The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	7695	56336	4968141	protease,transposase	Ralstonia_phage(33.33%)	41	NA	NA
WP_011407164.1|7695_8532_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011407165.1|8718_9525_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9801_10995_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011257014.1|11148_11820_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|11904_12666_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12712_13135_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13138_13552_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_109182051.1|13847_14615_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14625_14895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407167.1|14969_16430_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|17076_18087_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18358_19561_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19702_21841_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|22051_22345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257023.1|22461_23007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257024.1|23120_24101_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	1.6e-88
WP_011257025.1|24148_25315_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_069959658.1|25461_26028_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_069959660.1|27502_28711_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|29338_30361_-	sugar kinase	NA	NA	NA	NA	NA
WP_011258802.1|31183_32152_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_134953787.1|32980_33367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057298.1|33598_34480_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.5e-05
WP_109182052.1|35081_36458_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.5	9.2e-79
WP_012443643.1|39470_39713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443642.1|39654_39978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075241628.1|40108_40495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257128.1|40443_41424_-|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
WP_011407183.1|41783_42035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407184.1|42042_43332_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
WP_011407185.1|43771_44107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407187.1|44381_44813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|45161_46571_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011257122.1|47888_48149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|48165_48498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080256644.1|48497_48956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407913.1|49315_50530_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187731.1|51050_51848_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182053.1|53563_54529_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_125168734.1|54525_54804_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_109182054.1|54947_56336_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	78054	139351	4968141	transposase	Ralstonia_phage(62.5%)	56	NA	NA
WP_109181945.1|78054_78818_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407204.1|78877_79138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182843.1|79156_81715_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_011257097.1|81899_82241_+	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_011257094.1|84457_86011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257093.1|86474_87038_-	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	38.5	4.4e-11
WP_011257092.1|87413_87833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|88295_89264_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011257091.1|89731_91549_-	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	NA	NA	NA	NA
WP_011257090.1|91631_92462_-	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_011257089.1|92458_92968_-	type III secretion protein HrpB7	NA	NA	NA	NA	NA
WP_011257088.1|92960_94289_-	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_011257087.1|94278_94980_-	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_011257086.1|94964_95594_-	type III secretion protein HrpB4	NA	NA	NA	NA	NA
WP_011257085.1|95601_96363_-	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
WP_011407211.1|96364_96757_-	type III secretion protein HrpB2	NA	NA	NA	NA	NA
WP_011257083.1|96790_97246_-	HrpB1 family type III secretion system apparatus protein	NA	NA	NA	NA	NA
WP_012443605.1|97460_98540_+	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_033013638.1|98548_100471_+	hypersensitivity response secretion protein hrcV	NA	NA	NA	NA	NA
WP_027704247.1|100470_101112_+	type III secretion protein HpaP	NA	NA	NA	NA	NA
WP_027704248.1|101204_102158_+	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_011407215.1|102144_102789_+	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_011257077.1|102793_103054_+	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_011257076.1|103050_103878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257075.1|103874_104813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257074.1|104822_105065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257073.1|105145_105427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257072.1|105481_105952_+	protein HpaB	NA	NA	NA	NA	NA
WP_011257071.1|106366_108352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182055.1|108348_108795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|110495_111464_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011257310.1|111590_112826_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109182056.1|112996_114316_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407219.1|114504_115488_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_109182057.1|115858_117094_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407220.1|117529_119902_+	HPr kinase	NA	NA	NA	NA	NA
WP_011257061.1|120777_122406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407223.1|122963_123347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407224.1|123343_123829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407225.1|123832_124195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407226.1|124311_125748_-	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.7	1.5e-10
WP_011407227.1|125989_126841_+	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
WP_011257053.1|127300_127618_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011257052.1|127923_128811_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_011407229.1|129517_130468_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	3.0e-97
WP_125168735.1|130581_130791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187709.1|130858_131131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257048.1|131171_131453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407231.1|131591_132650_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011407232.1|132790_133738_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
WP_011407233.1|133992_134304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239594.1|135576_135759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|135770_136241_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011257042.1|136410_137103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257041.1|137194_137593_+	host attachment protein	NA	NA	NA	NA	NA
WP_011407237.1|138394_139351_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
>prophage 3
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	174158	263542	4968141	transposase,tRNA	Acidithiobacillus_phage(16.67%)	54	NA	NA
WP_109182058.1|174158_175124_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187801.1|176559_177358_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082325201.1|177596_178979_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	4.7e-75
WP_094187711.1|180380_181448_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_012443678.1|181403_181601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257175.1|181582_181711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407264.1|181653_182181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464354.1|183003_185187_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_011407267.1|185198_188549_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011407268.1|188545_191662_-	DUF3416 domain-containing protein	NA	NA	NA	NA	NA
WP_011407278.1|198806_200126_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257184.1|200282_201803_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_011257185.1|201819_202098_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_011257186.1|202287_202626_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_011407279.1|203238_205224_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_011257188.1|206143_206956_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_011257189.1|207148_207760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257190.1|208176_209034_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	31.5	2.9e-14
