|2702012_2702363_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	41.6	5.5e-20
WP_062920897.1|2702359_2703388_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	53.1	1.9e-97
WP_062920898.1|2703390_2703693_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.2	5.2e-27
WP_062920899.1|2703693_2704293_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	1.3e-53
WP_062920900.1|2704292_2706311_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	56.7	7.6e-207
WP_016244729.1|2706300_2706453_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
WP_062920901.1|2706494_2706914_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	65.9	5.1e-41
WP_062920902.1|2706917_2707361_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.0	9.5e-62
WP_062920903.1|2707370_2708516_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.4	2.8e-166
WP_062920904.1|2708519_2708960_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.0	6.0e-40
WP_062920905.1|2709054_2709441_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	76.6	6.8e-48
WP_062920906.1|2709440_2710058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038435200.1|2710054_2710474_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	61.5	2.0e-40
WP_062920907.1|2710442_2710724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062920908.1|2710763_2711705_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	75.8	1.6e-135
WP_062920909.1|2711716_2712211_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	63.4	8.4e-51
WP_062920910.1|2712214_2713417_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.9	3.6e-111
WP_062920911.1|2713468_2714017_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	2.3e-49
WP_062920912.1|2714072_2715524_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.6	1.9e-191
WP_021312714.1|2715762_2717163_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	9.4e-188
WP_062920913.1|2717113_2717890_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	64.2	4.2e-12
WP_062920914.1|2718255_2718723_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	72.9	2.7e-54
WP_140595633.1|2718719_2719223_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	79.6	2.7e-73
WP_004146347.1|2719225_2719540_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
WP_062920916.1|2719989_2720679_-	antiterminator	NA	I6PDF8	Cronobacter_phage	55.8	4.5e-58
WP_114139929.1|2720675_2721437_-	YlcG family protein	NA	M9NYX8	Enterobacteria_phage	76.1	2.6e-75
WP_062920917.1|2721429_2722098_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	80.1	1.7e-107
WP_071891127.1|2722094_2722262_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	64.8	2.1e-09
WP_062920918.1|2722261_2722717_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	1.8e-55
WP_140595636.1|2722969_2723281_-	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	53.5	5.4e-19
WP_062920920.1|2723273_2723462_-	hypothetical protein	NA	R9TNE4	Aeromonas_phage	75.0	5.5e-19
WP_062920921.1|2723461_2723659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077257772.1|2724208_2724373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071891130.1|2724372_2724948_-	hypothetical protein	NA	Q858D0	Salmonella_phage	54.4	2.6e-43
WP_062920923.1|2724944_2725349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062920925.1|2725851_2726076_-	hypothetical protein	NA	H9C169	Pectobacterium_phage	50.7	1.8e-13
WP_062920926.1|2726072_2726375_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062920927.1|2726374_2727151_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	65.4	1.4e-95
WP_023304897.1|2727147_2727876_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.0	7.8e-37
WP_004139615.1|2728009_2728231_-	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_004191589.1|2728270_2728489_-	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	50.7	1.4e-13
WP_021312733.1|2728597_2729257_+	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	61.5	1.9e-69
WP_008807814.1|2729762_2729969_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_062920928.1|2730048_2731020_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	76.8	3.8e-39
WP_062920929.1|2731027_2731225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483856.1|2731376_2732030_+	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	62.3	4.0e-64
WP_062920930.1|2732013_2732304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062920931.1|2732300_2732606_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062920932.1|2732602_2733259_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	86.9	2.3e-112
WP_009483861.1|2733255_2733474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062920933.1|2733470_2733743_+	hypothetical protein	NA	Q716F1	Shigella_phage	63.5	1.1e-23
WP_062920934.1|2733739_2734495_+	hypothetical protein	NA	R9VWB9	Serratia_phage	57.1	8.6e-71
WP_062920935.1|2734491_2734683_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	59.3	1.1e-11
WP_062920936.1|2734679_2734901_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.0e-12
WP_029497251.1|2734900_2735140_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	47.4	2.4e-11
WP_071891156.1|2735152_2735488_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_139112873.1|2735415_2735709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139112750.1|2735691_2736528_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	5.1e-141
WP_071579666.1|2736597_2736921_-	hypothetical protein	NA	NA	NA	NA	NA
2736542:2736588	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143017.1|2736959_2737826_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|2737827_2738040_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|2738085_2739471_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 6
NZ_CP034200	Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 chromosome, complete genome	5361371	4749663	4789475	5361371	integrase,plate,terminase,head,lysis,tail,holin,tRNA,capsid,portal	Escherichia_phage(27.5%)	48	4749536:4749576	4783290:4783330
4749536:4749576	attL	GGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAG	NA	NA	NA	NA
WP_032454123.1|4749663_4750701_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	64.7	2.7e-123
WP_032454122.1|4750707_4751292_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	38.7	1.0e-31
WP_004195891.1|4751411_4751633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032454121.1|4751663_4752173_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	93.5	4.6e-84
WP_032454120.1|4752180_4752381_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	93.9	1.1e-30
WP_032454119.1|4752344_4752683_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.0	8.0e-53
