The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043382	Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 chromosome, complete genome	4698270	421488	487218	4698270	tail,tRNA,integrase,head,holin,terminase,portal,capsid	Klebsiella_phage(23.53%)	82	455434:455451	486448:486465
WP_022650816.1|421488_421989_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_044596273.1|422398_423730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023315858.1|423745_425782_+	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_003857881.1|425888_426335_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_022650813.1|426318_427110_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_022650812.1|427209_428397_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_032609014.1|428428_429136_-	CTP synthase	NA	NA	NA	NA	NA
WP_003857886.1|429286_429631_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_022650810.1|429631_429937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023315857.1|430017_430272_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_032609012.1|430584_431613_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.1	2.2e-13
WP_015570793.1|431658_431757_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_015570794.1|431757_431832_+	protein YoaJ	NA	NA	NA	NA	NA
WP_003857896.1|431885_432134_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_099725438.1|432162_432348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524166.1|432506_432599_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_032609011.1|432723_434223_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_032609010.1|434227_434473_-	YmjA family protein	NA	NA	NA	NA	NA
WP_042863323.1|434548_434740_-	hypothetical protein	NA	Q77Z09	Phage_21	90.7	7.8e-21
WP_045351079.1|434884_436183_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_042863324.1|436248_438246_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	2.6e-21
WP_042863382.1|438448_439006_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	76.0	1.0e-73
WP_042863383.1|439136_439715_+|tail	tail fiber domain-containing protein	tail	A0A2I6PD03	Escherichia_phage	54.5	8.7e-47
WP_126527242.1|439680_440421_-|tail	phage tail protein	tail	G8C7K5	Escherichia_phage	68.6	2.4e-89
WP_010429924.1|441008_441242_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	76.6	3.9e-30
WP_042863329.1|441349_442021_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	71.7	9.3e-85
WP_042863330.1|442021_442336_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	71.6	3.7e-36
WP_042863332.1|442377_445920_-|tail	phage tail protein	tail	Q9MCU0	Escherichia_phage	60.8	0.0e+00
WP_042863333.1|445984_446587_-|tail	tail assembly protein	tail	I6PCW4	Cronobacter_phage	52.6	6.9e-47
WP_042863334.1|446567_447284_-	peptidase P60	NA	A0A1W6JP31	Morganella_phage	47.4	2.4e-62
WP_042863335.1|447286_448036_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	58.0	6.1e-85
WP_042863336.1|448118_448475_-|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	42.2	7.7e-22
WP_042863337.1|448474_451447_-|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	25.4	3.3e-25
WP_050861122.1|451436_451646_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	43.3	2.4e-07
WP_010433126.1|451675_452020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042863340.1|452078_452552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080317436.1|452569_452980_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	66.4	1.6e-39
WP_042863341.1|452985_453366_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	71.1	1.0e-43
WP_042863343.1|453346_453688_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	66.4	1.3e-37
WP_042863344.1|453684_454008_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q7Y407	Yersinia_phage	64.2	2.0e-32
WP_052215451.1|453988_454441_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	65.0	2.0e-14
WP_042863346.1|454500_455796_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	74.4	4.9e-175
455434:455451	attL	CAGGTCTTCCGCAGCGAA	NA	NA	NA	NA
WP_042863347.1|455864_456782_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	68.2	7.9e-111
WP_042863348.1|456815_458075_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	77.0	4.0e-190
WP_010433111.1|458074_458254_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	49.1	3.3e-05
WP_042863349.1|458247_459963_-|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	79.3	2.4e-278
WP_080317438.1|459997_460321_-|terminase	P27 family phage terminase small subunit	terminase	Q6UAY1	Klebsiella_phage	79.4	2.9e-44
WP_042863352.1|460564_460927_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	79.2	3.2e-55
WP_042863353.1|461129_461369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042863354.1|461522_462056_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	78.2	2.4e-67
WP_042863355.1|462052_462592_-	lysozyme	NA	K7PM52	Enterobacteria_phage	79.4	5.0e-81
WP_032634292.1|462588_462804_-|holin	holin	holin	H9C183	Pectobacterium_phage	73.9	5.0e-24
WP_042863356.1|462874_463930_-	site-specific DNA-methyltransferase	NA	K7PKK9	Enterobacteria_phage	80.9	5.2e-175
WP_042863357.1|464077_464269_-	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	69.8	1.1e-14
WP_042863358.1|464747_465287_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	65.5	7.5e-69
WP_042863359.1|465606_466212_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	72.1	1.1e-81
WP_042863360.1|466225_467245_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	53.1	6.5e-98