WP_011257191.1|209271_211158_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_069963816.1|211723_213100_+|transposase	IS5-like element ISXoo4 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.7e-78
WP_011257193.1|213504_216228_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.0	4.8e-71
WP_041182356.1|216295_218449_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.5	2.0e-27
WP_011257195.1|218445_220137_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_041181914.1|220133_220397_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	4.4e-06
WP_011257196.1|220458_222660_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
WP_011257197.1|222656_224345_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_011257198.1|224878_226783_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_075239321.1|227043_227223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407290.1|227356_227824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257199.1|227981_228941_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_011407291.1|228925_229543_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011257200.1|229585_230005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257201.1|230257_231163_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	39.2	4.4e-37
WP_011257202.1|231411_232296_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011257203.1|232359_233142_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407292.1|233186_233948_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_011257206.1|234111_234441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407293.1|234759_235851_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_011407294.1|235919_237518_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_011407295.1|237682_238927_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_011257210.1|239378_240008_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	3.3e-52
WP_011257211.1|240214_242191_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
WP_011407298.1|243577_244243_-	YceH family protein	NA	NA	NA	NA	NA
WP_011257214.1|244529_245540_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_011257215.1|245536_246268_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_011257216.1|246621_248151_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.0e-46
WP_011407300.1|248260_251293_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257218.1|251591_254630_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257219.1|254794_255847_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_075240491.1|256015_256261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407301.1|256259_257225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257221.1|257224_259885_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_011257222.1|261703_261922_-	YdcH family protein	NA	NA	NA	NA	NA
WP_109182059.1|262440_263542_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	2.1e-41
>prophage 4
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	282608	349689	4968141	holin,transposase,tRNA	Bacillus_phage(25.0%)	43	NA	NA
WP_011257031.1|282608_283577_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011257243.1|283830_285993_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407318.1|286540_287845_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011407319.1|287904_288507_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011257245.1|288503_290408_+	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407325.1|299727_300543_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_041182297.1|300889_301852_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182012.1|301956_302719_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257253.1|304518_305577_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011257254.1|305587_305878_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257255.1|305867_306530_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_012446379.1|306526_307078_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257257.1|307089_307839_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407332.1|307838_308633_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257259.1|309017_309305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703982.1|309323_309881_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182061.1|309898_310864_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407336.1|311708_312665_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	2.9e-39
WP_109182012.1|312736_313499_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182062.1|313538_314337_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407338.1|314468_315683_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
WP_109182063.1|315742_316573_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257269.1|316735_317971_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011257271.1|319369_319798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324389.1|319817_320258_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011407345.1|320160_320466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407346.1|320773_322528_-	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_109182012.1|323468_324231_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703800.1|324284_324869_-	gluconokinase	NA	NA	NA	NA	NA
WP_011407349.1|325026_326409_+	MFS transporter	NA	NA	NA	NA	NA
WP_044757567.1|326411_328811_+	NdvB protein	NA	NA	NA	NA	NA
WP_109182064.1|328914_331557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257279.1|332304_335754_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011407353.1|335946_336531_-	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011407354.1|337007_337784_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069959686.1|337964_339266_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_094187863.1|339262_339628_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_011257284.1|340064_341546_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_109182027.1|341738_342704_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407357.1|343530_345693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182065.1|345819_347988_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011257288.1|348625_349255_-|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_011257289.1|349257_349689_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	358534	416835	4968141	transposase,tRNA	Pseudomonas_phage(16.67%)	44	NA	NA
WP_109182066.1|358534_359333_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181916.1|359392_360155_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182067.1|364109_365075_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042464374.1|366135_367242_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012446346.1|368853_369036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465421.1|369035_369974_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_011407377.1|370092_370842_-	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	5.6e-54
WP_012446343.1|370844_371636_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257314.1|371653_372649_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
WP_011257315.1|372751_373513_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_109182068.1|373597_374593_-	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_011407380.1|374658_374931_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_042465424.1|375416_376004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257320.1|376000_376201_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011407383.1|376261_377863_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024712051.1|377894_378641_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
WP_011407385.1|378637_379831_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407386.1|380240_381263_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_041181930.1|381402_382968_-	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
WP_011257326.1|382978_383992_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407388.1|383981_384683_-	SapC family protein	NA	NA	NA	NA	NA
WP_011407389.1|384866_387881_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257330.1|388270_388960_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_069959690.1|389384_391622_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_069959691.1|391830_393621_+	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_069959692.1|393720_394179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257334.1|394843_395836_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_109182069.1|395960_397280_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407394.1|398585_399500_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407395.1|399627_400380_-	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.9	5.6e-22
WP_011257339.1|400613_403148_+	iron-uptake factor	NA	NA	NA	NA	NA
WP_041181934.1|403770_404652_-	TolB-like protein	NA	NA	NA	NA	NA