WP_062920432.1|4752751_4752979_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	73.3	1.0e-19
WP_062920433.1|4752978_4753200_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	86.3	1.2e-28
WP_047718529.1|4753200_4753482_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	91.4	3.7e-43
WP_062920434.1|4753474_4755703_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	90.8	0.0e+00
WP_062920436.1|4756475_4756961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062920437.1|4756974_4758066_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_062920438.1|4758432_4758615_+	hypothetical protein	NA	A0A0M4RE72	Salmonella_phage	78.8	5.5e-08
WP_071891072.1|4758621_4758882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032454110.1|4758930_4759974_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.4	4.0e-167
WP_032454109.1|4759973_4761743_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.8	1.8e-305
WP_032454108.1|4761908_4762763_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	80.6	4.8e-126
WP_062920439.1|4762836_4763895_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.2	8.4e-165
WP_032454107.1|4763898_4764642_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	79.9	2.5e-99
WP_009309691.1|4764738_4765245_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
WP_019725382.1|4765244_4765448_+|tail	tail protein	tail	S4TTA0	Salmonella_phage	79.1	9.5e-25
WP_019725381.1|4765452_4765743_+|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	79.6	5.0e-35
WP_032454106.1|4765729_4766227_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	87.7	8.7e-80
WP_032454105.1|4766223_4766655_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	66.9	6.2e-42
WP_116986925.1|4766536_4766788_+|holin	holin	holin	S4TNY4	Salmonella_phage	72.5	1.2e-24
WP_032454103.1|4766750_4767218_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.2	2.0e-62
WP_032454101.1|4767210_4767660_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	70.1	6.5e-50
WP_062920440.1|4768010_4769114_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_015959011.1|4769373_4770015_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.5	2.0e-92
WP_014343405.1|4770011_4770359_+|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	77.4	4.9e-45
WP_032454099.1|4771263_4771866_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	57.6	1.0e-53
WP_050442664.1|4771867_4774132_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	41.0	5.3e-108
WP_032454098.1|4774137_4774866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032454097.1|4774877_4775954_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	43.9	2.8e-30
WP_032454096.1|4776064_4777246_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.9	7.9e-196
WP_014343412.1|4777259_4777775_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
WP_062920441.1|4777835_4778111_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	76.1	1.2e-30
WP_062920442.1|4778125_4778263_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	88.9	3.7e-17
WP_062920443.1|4778255_4780694_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	71.6	4.2e-292
WP_032454094.1|4780710_4781190_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	77.1	4.5e-65
WP_062920444.1|4781189_4782350_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.2	2.4e-173
WP_071891073.1|4782398_4782806_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	44.4	5.9e-26
WP_032454093.1|4782898_4783117_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	84.7	1.0e-32
WP_002917636.1|4783485_4783992_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
4783290:4783330	attR	GGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAG	NA	NA	NA	NA
WP_004174339.1|4784091_4785933_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_004149864.1|4786151_4787897_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|4788008_4788224_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_040215074.1|4788461_4789475_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	1.1e-108
>prophage 7
NZ_CP034200	Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 chromosome, complete genome	5361371	5089382	5097745	5361371	integrase	uncultured_Caudovirales_phage(42.86%)	12	NA	NA
WP_062920489.1|5089382_5089670_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	47.8	2.8e-14
WP_062920490.1|5089662_5090541_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_062920491.1|5090533_5090713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062920492.1|5090709_5090973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062920493.1|5090987_5091191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071891076.1|5091196_5091415_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_062920494.1|5091411_5093754_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	39.7	8.7e-146
WP_062920495.1|5094734_5095343_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	62.3	8.2e-56
WP_062920496.1|5095343_5095649_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	58.3	1.4e-27
WP_062920497.1|5095651_5096731_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	52.0	2.0e-97
WP_062920498.1|5096734_5097076_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	55.8	8.5e-18
WP_062920499.1|5097085_5097745_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	51.1	8.9e-56
>prophage 1
NZ_CP034201	Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence	372826	29299	33696	372826		Salmonella_phage(25.0%)	10	NA	NA
WP_135801301.1|29299_29620_+	hypothetical protein	NA	J9Q750	Salmonella_phage	50.0	6.5e-28
WP_058842858.1|29700_30015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197205.1|30135_30387_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
WP_058842859.1|30552_30771_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	3.4e-20
WP_040209848.1|30863_31361_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	67.1	2.0e-23
WP_004197241.1|31357_31546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197209.1|32024_32252_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.5e-10
WP_004197234.1|32248_32893_+	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	39.8	1.4e-05
WP_058842860.1|32893_33217_+	hypothetical protein	NA	E5AGF3	Erwinia_phage	46.9	2.0e-13
WP_004197228.1|33309_33696_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
>prophage 2
NZ_CP034201	Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence	372826	219301	316519	372826	protease,transposase,integrase	Escherichia_phage(13.79%)	85	210173:210188	298160:298175
210173:210188	attL	GCCGTTTTTAAATATC	NA	NA	NA	NA
WP_004225018.1|219301_220297_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
WP_004210218.1|220502_221516_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