WP_042863361.1|467244_467613_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	60.4	2.7e-38
WP_042863362.1|467603_467804_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	47.0	1.1e-09
WP_042863363.1|468060_468315_-	cloacin	NA	NA	NA	NA	NA
WP_072034969.1|468638_468905_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	67.6	9.8e-22
WP_042863364.1|468911_469145_-	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	76.6	1.5e-26
WP_042863365.1|469353_469896_+	GNAT family N-acetyltransferase	NA	D0R097	Streptococcus_phage	36.6	2.8e-07
WP_072034970.1|470035_470503_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023315835.1|470721_472509_-	DUF4209 domain-containing protein	NA	Q2P9X5	Enterobacteria_phage	23.6	1.6e-14
WP_023315834.1|473136_473826_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_023315833.1|474094_474349_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	68.8	3.5e-24
WP_023315832.1|474352_474772_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_122983244.1|474786_475332_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	76.2	4.2e-67
WP_042863368.1|475243_476302_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	43.4	4.1e-34
WP_042863369.1|476338_476893_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	33.0	2.4e-14
WP_040017166.1|476895_477126_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	60.5	8.0e-20
WP_080317437.1|477215_477653_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	59.0	1.6e-37
WP_042863370.1|478050_478233_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_114079833.1|480173_480893_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	58.0	2.9e-60
WP_072034971.1|480945_481191_+	excisionase	NA	NA	NA	NA	NA
WP_042863371.1|481171_482299_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.9	5.2e-120
WP_052215455.1|482324_483377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003857898.1|483561_484812_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
WP_022650805.1|484929_485592_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_022650804.1|485591_486065_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032103856.1|486105_487218_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
486448:486465	attR	TTCGCTGCGGAAGACCTG	NA	NA	NA	NA
>prophage 2
NZ_CP043382	Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 chromosome, complete genome	4698270	1110169	1155736	4698270	tail,integrase,lysis,head,holin	Cronobacter_phage(31.48%)	68	1127079:1127095	1158629:1158645
WP_032608758.1|1110169_1110556_-|tail	phage tail fiber protein	tail	A0A0F7LDZ0	Escherichia_phage	56.6	1.3e-17
WP_126294952.1|1111089_1113306_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	61.4	3.0e-39
WP_042863109.1|1113363_1115841_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.8	0.0e+00
WP_052215427.1|1115827_1116355_-	HNH endonuclease	NA	Q2NPG0	Xanthomonas_virus	39.1	6.7e-22
WP_052215429.1|1116429_1116819_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	89.3	3.8e-62
WP_015571561.1|1116832_1117303_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	80.1	1.0e-66
WP_032671074.1|1117302_1117800_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	90.9	1.9e-87
WP_042863110.1|1117841_1118069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126530363.1|1118079_1121595_-	tape measure protein	NA	R9TMK1	Aeromonas_phage	57.5	9.8e-234
WP_042863112.1|1121653_1122337_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	60.2	5.0e-78
WP_042863113.1|1122396_1123143_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	75.8	2.4e-97
WP_042863114.1|1123201_1123585_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	56.7	8.3e-38
WP_042863115.1|1123624_1124167_-	HNH endonuclease	NA	A5H1J6	Xanthomonas_virus	43.9	2.5e-32
WP_042863116.1|1124269_1124638_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	63.1	1.0e-37
WP_059453295.1|1124640_1125000_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	65.2	2.3e-37
WP_059453296.1|1125231_1125669_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_032665489.1|1125773_1125944_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	50.0	2.2e-11
WP_006808952.1|1125943_1126324_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	7.0e-29
WP_045347693.1|1126326_1126692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047716508.1|1126701_1127799_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	77.7	5.9e-161
1127079:1127095	attL	TTGCCCCGGCGCGGATG	NA	NA	NA	NA
WP_059453297.1|1127809_1128244_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	71.5	9.1e-49
WP_059453298.1|1128247_1129444_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	49.6	1.4e-94
WP_072262684.1|1129782_1130790_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.8	2.4e-113
WP_114079838.1|1130716_1132192_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	59.8	1.7e-155
WP_059453301.1|1132202_1133678_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	83.9	2.3e-253
WP_045332067.1|1133677_1134193_-	hypothetical protein	NA	A0A0H5AUE2	Pseudomonas_phage	62.2	8.8e-51
WP_059453302.1|1134196_1134403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059453303.1|1134523_1135078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059453304.1|1135127_1135661_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	98.3	7.4e-93
WP_059453305.1|1136050_1136521_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	56.8	7.1e-39
