The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040699	Salmonella enterica strain 7 isolate CFSAN047352 chromosome, complete genome	4709901	1674173	1683344	4709901	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1674173_1675121_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1675104_1675836_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1675816_1675924_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1675983_1676715_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1676937_1678623_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1678619_1679339_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1679385_1679853_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_017465874.1|1679909_1680440_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703143.1|1680611_1681070_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	71.9	2.4e-52
WP_000195330.1|1681310_1683344_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 2
NZ_CP040699	Salmonella enterica strain 7 isolate CFSAN047352 chromosome, complete genome	4709901	1853802	1864418	4709901		Morganella_phage(25.0%)	12	NA	NA
WP_017465538.1|1853802_1854276_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	76.6	1.6e-38
WP_001736108.1|1854922_1855213_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	3.0e-08
WP_017465540.1|1855584_1856382_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001532308.1|1856862_1857024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1857150_1857570_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_017465541.1|1857572_1858841_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	3.5e-226
WP_000208509.1|1859295_1859508_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1859518_1859707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017465542.1|1859966_1861178_-	porin	NA	Q1MVN1	Enterobacteria_phage	56.2	4.4e-109
WP_017465543.1|1861827_1862139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377042.1|1862218_1862914_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157305.1|1862987_1864418_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 3
NZ_CP040699	Salmonella enterica strain 7 isolate CFSAN047352 chromosome, complete genome	4709901	2762354	2850157	4709901	tRNA,holin,head,portal,integrase,protease,tail,lysis,capsid,terminase	Salmonella_phage(48.15%)	94	2785148:2785167	2861306:2861325
WP_000374046.1|2762354_2763014_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|2763100_2763430_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2763426_2763708_-	acylphosphatase	NA	NA	NA	NA	NA
WP_017465795.1|2763756_2764536_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2764561_2765110_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2765324_2766536_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2766593_2766911_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2766955_2767372_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2767542_2768205_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2768299_2768758_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_017465794.1|2768793_2770848_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2770971_2771418_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950861.1|2771436_2773590_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2773576_2774182_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_017465793.1|2774398_2774908_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2775265_2776318_+	porin OmpA	NA	NA	NA	NA	NA
WP_017465792.1|2776389_2776842_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_017465791.1|2777027_2778788_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2778856_2779375_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2779474_2779642_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2779897_2780461_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_017465790.1|2780457_2782098_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_017465789.1|2782102_2783356_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2783370_2785278_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2785148:2785167	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2785290_2787399_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224072.1|2787497_2788607_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2788603_2789146_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2789311_2790322_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193775.1|2790529_2793142_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	3.7e-20
WP_000497440.1|2793568_2793775_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	100.0	1.8e-31
WP_001536069.1|2794250_2795051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010835411.1|2795618_2797109_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	98.6	1.6e-254
WP_000143168.1|2797938_2798520_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.3e-94
WP_023193196.1|2798519_2801015_-|tail	Gifsy-2 prophage tail fiber protein	tail	E5G6P0	Salmonella_phage	76.1	7.3e-159
WP_000178849.1|2801068_2801311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514902.1|2801349_2804712_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.5	0.0e+00
WP_001750110.1|2804773_2805421_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	1.6e-89
WP_000662738.1|2805318_2806056_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.2	9.8e-128
WP_001152686.1|2806062_2806761_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.9	1.6e-103
WP_000447370.1|2806770_2807100_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
WP_000372075.1|2807102_2810198_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.7	4.8e-277
WP_010989052.1|2810169_2810508_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2810504_2810900_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971953.1|2810950_2811697_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2811704_2812106_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000677089.1|2812102_2812681_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083293.1|2812667_2813045_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
WP_000201485.1|2813055_2813421_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2813478_2814507_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2814561_2814909_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189498.1|2814921_2816418_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	1.1e-96
WP_000831821.1|2816407_2817988_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2817984_2818188_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623092.1|2818171_2820103_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
WP_001102153.1|2820074_2820620_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_001750111.1|2820905_2821307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001252721.1|2821563_2822067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031607240.1|2822395_2822845_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	6.1e-64