WP_011257342.1|404704_405556_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_011407398.1|405557_405944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757197.1|406405_408538_+	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_094187715.1|408675_409438_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407399.1|409627_409894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182029.1|409976_410942_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012446321.1|410954_411143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257349.1|411104_411575_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011257350.1|412265_413789_+	catalase	NA	A0A2K9L0T1	Tupanvirus	48.0	2.2e-97
WP_011257351.1|413847_414423_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011407403.1|415173_415368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257354.1|415830_416835_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	572562	630641	4968141	integrase,transposase,tRNA	Stenotrophomonas_phage(16.67%)	55	580713:580729	629175:629191
WP_109182067.1|572562_573528_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407489.1|573995_575315_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257475.1|575844_576360_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011407490.1|576762_578985_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_103057279.1|579453_580479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959707.1|580462_581065_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
580713:580729	attL	GCGTAGTGCTGCGTCAT	NA	NA	NA	NA
WP_069959708.1|581395_582340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407493.1|582858_584235_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011407494.1|584319_586221_+	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
WP_011257482.1|586406_586622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407495.1|586728_587505_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407496.1|587666_588341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407497.1|588337_589111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257486.1|589334_589898_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011257487.1|589908_592401_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
WP_011257488.1|592583_593858_-	RDD family protein	NA	NA	NA	NA	NA
WP_069959711.1|593899_594622_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_011257490.1|594662_595136_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_011257491.1|595178_596321_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_011407499.1|596392_597529_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_011257493.1|597661_598174_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_011257494.1|598568_599492_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_011407500.1|599491_600805_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011257496.1|600855_602577_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_044757153.1|602741_604019_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257498.1|604216_605041_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011257499.1|605041_606100_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_011257500.1|606265_607732_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_042465436.1|607728_608232_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_011257502.1|608341_609475_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_011407503.1|609717_610239_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011407504.1|610438_611353_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011257505.1|611453_611894_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_011407505.1|612002_613877_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_011407506.1|614069_614390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181948.1|615139_616234_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	36.9	2.6e-52
WP_025988679.1|616472_616712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257508.1|616708_617560_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	43.8	8.1e-09
WP_017172572.1|617556_617841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959713.1|618192_618912_+	P-type DNA transfer protein VirB5	NA	NA	NA	NA	NA
WP_011257512.1|618925_619405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181949.1|619401_619662_+	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_011257514.1|619663_620749_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_041181950.1|620755_621058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257515.1|621054_621213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257516.1|622525_622936_+	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	52.0	7.0e-35
WP_041181951.1|623016_624291_+	DNA cytosine methyltransferase	NA	A0A191SB20	Nostoc_phage	37.4	8.3e-58
WP_011257518.1|624287_625085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257519.1|625344_626619_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.4e-110
WP_087801807.1|626531_626795_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	71.4	7.2e-17
WP_011257520.1|626752_626959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257521.1|626955_627228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407508.1|627224_627470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075240290.1|627734_627923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407512.1|629405_630641_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
629175:629191	attR	ATGACGCAGCACTACGC	NA	NA	NA	NA
>prophage 7
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	737005	796386	4968141	transposase	Enterobacteria_phage(25.0%)	56	NA	NA
WP_109182076.1|737005_737971_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_069960068.1|740379_741651_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011407585.1|741858_743688_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.5	1.3e-133
WP_011257638.1|744069_744543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257639.1|744774_745350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187804.1|745382_746145_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|746261_747296_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011407588.1|747512_748037_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_011257643.1|748193_749300_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_103057232.1|749296_751144_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_011257645.1|751230_751647_-	CopL family metal-binding regulatory protein	NA	NA	NA	NA	NA
WP_011407590.1|751782_752886_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_011407591.1|752929_754954_+	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_041181965.1|755127_755949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257649.1|756062_757271_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_011407593.1|757270_757786_-	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA	NA	NA	NA	NA	NA
WP_075239276.1|757784_758132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407594.1|758131_759211_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_011407595.1|759352_760003_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_011257653.1|760314_760713_-	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_011407596.1|760709_761192_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011407597.1|761516_762191_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_011407598.1|762305_762641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703598.1|762833_763187_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_012446113.1|763148_763328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407600.1|763599_764982_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.3	1.4e-55
WP_019301777.1|765074_765200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257658.1|765361_766351_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
WP_042464484.1|766394_767021_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_011257660.1|767359_768499_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_011407602.1|768591_768975_+	DUF4398 domain-containing protein	NA	NA	NA	NA	NA
WP_011257662.1|768971_769862_+	membrane protein	NA	NA	NA	NA	NA
WP_003484103.1|770203_770422_+	YdcH family protein	NA	NA	NA	NA	NA
WP_011407603.1|770663_772034_+	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	38.8	2.6e-49
WP_011257665.1|772124_773318_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_011257666.1|773364_774165_+	FkbM family methyltransferase	NA	H8ZJI6	Ostreococcus_tauri_virus	28.0	3.5e-06
WP_011407605.1|774199_775276_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SG19	Hokovirus	21.8	4.9e-11
WP_011407606.1|776307_777234_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_024744691.1|777254_777545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257668.1|777535_778699_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011257669.1|778704_779757_+	acyltransferase	NA	A9YX16	Burkholderia_phage	33.9	1.5e-41