WP_032608725.1|1136517_1136958_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	71.1	4.4e-51
WP_001514184.1|1136961_1137237_-|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_032608724.1|1137233_1137635_-	membrane protein	NA	NA	NA	NA	NA
WP_042863130.1|1138132_1138822_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.9	4.5e-58
WP_114079839.1|1138818_1138935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042863131.1|1138931_1139294_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	83.2	1.1e-52
WP_042863132.1|1139290_1139581_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	89.6	3.4e-44
WP_126530362.1|1139573_1139744_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	86.8	7.2e-18
WP_126530360.1|1139743_1140199_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	72.7	2.0e-59
WP_126530358.1|1140427_1140682_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	45.6	5.9e-08
WP_126530365.1|1140681_1140951_-	DUF551 domain-containing protein	NA	G5DA83	Enterobacteria_phage	37.9	2.4e-07
WP_126530356.1|1141613_1142000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045340902.1|1141996_1142257_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	91.7	3.1e-36
WP_126530354.1|1142866_1143166_-	protein ren	NA	M1FPD5	Enterobacteria_phage	49.5	4.1e-16
WP_126530352.1|1143165_1144599_-	AAA family ATPase	NA	Q716D2	Shigella_phage	86.5	5.9e-230
WP_045618179.1|1144588_1145488_-	hypothetical protein	NA	Q37929	Escherichia_phage	53.8	3.5e-79
WP_000449472.1|1145707_1145929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047746573.1|1145969_1146191_-	helix-turn-helix domain-containing protein	NA	M9NZA8	Enterobacteria_phage	94.5	7.4e-31
WP_047746660.1|1146308_1147019_+	helix-turn-helix transcriptional regulator	NA	M9NZE3	Enterobacteria_phage	89.0	1.5e-120
WP_126530350.1|1147040_1147673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047748435.1|1147699_1147912_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	78.1	1.6e-19
WP_126530348.1|1148318_1148660_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	92.9	6.9e-52
WP_126530346.1|1148816_1149224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651079.1|1149387_1149636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000607101.1|1149787_1149997_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	97.1	3.9e-34
WP_059453307.1|1150068_1150353_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	95.7	1.1e-47
WP_032676300.1|1150364_1150868_+	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	29.5	2.1e-12
WP_042863144.1|1150864_1151488_+	YqaJ-like viral recombinase	NA	S0A2A9	Cellulophaga_phage	49.5	7.2e-47
WP_042863145.1|1151484_1151913_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	93.0	2.4e-70
WP_045897922.1|1152073_1152625_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	59.4	1.1e-56
WP_042863147.1|1152621_1152840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042863148.1|1152836_1153178_+	DUF551 domain-containing protein	NA	U5P092	Shigella_phage	50.6	3.2e-17
WP_032608692.1|1153269_1153488_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	63.9	4.6e-17
WP_032608691.1|1153487_1153799_+	DUF2591 family protein	NA	E5AGF4	Erwinia_phage	47.4	1.0e-14
WP_126530344.1|1153776_1154016_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	73.1	1.4e-27
WP_032608689.1|1154024_1154255_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	94.7	5.7e-34
WP_071886183.1|1154360_1154696_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025756108.1|1154572_1155736_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	99.5	1.4e-229
1158629:1158645	attR	CATCCGCGCCGGGGCAA	NA	NA	NA	NA
>prophage 3
NZ_CP043382	Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 chromosome, complete genome	4698270	1684599	1709687	4698270	transposase,integrase	Escherichia_phage(42.86%)	27	1689631:1689690	1708920:1709739
WP_000608644.1|1684599_1685862_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|1686117_1686993_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|1687039_1687372_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
1689631:1689690	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|1689693_1690398_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002063889.1|1691591_1692134_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557452.1|1692146_1693007_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_001067855.1|1693113_1693818_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|1694449_1695280_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|1695410_1695965_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|1696108_1696813_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_078310596.1|1697073_1697271_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	57.4	1.2e-11
WP_071886836.1|1697338_1697554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031942322.1|1697634_1698303_-	tetracycline resistance transcriptional repressor TetR	NA	NA	NA	NA	NA
WP_031942321.1|1698381_1699581_+	tetracycline efflux MFS transporter Tet(A)	NA	A0A2H4UVM2	Bodo_saltans_virus	22.4	8.2e-07