WP_004210220.1|221628_222156_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_077250518.1|222169_225127_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.8	2.3e-50
WP_004144375.1|225968_226829_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
WP_011251321.1|228560_229196_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_011251320.1|229532_230774_-	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	27.2	2.2e-10
WP_000301240.1|230858_231434_-	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	9.6e-30
WP_004026609.1|231520_232099_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_004026607.1|232137_233178_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
WP_004026604.1|233201_233657_-	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_011251319.1|233679_234831_-	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_004196925.1|234827_235412_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.4	2.0e-11
WP_011251317.1|235722_236781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181731.1|236792_237935_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.5	3.7e-33
WP_004181732.1|237927_238701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058842873.1|238702_239782_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	8.6e-40
WP_014386544.1|239781_240738_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_038992145.1|240748_241972_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_004026591.1|241974_242433_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_004026588.1|242911_243550_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026586.1|243574_244216_+	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
WP_004026585.1|244216_244855_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026583.1|244947_245988_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_032412835.1|245987_247721_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_058842874.1|247748_249248_+	kinase	NA	NA	NA	NA	NA
WP_001067855.1|252705_253410_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|256741_257506_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_024143553.1|257534_257717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130000.1|257732_258038_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_140595908.1|258048_259254_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_004883563.1|260664_260937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001993321.1|260955_261135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|261064_261904_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|261897_262245_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001317507.1|262428_262902_-	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
WP_000845048.1|263057_264071_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_077467014.1|264039_264273_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_140595911.1|267331_268051_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	8.6e-137
WP_004896925.1|268935_269478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000155092.1|269836_270721_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000052512.1|270776_272252_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_002001451.1|272650_273835_-|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_002026779.1|273883_274069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077252464.1|274288_274570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359986.1|274550_275324_-	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_000954592.1|277300_277477_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|277806_278622_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|278708_279011_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|278904_279156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|279186_280680_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|280890_281115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000018329.1|283310_284126_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_140595913.1|285043_286603_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.1e-83
WP_004026572.1|286873_287869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026570.1|288130_289048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074942246.1|289812_290016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017146617.1|290299_290503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042919293.1|290532_290847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026565.1|291089_291542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186900.1|292799_293684_+	hypothetical protein	NA	J9Q7H0	Salmonella_phage	43.2	2.6e-50
WP_032720864.1|295042_296110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186931.1|296195_296450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186933.1|296626_297763_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004026552.1|297828_298146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140595916.1|298290_298623_-	hypothetical protein	NA	NA	NA	NA	NA
298160:298175	attR	GATATTTAAAAACGGC	NA	NA	NA	NA
WP_004181760.1|298619_299378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186936.1|299374_300334_-	DNA replication protein	NA	NA	NA	NA	NA
WP_004186937.1|300376_300784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181762.1|300793_301258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181763.1|301305_301548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181765.1|302135_302354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181766.1|302498_303038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181767.1|303106_304351_-	topoisomerase	NA	A0A0H5AWB1	Pseudomonas_phage	25.5	1.8e-09
WP_004181768.1|304461_304692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197566.1|304763_305540_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026538.1|306792_307869_-	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_004186944.1|307960_309013_-	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_004026535.1|309040_309862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181774.1|309923_310277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025368599.1|310421_311408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025368600.1|311741_313541_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	25.6	2.2e-27
WP_025368601.1|313831_314080_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_004181778.1|314069_314354_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.1	4.7e-22
WP_040120489.1|316093_316519_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	51.5	1.8e-33