WP_109182077.1|779843_781163_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407609.1|781478_782663_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_011407610.1|783192_784506_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
WP_011407611.1|784495_785314_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_069959723.1|785536_786478_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011257675.1|786477_787224_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011407612.1|787449_788505_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011407613.1|788560_789448_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407614.1|789444_790002_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
WP_011407615.1|789998_790907_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
WP_011257680.1|791023_792427_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011407616.1|792473_793820_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011407617.1|793953_794685_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_011257683.1|794684_795314_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_011258802.1|795417_796386_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 8
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	807232	875615	4968141	transposase,tRNA	Ralstonia_phage(20.0%)	47	NA	NA
WP_011257693.1|807232_808927_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011257694.1|809038_809443_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011407623.1|809574_810348_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011257696.1|810358_810826_+	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_011257697.1|810831_811305_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182079.1|811863_813183_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182080.1|813340_814660_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407627.1|814872_815841_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_109182081.1|815990_817310_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_099051332.1|817542_819588_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	8.2e-15
WP_011257702.1|819854_820895_-	pectate lyase	NA	NA	NA	NA	NA
WP_094187731.1|822484_823282_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075244150.1|823934_824249_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_109182082.1|824435_825537_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	1.6e-41
WP_027704099.1|826163_826466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182083.1|826473_829416_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.6	3.2e-129
WP_003490202.1|829623_830049_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_011257712.1|830089_830395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257713.1|830394_831867_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	6.2e-49
WP_011407634.1|831974_833057_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_011407635.1|833053_834160_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_011257716.1|834574_835042_-	RDD family protein	NA	NA	NA	NA	NA
WP_011257717.1|835468_836440_+	site-specific tyrosine recombinase XerD	NA	G1JX48	Mycobacterium_phage	27.9	6.4e-18
WP_011257718.1|836894_837692_+	DsbC family protein	NA	NA	NA	NA	NA
WP_011257719.1|838090_842143_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	7.5e-121
WP_075239329.1|842400_842664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959728.1|843120_846918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409190.1|848416_849373_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	2.4e-41
WP_011407640.1|850196_851936_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_041181968.1|851932_852112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257722.1|852111_853329_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_011407642.1|853596_854028_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_011257724.1|854037_854547_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_011257725.1|854543_854960_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011257726.1|854956_855592_+	type II secretion system protein J	NA	NA	NA	NA	NA
WP_011407644.1|855588_856440_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_011407645.1|856436_857558_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407646.1|857541_858195_+	general secretion pathway protein GspM	NA	NA	NA	NA	NA
WP_011407647.1|858184_858994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257731.1|858990_861303_+	type II secretion system secretin GspD	NA	A7BJX1	Enterobacteria_phage	23.5	5.2e-10
WP_011257732.1|861299_862139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257733.1|862555_863284_-	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_011407648.1|863389_863965_-	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_011407649.1|864340_866503_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407650.1|866538_867696_-	phosphotransferase	NA	NA	NA	NA	NA
WP_011407652.1|868306_869146_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011258802.1|874646_875615_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 9
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	885256	935563	4968141	protease,transposase	Trichoplusia_ni_ascovirus(10.0%)	44	NA	NA
WP_109182084.1|885256_886222_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257750.1|886612_887188_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_011407659.1|887300_887810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010368401.1|887908_888103_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011257752.1|888192_889170_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011257753.1|889399_889840_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_011257754.1|890117_891062_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_011407660.1|891144_891888_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
WP_010368407.1|892092_892332_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_011407661.1|892473_893709_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011407662.1|893879_895235_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_011257758.1|895295_896369_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_069959732.1|896365_897325_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_011257760.1|897321_897675_+	type IV fimbriae assembly protein	NA	NA	NA	NA	NA
WP_133261978.1|898377_899160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128415345.1|899253_899439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407665.1|899521_899848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181972.1|900083_901682_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_011257763.1|901827_902724_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_011407667.1|902799_903954_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_069963828.1|904148_906740_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_011407669.1|907062_907200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014502271.1|907283_907481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960159.1|907472_908672_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_011407672.1|909171_911388_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703871.1|911466_912465_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011257770.1|912574_912757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182085.1|913736_916724_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182786.1|916898_917846_+	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
WP_011407676.1|918345_918882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182086.1|918952_920272_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182087.1|920616_921579_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	2.2e-42
WP_011257778.1|921712_922273_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011257779.1|922315_922798_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_011407679.1|922960_923437_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257781.1|923847_924747_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011257782.1|924986_925373_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011407680.1|926002_927130_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257784.1|927129_927993_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_011257785.1|928286_928472_+	DUF2065 family protein	NA	NA	NA	NA	NA
WP_011407681.1|928809_930102_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	37.5	8.4e-74
WP_011407682.1|930427_933100_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.0	2.6e-77
WP_011257788.1|933293_934076_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_109182119.1|934186_935563_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.4	5.0e-77
>prophage 10
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	974284	1036079	4968141	protease,transposase	Ralstonia_phage(22.22%)	41	NA	NA