WP_013851371.1|1700095_1700599_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001067855.1|1700635_1701340_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071886840.1|1701398_1701866_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|1701870_1702077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288432.1|1702458_1703892_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_004098817.1|1703925_1705140_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_024139167.1|1705146_1705359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|1705400_1706165_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|1706307_1706574_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|1706794_1707268_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	A0A140HLG8	Bacillus_phage	33.8	5.3e-18
WP_000845048.1|1707423_1708437_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_015344971.1|1708405_1708690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|1708982_1709687_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
1708920:1709739	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 4
NZ_CP043382	Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 chromosome, complete genome	4698270	3025909	3096572	4698270	tail,tRNA,integrase,lysis,head,holin,terminase,portal,capsid,plate	Salmonella_phage(51.22%)	92	3020891:3020921	3102264:3102294
3020891:3020921	attL	TGTAGGCCGGGTAAGCGCAGCGCCACCCGGC	NA	NA	NA	NA
WP_032607942.1|3025909_3027469_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.5	7.4e-08
WP_003862595.1|3027465_3027960_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032607938.1|3028105_3028870_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_003862593.1|3028870_3030040_-	DNA repair ATPase	NA	NA	NA	NA	NA
WP_042863282.1|3030417_3031431_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	59.9	1.1e-116
WP_114079840.1|3031440_3032346_-	NAD-dependent DNA ligase	NA	NA	NA	NA	NA
WP_032610574.1|3032351_3032966_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.4	1.2e-38
WP_042863280.1|3033067_3033304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015386351.1|3033338_3033848_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	1.0e-83
WP_015386352.1|3033855_3034056_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.9	8.7e-31
WP_032610572.1|3034019_3034361_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.8	4.5e-51
WP_001744223.1|3034428_3034662_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	80.5	5.4e-24
WP_032634595.1|3034661_3034889_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	3.9e-35
WP_042863278.1|3034885_3035782_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	65.7	1.7e-102
WP_042863277.1|3035774_3038078_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	63.6	3.5e-272
WP_042863276.1|3038229_3038925_+	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	74.6	6.7e-94
WP_001154443.1|3039084_3039273_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
WP_042863275.1|3039284_3039518_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_042863274.1|3039804_3040023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032706394.1|3040022_3040865_+	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	47.7	3.8e-59
WP_080317432.1|3040874_3041111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006777758.1|3041247_3042297_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	79.1	4.2e-156
WP_023307000.1|3042296_3044060_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	87.5	3.2e-312
WP_042863273.1|3044209_3045037_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	56.7	3.5e-73
WP_017382376.1|3045052_3046201_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	68.2	4.6e-132
WP_032665783.1|3046204_3046858_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	56.1	3.0e-56
WP_014884903.1|3046956_3047424_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.7	1.3e-48
WP_000868184.1|3047423_3047627_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_014884902.1|3047630_3047846_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	66.2	2.0e-20
WP_014884901.1|3047826_3048342_+	lysozyme	NA	E5G6N1	Salmonella_phage	76.5	1.8e-72
WP_023306996.1|3048338_3048767_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	84.3	1.2e-56
WP_072208435.1|3048696_3048900_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	91.0	1.8e-28
WP_014884898.1|3048862_3049294_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	89.5	3.5e-69
WP_014884897.1|3049286_3049733_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.1	2.4e-60
WP_014884896.1|3049801_3050380_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.9	8.2e-106
WP_014884895.1|3050376_3050736_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	89.8	2.3e-53
WP_042863272.1|3050722_3051631_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	92.1	6.8e-147
WP_014884893.1|3051623_3052229_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	94.0	8.1e-112
WP_042863271.1|3052225_3053878_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	72.8	8.4e-119
WP_042863270.1|3053877_3054276_+|tail	phage tail fiber protein	tail	K7PMC4	Enterobacterial_phage	47.7	1.5e-18
WP_042863268.1|3054408_3055581_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	92.6	2.1e-209
WP_007848874.1|3055590_3056106_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	93.0	7.6e-87
WP_014884889.1|3056160_3056463_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	3.1e-40
WP_007848878.1|3056477_3056597_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	3.3e-14
WP_042863267.1|3056589_3060123_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	68.5	0.0e+00
WP_032636598.1|3060122_3060608_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	89.4	6.8e-69
WP_042863265.1|3060604_3061705_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	92.1	1.4e-183