WP_000984583.1|2822862_2823315_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.7	4.6e-80
WP_001574216.1|2823298_2823628_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000798705.1|2824950_2825400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2825535_2825661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047630.1|2826059_2826857_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	4.0e-151
WP_001617856.1|2826846_2826993_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096547.1|2826989_2827601_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_001241019.1|2827603_2827810_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_001750112.1|2827809_2828412_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|2828446_2828695_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2828811_2829045_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000802853.1|2829292_2829619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107251218.1|2829712_2829781_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_000132543.1|2829761_2830979_-	hypothetical protein	NA	J9Q803	Salmonella_phage	53.3	3.1e-118
WP_000974174.1|2831289_2831535_-	hypothetical protein	NA	Q5G8U9	Enterobacteria_phage	88.9	3.0e-33
WP_000065089.1|2831534_2831855_-	hypothetical protein	NA	H6WRY0	Salmonella_phage	65.5	6.7e-25
WP_000113626.1|2831851_2832199_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	100.0	4.5e-59
WP_001750113.1|2832209_2832959_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	99.2	7.3e-139
WP_001540689.1|2832961_2833945_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_010835408.1|2834029_2834404_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000992434.1|2834369_2834606_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_001230956.1|2834710_2835106_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_001750114.1|2835211_2836153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001750115.1|2836179_2836386_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	4.3e-17
WP_001750116.1|2836974_2837325_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	96.6	3.2e-60
WP_001750117.1|2837451_2840379_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.8	0.0e+00
WP_010835407.1|2840341_2841499_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|2841541_2841781_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2841821_2842070_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262307.1|2842114_2843407_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_017465611.1|2843601_2844804_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_017465610.1|2844884_2846318_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_021294193.1|2846563_2847778_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000301921.1|2847864_2848098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762342.1|2848094_2848556_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117867.1|2848756_2850157_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
2861306:2861325	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 4
NZ_CP040699	Salmonella enterica strain 7 isolate CFSAN047352 chromosome, complete genome	4709901	4295461	4342534	4709901	tRNA,tail,plate	Burkholderia_phage(36.36%)	49	NA	NA
WP_017465897.1|4295461_4296460_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039337.1|4296547_4297858_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|4298104_4298620_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4298719_4298929_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4298950_4299064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128112.1|4299060_4300386_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4300564_4301173_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4301281_4301650_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4301820_4304241_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4304339_4305212_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019230.1|4305225_4305723_-	chorismate lyase	NA	NA	NA	NA	NA
WP_017465896.1|4305904_4306822_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_017465895.1|4306985_4308344_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4308432_4309542_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4309903_4311094_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382570.1|4311225_4312770_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4312784_4313675_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4313840_4314251_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750810.1|4314393_4316490_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977968.1|4316489_4317227_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_126489750.1|4317223_4317892_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4317925_4318168_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|4318611_4320261_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4320605_4321955_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4322085_4322433_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|4323009_4323297_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_017465893.1|4323299_4323905_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	4.2e-60
WP_017465892.1|4323917_4324232_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	1.1e-19
WP_000449433.1|4324392_4324848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4324844_4325042_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4325031_4326459_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4326458_4326983_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003639.1|4327034_4327352_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4327311_4327440_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262486.1|4327536_4329891_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.9	4.0e-66
WP_017465891.1|4329890_4330844_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_017465890.1|4330843_4331053_+	membrane protein	NA	A4JWL2	Burkholderia_virus	58.8	2.8e-16
WP_017465889.1|4331040_4332084_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.9	6.5e-77
WP_017465888.1|4332093_4332816_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593184.1|4333143_4333506_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000703628.1|4333502_4334432_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	7.9e-151
WP_001095011.1|4334431_4335979_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4336142_4336502_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951730.1|4336492_4337608_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_000359504.1|4337600_4338233_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_017465887.1|4338235_4340005_+|tail	tail protein	tail	A0A0M3ULH6	Salmonella_phage	40.5	3.2e-52
WP_017465886.1|4340009_4340615_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_017465885.1|4340611_4341067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022544687.1|4341805_4342534_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	7.3e-35