WP_109182067.1|974284_975250_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182120.1|975246_975420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446005.1|975704_976196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257827.1|977875_979132_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011257828.1|979291_979855_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_011257829.1|980221_981580_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_027703752.1|981579_982176_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_011257831.1|982322_983207_+	membrane protein	NA	NA	NA	NA	NA
WP_011257834.1|985188_985803_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257835.1|985885_986872_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|986987_987482_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|987726_989556_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011407704.1|989574_990045_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|990967_992095_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|992195_993578_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_125168738.1|993491_993686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257842.1|993825_995949_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407706.1|996477_996996_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_109182088.1|997702_998804_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.2e-41
WP_011257570.1|999319_1000555_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407710.1|1001168_1002059_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_011407175.1|1003763_1004732_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407713.1|1007008_1008244_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109182089.1|1009226_1010546_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182948.1|1011291_1012215_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
WP_109182121.1|1013277_1014243_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|1014544_1016122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|1016189_1016953_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1019621_1020590_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109182090.1|1020592_1020874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407721.1|1020850_1021312_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011257866.1|1021860_1022103_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_109182012.1|1022096_1022860_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049756327.1|1022892_1023624_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
WP_109182091.1|1025443_1026196_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181928.1|1026197_1027163_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257874.1|1027426_1028434_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011257875.1|1028577_1029339_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_012445939.1|1032656_1033949_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1034041_1034668_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|1034792_1036079_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
>prophage 11
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	1066621	1137641	4968141	integrase,transposase	Ralstonia_phage(22.22%)	59	1066693:1066708	1081753:1081768
WP_109182094.1|1066621_1067587_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
1066693:1066708	attL	GCAGCAGTGCGAGCAG	NA	NA	NA	NA
WP_011407739.1|1067685_1068372_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
WP_011257902.1|1068482_1068887_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011407740.1|1069097_1070147_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257904.1|1070167_1070917_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257905.1|1070916_1071666_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257906.1|1071665_1072697_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257907.1|1072714_1073074_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011407742.1|1073098_1073596_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257909.1|1073592_1073838_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011257910.1|1073834_1074281_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257911.1|1074842_1076939_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_011257912.1|1076945_1077266_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011257913.1|1077363_1077957_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_011407744.1|1078058_1078409_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257915.1|1078528_1079062_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011257916.1|1079058_1081011_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257917.1|1081003_1081960_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
1081753:1081768	attR	GCAGCAGTGCGAGCAG	NA	NA	NA	NA
WP_011407746.1|1081965_1082919_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_012445908.1|1082957_1084826_+	membrane protein	NA	NA	NA	NA	NA
WP_011407749.1|1086341_1086857_+	peptide deformylase	NA	NA	NA	NA	NA
WP_103057268.1|1087373_1088132_+	cellulase	NA	NA	NA	NA	NA
WP_041182379.1|1088604_1089351_+	cellulase	NA	NA	NA	NA	NA
WP_011407751.1|1089967_1091569_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_011257570.1|1092557_1093793_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407317.1|1094621_1095590_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	5.6e-99
WP_075241901.1|1096057_1096408_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_109182095.1|1096489_1097809_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407757.1|1097852_1098188_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_011257932.1|1098519_1099446_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_011257933.1|1099506_1100283_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011407759.1|1100584_1101256_-	methyltransferase	NA	NA	NA	NA	NA
WP_011407760.1|1101578_1102217_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_011257936.1|1102216_1103488_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011257937.1|1103641_1104733_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_011257938.1|1104732_1105995_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_011407761.1|1106147_1106828_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011407762.1|1106994_1108911_-	amylosucrase	NA	NA	NA	NA	NA
WP_011407763.1|1108945_1111390_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407764.1|1111659_1112991_+	MFS transporter	NA	NA	NA	NA	NA
WP_011407765.1|1113231_1114263_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407766.1|1114503_1115244_-	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_011257945.1|1115355_1116684_-	CitMHS family transporter	NA	NA	NA	NA	NA
WP_011407767.1|1116911_1118105_-	porin	NA	NA	NA	NA	NA
WP_011407768.1|1118360_1119062_+	response regulator	NA	NA	NA	NA	NA
WP_011407769.1|1119054_1120440_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	23.7	8.3e-11
WP_011407770.1|1120439_1121489_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011257949.1|1121528_1122167_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011257951.1|1122367_1123222_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011407771.1|1123218_1123857_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011257953.1|1124165_1125068_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257955.1|1125059_1125839_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_141062006.1|1125835_1127158_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.3	8.9e-63
WP_011407773.1|1127500_1130146_-	response regulator	NA	B5LWN0	Feldmannia_species_virus	28.1	4.4e-13
WP_011407774.1|1130467_1131640_-	porin	NA	NA	NA	NA	NA
WP_011407775.1|1131930_1133304_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011257960.1|1133501_1135811_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_027703512.1|1135986_1136151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182097.1|1136539_1137641_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
>prophage 12
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	1147397	1250238	4968141	transposase	Bacillus_phage(15.38%)	84	NA	NA
WP_109181887.1|1147397_1148161_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257975.1|1148393_1149719_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_011257976.1|1149917_1150265_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011407789.1|1150261_1152670_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011257978.1|1152848_1154006_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_011257979.1|1154021_1154621_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.8	3.8e-13
WP_011257980.1|1154617_1155013_-	glyoxalase	NA	NA	NA	NA	NA
WP_011257981.1|1155009_1155735_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_011257982.1|1155844_1156705_+	YicC family protein	NA	NA	NA	NA	NA
WP_011257983.1|1156821_1157433_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	30.9	3.1e-10
WP_099051298.1|1157613_1158411_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407791.1|1158559_1158859_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_011257986.1|1158987_1161159_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011257987.1|1161238_1161619_+	RidA family protein	NA	NA	NA	NA	NA