WP_042863286.1|3061774_3061993_+	DNA-binding transcriptional regulator	NA	Q53ZE7	Salmonella_virus	73.6	3.2e-26
WP_063142604.1|3062239_3063283_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	89.8	4.7e-184
WP_063142605.1|3063282_3063870_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	59.8	3.7e-61
WP_126530370.1|3064004_3064268_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	69.8	2.6e-27
WP_063142603.1|3064298_3064808_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	84.0	2.3e-75
WP_074139616.1|3064815_3065016_+	DUF2724 domain-containing protein	NA	A0A218M4I1	Erwinia_phage	79.0	9.6e-22
WP_063142602.1|3064979_3065318_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	75.9	5.4e-41
WP_063142601.1|3065383_3065611_+	DUF2732 family protein	NA	A0A218M4I9	Erwinia_phage	61.3	9.9e-15
WP_126530372.1|3065611_3065893_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	69.9	1.8e-29
WP_063142599.1|3065870_3068264_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	85.6	0.0e+00
WP_063142598.1|3068431_3068872_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	72.3	3.1e-52
WP_063142597.1|3069009_3069267_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	56.4	2.9e-18
WP_049108645.1|3069584_3070607_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.6	6.0e-168
WP_058658676.1|3070608_3072378_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.7	9.4e-302
WP_059453244.1|3072543_3073398_+|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	70.1	3.4e-108
WP_039671454.1|3073458_3074532_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	79.3	1.6e-158
WP_059453245.1|3074535_3075297_+|terminase	terminase endonuclease subunit	terminase	A0A218M4L0	Erwinia_phage	66.8	7.3e-78
WP_052320068.1|3075396_3075897_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.0	3.6e-57
WP_059453246.1|3075896_3076100_+|tail	phage tail protein	tail	Q858W3	Yersinia_virus	82.1	1.6e-24
WP_049108653.1|3076104_3076401_+|holin	holin	holin	O80308	Escherichia_phage	88.8	2.3e-40
WP_049108654.1|3076387_3076885_+	glycoside hydrolase family 104 protein	NA	O80309	Escherichia_phage	91.4	2.4e-85
WP_058658663.1|3076881_3077295_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	68.6	7.1e-43
WP_115877087.1|3077176_3077440_+|holin	holin	holin	S4TNY4	Salmonella_phage	69.8	4.1e-28
WP_039671463.1|3077402_3077870_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	85.8	2.2e-72
WP_039671464.1|3077862_3078312_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.0	1.8e-47
WP_039671465.1|3078380_3079022_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	80.3	8.9e-93
WP_039671467.1|3079018_3079366_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	74.8	3.8e-42
WP_039671468.1|3079369_3080278_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	81.1	1.1e-133
WP_039671470.1|3080270_3080801_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	85.8	2.6e-90
WP_126530374.1|3080812_3082999_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.0	1.8e-89
WP_126530376.1|3083011_3083416_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	52.2	8.8e-30
WP_126530378.1|3083540_3084731_+|tail	phage tail sheath protein	tail	Q7Y4D1	Escherichia_virus	89.9	5.9e-207
WP_045359411.1|3084744_3085263_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	90.7	7.7e-87
WP_045359412.1|3085324_3085600_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	82.4	1.8e-34
WP_039671477.1|3085632_3085752_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	92.3	6.7e-15
WP_126530379.1|3085744_3088288_+|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	69.9	1.1e-221
WP_048249321.1|3088303_3088783_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	84.3	2.6e-73
WP_063142593.1|3088782_3089925_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	78.0	2.9e-155
WP_039671482.1|3089991_3090210_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	81.9	2.5e-31
WP_039671483.1|3090200_3090425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032607936.1|3090641_3091148_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_006812010.1|3091248_3093093_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_003862574.1|3093245_3094991_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_001144069.1|3095106_3095322_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_032607934.1|3095558_3096572_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	6.3e-109
3102264:3102294	attR	TGTAGGCCGGGTAAGCGCAGCGCCACCCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP043382	Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 chromosome, complete genome	4698270	3493891	3557749	4698270	tail,tRNA	Enterobacteria_phage(20.83%)	60	NA	NA
WP_022651724.1|3493891_3496519_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	1.7e-81
WP_000906486.1|3496760_3496946_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_015571665.1|3498136_3498703_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_017692791.1|3498699_3499128_+	DedA family protein	NA	NA	NA	NA	NA
WP_022649137.1|3499211_3500756_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_003862180.1|3500908_3501424_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003862181.1|3501477_3502242_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032610003.1|3502228_3503884_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_006811709.1|3504050_3505598_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_022651722.1|3505614_3506787_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_017694792.1|3506917_3507448_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_032610002.1|3507762_3508947_-	MFS transporter	NA	NA	NA	NA	NA
WP_017382774.1|3509137_3510133_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_015571659.1|3510142_3511207_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_022651720.1|3511199_3512402_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.3	3.2e-27
WP_022649130.1|3512735_3513695_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.1	5.7e-136
WP_126527251.1|3513704_3515849_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.8	6.0e-202
WP_003862188.1|3515821_3516232_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.3	3.0e-17
WP_032609998.1|3516228_3516468_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	43.2	9.8e-13
WP_017382769.1|3516711_3517038_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_006811693.1|3517196_3517541_+	YgaC family protein	NA	NA	NA	NA	NA
WP_032609996.1|3517573_3518023_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_022651717.1|3518519_3518924_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_003862199.1|3518961_3519141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609995.1|3519223_3519742_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_003862203.1|3519921_3520080_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_015571650.1|3520076_3521006_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022651715.1|3521326_3521932_+	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	25.2	1.6e-06
WP_086623611.1|3523579_3524998_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_032665825.1|3525009_3526590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609988.1|3526586_3527543_+	carbamate kinase family protein	NA	NA	NA	NA	NA
WP_023314699.1|3527544_3528924_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_023323646.1|3528942_3529863_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023323645.1|3530078_3531410_+	MFS transporter	NA	NA	NA	NA	NA
WP_003862216.1|3531446_3532196_+	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_032609986.1|3532208_3533054_+	transketolase	NA	NA	NA	NA	NA
WP_022651706.1|3533053_3534052_+	transketolase family protein	NA	NA	NA	NA	NA
WP_042863460.1|3534126_3534858_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_022651704.1|3534854_3535457_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_022651703.1|3535554_3536442_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023314694.1|3536462_3537644_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_032609984.1|3537719_3538067_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	64.2	1.9e-33
WP_032609983.1|3538077_3538377_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	61.7	1.0e-27
WP_087920848.1|3538627_3539788_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032609980.1|3539807_3542000_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.7	1.6e-32
WP_114079831.1|3542599_3545218_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	60.2	4.7e-273
WP_032610603.1|3545220_3545559_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	77.7	9.2e-49
WP_032610602.1|3545555_3546311_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	92.4	1.0e-135
WP_032610600.1|3546312_3547023_+	peptidase P60	NA	K7PJV6	Enterobacteria_phage	96.2	1.5e-141
WP_032610599.1|3547051_3547399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032610598.1|3547425_3548016_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	85.2	3.8e-90
WP_032610597.1|3548070_3551868_+|tail	phage tail protein	tail	K7PHL5	Enterobacterial_phage	83.5	0.0e+00
WP_032610596.1|3551911_3552226_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	71.6	6.4e-36
WP_032610595.1|3552226_3552898_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	70.9	1.1e-85
WP_032610594.1|3553005_3553239_+	hypothetical protein	NA	E4WL42	Enterobacteria_phage	75.3	2.5e-29
WP_077870385.1|3553296_3554424_+|tail	tail fiber domain-containing protein	tail	A0A2I6PID3	Escherichia_phage	37.3	2.1e-52
WP_071886176.1|3554677_3555031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123906383.1|3555791_3556217_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	47.2	2.4e-25
WP_013096351.1|3556303_3556543_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	89.9	2.2e-33
WP_003863115.1|3557266_3557749_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
>prophage 6
NZ_CP043382	Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 chromosome, complete genome	4698270	4056107	4064957	4698270		Enterobacteria_phage(28.57%)	7	NA	NA
WP_032103484.1|4056107_4057172_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	6.4e-104
WP_032609646.1|4057187_4058054_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	2.8e-110
WP_032609645.1|4058066_4058957_+	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	31.3	4.8e-28
WP_023295000.1|4058967_4059516_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	9.1e-54
WP_023294999.1|4059651_4061058_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	5.2e-37
WP_032609644.1|4061311_4062478_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.5	1.2e-111
WP_032609643.1|4063952_4064957_-	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	3.3e-33
>prophage 7
NZ_CP043382	Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 chromosome, complete genome	4698270	4165980	4186098	4698270	integrase,terminase	Pectobacterium_phage(33.33%)	25	4165545:4165559	4171084:4171098