WP_011407792.1|1161639_1163793_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011257989.1|1163918_1164857_+	inosine-uridine preferring nucleoside hydrolase	NA	NA	NA	NA	NA
WP_005911911.1|1164928_1165171_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011407793.1|1165384_1166674_+	citrate synthase	NA	NA	NA	NA	NA
WP_011407794.1|1167052_1167703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187795.1|1168012_1170535_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_011407795.1|1170657_1171716_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257994.1|1171715_1172474_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011257995.1|1172470_1173136_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_011257996.1|1173132_1173666_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011407796.1|1173685_1175635_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_094187763.1|1175705_1176504_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407713.1|1176646_1177882_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407799.1|1177952_1178987_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258000.1|1179609_1180629_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_011258001.1|1180649_1181612_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407801.1|1181614_1182076_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_011407802.1|1182072_1183080_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_082325235.1|1183076_1184879_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011407804.1|1184875_1186633_+	membrane protein	NA	NA	NA	NA	NA
WP_033013273.1|1186928_1187246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057328.1|1187443_1188724_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011258007.1|1188943_1190944_+	transketolase	NA	NA	NA	NA	NA
WP_109181888.1|1191194_1191749_+	outer membrane receptor protein	NA	NA	NA	NA	NA
WP_011258009.1|1191762_1192479_-	M23 family metallopeptidase	NA	A0A0M5M794	Arthrobacter_phage	34.2	2.7e-05
WP_011407808.1|1192481_1193474_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_042464574.1|1193793_1196508_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407810.1|1196627_1197803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464577.1|1197937_1199896_-	acetyl-CoA hydrolase	NA	NA	NA	NA	NA
WP_069960293.1|1200071_1200719_+	thermostable hemolysin	NA	NA	NA	NA	NA
WP_011407813.1|1200715_1202215_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_011407814.1|1202211_1202886_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_011407815.1|1202885_1203725_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407818.1|1204391_1205090_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	9.8e-29
WP_041182938.1|1205107_1206469_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011407820.1|1206568_1206934_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407821.1|1206923_1208240_+	TonB family protein	NA	NA	NA	NA	NA
WP_011407822.1|1208236_1208821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407823.1|1209163_1209778_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-19
WP_011258026.1|1209777_1210470_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011407824.1|1210480_1211257_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011258028.1|1211327_1212158_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012445839.1|1212171_1212945_-	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_011407830.1|1216815_1217817_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_094187715.1|1218204_1218967_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182098.1|1219056_1220022_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181889.1|1220131_1221457_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	25.9	9.0e-07
WP_011407833.1|1221919_1222597_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704066.1|1222676_1223066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182099.1|1223278_1224166_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	33.1	2.4e-32
WP_041182001.1|1224599_1225583_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	2.2e-98
WP_011407838.1|1225757_1227845_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011407839.1|1227996_1228656_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_094187758.1|1228736_1229534_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407841.1|1229556_1229736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258045.1|1229754_1230159_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258046.1|1230192_1230552_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258047.1|1230795_1231668_-	ion transporter	NA	NA	NA	NA	NA
WP_011258048.1|1231740_1232967_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
WP_011407842.1|1233212_1233830_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_011407845.1|1235390_1236974_+	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_011258050.1|1236970_1237396_+	cytochrome c	NA	NA	NA	NA	NA
WP_011407846.1|1237420_1237924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407850.1|1239366_1239816_+	azurin	NA	NA	NA	NA	NA
WP_141062007.1|1242697_1242928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703881.1|1243206_1244496_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_133261981.1|1246509_1247961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258055.1|1248457_1249327_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
WP_011258056.1|1249348_1250020_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_011258057.1|1250016_1250238_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	1470760	1609440	4968141	transposase,tRNA	uncultured_Caudovirales_phage(16.0%)	109	NA	NA
WP_109181897.1|1470760_1471726_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011258243.1|1472105_1472783_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_075239020.1|1473101_1473290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005926176.1|1473320_1473545_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_011407979.1|1473544_1475617_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_011407980.1|1475848_1476706_+	pirin family protein	NA	NA	NA	NA	NA
WP_082323236.1|1477741_1480144_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	4.6e-41
WP_027704078.1|1480198_1481059_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_129593053.1|1481010_1481706_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_044757488.1|1481695_1483108_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_109181898.1|1483117_1485541_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	3.1e-37
WP_011258248.1|1485537_1486485_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_041182394.1|1487478_1488027_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_075245366.1|1488421_1488979_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407990.1|1489028_1491137_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_069959782.1|1491158_1493060_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.2e-30
WP_027704078.1|1493114_1493975_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_129593120.1|1493926_1494622_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258251.1|1495085_1495319_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407994.1|1495539_1496106_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407995.1|1496308_1496896_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_109182101.1|1497203_1497683_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_069959784.1|1497679_1500088_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011407999.1|1500432_1500894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408000.1|1501140_1502031_-	pirin family protein	NA	NA	NA	NA	NA
WP_125168744.1|1502208_1502727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444354.1|1502798_1503512_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_011258259.1|1503615_1504365_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_042465485.1|1504725_1504977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408003.1|1505309_1507367_+	M13 family peptidase	NA	A0A1V0SHG2	Klosneuvirus	28.6	1.2e-79
WP_069960076.1|1509314_1510436_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011258263.1|1510450_1511278_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_069959785.1|1511261_1512545_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011408007.1|1512571_1513087_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_069959786.1|1513097_1515254_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
WP_011408009.1|1515321_1517319_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|1517337_1517667_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_125168745.1|1517706_1517925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181899.1|1518156_1521621_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_014502625.1|1522023_1522566_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408011.1|1522977_1523886_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_094187763.1|1524231_1525030_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042464653.1|1525173_1525893_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_109181900.1|1526048_1527083_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258276.1|1527103_1527916_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408014.1|1528651_1529035_+	membrane protein	NA	NA	NA	NA	NA