4165545:4165559	attL	GATGACATGCGGGAA	NA	NA	NA	NA
WP_032609570.1|4165980_4166997_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	64.0	2.8e-125
WP_032609568.1|4166980_4167229_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	39.5	6.4e-07
WP_071886173.1|4167164_4167389_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	56.3	1.7e-11
WP_032609566.1|4167439_4167622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609565.1|4167624_4168185_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	56.3	2.9e-47
WP_032610253.1|4168181_4170374_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.9	6.5e-103
WP_071886172.1|4170424_4170748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077870381.1|4171299_4171713_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	61.9	2.0e-37
4171084:4171098	attR	TTCCCGCATGTCATC	NA	NA	NA	NA
WP_071886171.1|4171781_4171976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609563.1|4173202_4173961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609562.1|4173960_4174371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609561.1|4174431_4174773_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	51.8	3.7e-21
WP_032609560.1|4174769_4176380_+|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	70.3	8.4e-225
WP_048859468.1|4176400_4178647_+	hypothetical protein	NA	A0A0F6TJC8	Escherichia_coli_O157_typing_phage	46.0	3.8e-66
WP_032609559.1|4178676_4180158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609558.1|4180154_4181096_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.7	5.5e-160
WP_023295990.1|4181092_4181455_-	GtrA family protein	NA	B9UDL8	Salmonella_phage	75.0	3.5e-46
WP_023295991.1|4181604_4181835_+	hypothetical protein	NA	A5LH82	Enterobacteria_phage	71.0	2.9e-22
WP_032609557.1|4181815_4182355_+	lysozyme	NA	H6WRZ4	Salmonella_phage	89.3	2.2e-92
WP_032609556.1|4182351_4182711_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	45.5	2.4e-15
WP_099516328.1|4183282_4183384_+	DNA invertase	NA	NA	NA	NA	NA
WP_003859653.1|4183462_4183786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651459.1|4183815_4184742_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032609555.1|4184747_4185218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003859661.1|4185381_4186098_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	1.0e-12
>prophage 1
NZ_CP043383	Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence	85718	4590	27473	85718	transposase	uncultured_virus(16.67%)	23	NA	NA
WP_001553819.1|4590_7488_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509966.1|7582_8188_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004683689.1|8752_9763_+|transposase	IS30-like element ISAba125 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	4.1e-52
WP_004201164.1|9863_10676_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|10679_11045_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|11049_11688_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|11698_12730_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201171.1|12734_13064_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201172.1|13257_13548_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201176.1|13603_15244_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_015056392.1|15432_16962_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017480460.1|16922_17117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|17427_18132_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001235713.1|19615_20173_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|20355_21216_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|21385_22141_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_014342204.1|22221_22770_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_076611394.1|22885_24088_+|transposase	ISL3-like element ISAeme19 family transposase	transposase	A9YX10	Burkholderia_phage	53.2	1.0e-102
WP_099147893.1|24102_24495_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	8.5e-22
WP_058655923.1|24487_24883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040219234.1|25489_26440_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	5.0e-76
WP_040219232.1|26586_26787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652286.1|26840_27473_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
>prophage 2
NZ_CP043383	Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence	85718	37655	45969	85718		Cronobacter_phage(16.67%)	11	NA	NA
WP_058655915.1|37655_38930_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	5.6e-155
WP_058655916.1|38929_39352_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.8	1.2e-29
WP_058655917.1|39531_40203_-	DNA breaking-rejoining protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	2.8e-81
WP_058655918.1|40552_41236_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	8.7e-30
WP_047359680.1|41232_41457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058655919.1|41505_41922_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_058655920.1|42332_42839_+	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	31.7	8.2e-09
WP_058655921.1|42968_43232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098945567.1|43538_43706_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_059446943.1|43659_43890_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_058672090.1|43959_45969_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.4	2.1e-23