WP_011408015.1|1529193_1530363_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
WP_011408016.1|1530357_1531416_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.1e-71
WP_011408017.1|1531476_1532289_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408018.1|1532804_1533188_+	membrane protein	NA	NA	NA	NA	NA
WP_011408019.1|1533373_1534537_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
WP_011258803.1|1534626_1535595_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011408020.1|1535727_1536540_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408021.1|1536770_1537358_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_011407237.1|1537656_1538613_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_075242217.1|1538686_1539418_+	nitrilase	NA	NA	NA	NA	NA
WP_069960180.1|1539439_1540543_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_011258289.1|1540611_1542015_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408024.1|1542028_1542535_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408025.1|1542940_1543399_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|1544176_1544380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258293.1|1545941_1546427_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|1546654_1546870_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_011408030.1|1547120_1547600_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011408031.1|1547731_1548160_-	cytochrome c	NA	NA	NA	NA	NA
WP_011258297.1|1548232_1549063_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_011408032.1|1549124_1549892_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011258299.1|1549891_1550107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408033.1|1550252_1551044_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_041182398.1|1551201_1552365_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011408036.1|1554598_1555237_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011258305.1|1555412_1557353_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_011258306.1|1557569_1558124_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011408037.1|1558345_1559776_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_011258308.1|1559842_1561297_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	5.7e-47
WP_042465493.1|1561524_1561704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258309.1|1561713_1562439_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_011408038.1|1562537_1562948_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041182034.1|1562999_1563956_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	1.0e-39
WP_011408040.1|1564199_1566581_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258314.1|1569234_1569645_+	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_011408042.1|1569944_1570127_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258316.1|1570259_1571300_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011258317.1|1571372_1572818_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_011257031.1|1574348_1575317_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181902.1|1575529_1576849_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109181903.1|1577144_1577690_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_011408047.1|1577686_1579150_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011258323.1|1580610_1580865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075242210.1|1581267_1581801_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_014502654.1|1581826_1582228_+	membrane protein	NA	NA	NA	NA	NA
WP_011258326.1|1582576_1582819_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_069970183.1|1582855_1583506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133261986.1|1584181_1586086_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.4	2.1e-57
WP_075243271.1|1586349_1588746_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_011258331.1|1588895_1589618_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011258334.1|1592537_1593038_+	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
WP_075241746.1|1592979_1594656_+	serine hydrolase	NA	NA	NA	NA	NA
WP_011258336.1|1594802_1596068_+	potassium transporter	NA	NA	NA	NA	NA
WP_011258337.1|1596126_1597320_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.3	4.0e-22
WP_012444424.1|1597316_1598006_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_033013597.1|1598111_1599581_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011258340.1|1599600_1600437_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011258341.1|1600462_1601566_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_044756980.1|1601562_1604619_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_069960188.1|1604684_1605275_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_069959790.1|1605406_1607239_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_094187715.1|1607314_1608078_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181904.1|1608120_1609440_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	1676127	1768315	4968141	transposase,tRNA	Hokovirus(14.29%)	55	NA	NA
WP_011258399.1|1676127_1678959_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
WP_011408096.1|1679273_1679774_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_011258401.1|1679863_1680814_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_011258402.1|1681327_1682263_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_011408097.1|1682262_1684263_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_033013172.1|1684265_1684892_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_010365831.1|1684891_1685227_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_033013173.1|1685576_1687274_+	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_012444470.1|1687498_1689745_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.3	4.4e-54
WP_109181908.1|1689768_1691388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114889752.1|1691531_1696226_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	48.6	1.5e-24
WP_041182622.1|1696229_1696805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444477.1|1698372_1698657_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_109181909.1|1699393_1703977_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.7	4.2e-19
WP_125168749.1|1703966_1704566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181910.1|1706301_1707403_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.2e-41
WP_069964932.1|1709305_1711861_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.7	6.6e-30
WP_012445369.1|1714831_1716226_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_044756961.1|1717611_1719168_+	membrane protein	NA	NA	NA	NA	NA
WP_011408111.1|1721751_1722990_-	MFS transporter	NA	NA	NA	NA	NA
WP_011408112.1|1723430_1723724_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_011258426.1|1724221_1724998_-	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_011408113.1|1725155_1726922_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_125168750.1|1726945_1727230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258428.1|1727433_1727961_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_044756957.1|1728060_1728738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258430.1|1728827_1729556_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258431.1|1729670_1730195_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_011258432.1|1730352_1730937_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_011258433.1|1731136_1733044_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.1	3.4e-79
WP_010363979.1|1733172_1734210_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	2.7e-06
WP_011258434.1|1734262_1734721_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011258435.1|1734732_1735512_+	protein TolQ	NA	NA	NA	NA	NA
WP_011408114.1|1735668_1736118_+	protein TolR	NA	NA	NA	NA	NA
WP_011258437.1|1736107_1737148_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_011408115.1|1737407_1738727_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_011408116.1|1738784_1739303_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_011258440.1|1739309_1740128_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_011408117.1|1740170_1740854_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	39.5	1.5e-37
WP_019301562.1|1741687_1741798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408120.1|1742087_1742798_-	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_011408121.1|1743032_1743239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057327.1|1745032_1745611_-	amino acid transporter	NA	NA	NA	NA	NA
WP_011260830.1|1748146_1749382_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|1749432_1750196_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069959795.1|1750262_1751639_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	1.1e-58
WP_008578058.1|1752017_1752692_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_011408164.1|1753322_1753727_-	response regulator	NA	NA	NA	NA	NA
WP_011408165.1|1753805_1754303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959808.1|1754441_1756238_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	2.6e-81
WP_011408166.1|1756794_1757340_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_069959809.1|1757441_1761563_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
WP_011408167.1|1761783_1764426_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182063.1|1765867_1767382_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_094187715.1|1767552_1768315_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	1905786	1966604	4968141	protease,transposase	Tupanvirus(18.18%)	52	NA	NA
WP_094187715.1|1905786_1906550_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408239.1|1907498_1908305_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_011408242.1|1910337_1911723_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011408243.1|1911861_1913367_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011408244.1|1913377_1914559_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011258591.1|1914555_1915353_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408245.1|1915352_1916525_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_027703337.1|1916684_1917587_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_011408247.1|1917825_1918791_+	cation transporter	NA	NA	NA	NA	NA
WP_011258595.1|1919007_1921089_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_041182077.1|1921325_1921946_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_011258597.1|1921942_1922842_+	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_011408249.1|1922951_1924538_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	6.5e-28
WP_011258599.1|1924703_1926509_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.5	6.1e-22
WP_011258600.1|1926615_1927416_+	signal peptidase I	NA	NA	NA	NA	NA
WP_011258601.1|1927446_1927824_+	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011258602.1|1927813_1928494_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.4	1.7e-17
WP_011258603.1|1928490_1929390_+	GTPase Era	NA	NA	NA	NA	NA
WP_011258604.1|1929613_1930336_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011408250.1|1930484_1931207_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011408251.1|1931365_1932700_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	27.2	1.0e-29
WP_011258607.1|1932874_1933372_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_011258607.1|1933717_1934215_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_011257310.1|1934310_1935546_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011408252.1|1935774_1937151_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_041182416.1|1937270_1937954_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_011408254.1|1937970_1939005_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011408255.1|1939185_1940763_+	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	25.6	2.2e-44
WP_011408256.1|1940880_1941885_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_011408257.1|1941884_1942439_+	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011408258.1|1942524_1943277_+	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_003488188.1|1943363_1943570_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_014504008.1|1945080_1945725_-	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_011408263.1|1945714_1948216_-	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_011408264.1|1948212_1949817_-	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	36.6	4.9e-15
WP_011258619.1|1949813_1950047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408265.1|1950043_1951066_-	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_011258621.1|1951402_1951768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408267.1|1951764_1952355_-	cell shape determination protein CcmA	NA	NA	NA	NA	NA
WP_011408268.1|1952452_1954162_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	2.1e-16
WP_011258624.1|1954270_1954597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408269.1|1954826_1955171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408270.1|1955293_1956469_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011258626.1|1956624_1959453_+|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011258627.1|1959513_1960614_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_103057269.1|1960914_1961145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182081.1|1961081_1961609_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258629.1|1962010_1962184_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011258630.1|1962344_1962599_-	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258631.1|1962773_1963040_+	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_041182418.1|1963230_1963797_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_109181915.1|1965284_1966604_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	1999216	2058341	4968141	protease,transposase,coat,tRNA	Acidithiobacillus_phage(25.0%)	47	NA	NA
WP_109181918.1|1999216_2001301_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012445211.1|2001525_2001975_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_109181919.1|2002738_2003791_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408305.1|2004068_2005466_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_011258667.1|2005462_2006440_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_011258668.1|2006621_2008559_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258669.1|2008979_2009756_-	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258670.1|2009760_2010435_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_082323429.1|2012065_2013442_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.0e-78
WP_011408311.1|2013481_2013877_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_069959817.1|2013919_2015395_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.5	2.2e-102
WP_109181920.1|2015609_2015825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408313.1|2016192_2016609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256646.1|2016622_2016793_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_011258676.1|2020481_2021045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258677.1|2021517_2022834_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_011408316.1|2023001_2023604_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408317.1|2023677_2024124_+	membrane protein	NA	NA	NA	NA	NA
WP_075244058.1|2024201_2024432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075244057.1|2024421_2024673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258680.1|2025289_2026633_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_109181921.1|2026569_2027982_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011258682.1|2027978_2028716_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
WP_042464756.1|2028715_2030896_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258685.1|2031735_2032695_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_011408321.1|2032870_2036461_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
WP_011408322.1|2036918_2037659_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
WP_027703356.1|2037655_2038912_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011258689.1|2038950_2039742_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|2039765_2040227_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_069959820.1|2040223_2041237_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_011258692.1|2041636_2044090_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_011408324.1|2044086_2045433_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011258694.1|2045459_2046650_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_011258695.1|2046652_2047480_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027703358.1|2047476_2048238_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258697.1|2048255_2048813_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011258698.1|2048993_2049716_-	UMP kinase	NA	NA	NA	NA	NA
WP_011408325.1|2049772_2050150_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258700.1|2050277_2051156_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011258701.1|2051325_2052129_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011408326.1|2052504_2053230_-	molecular chaperone	NA	NA	NA	NA	NA
WP_041182086.1|2053232_2053565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258703.1|2053611_2054646_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_011258704.1|2054642_2056994_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011408330.1|2057010_2057781_-	molecular chaperone	NA	NA	NA	NA	NA
WP_099051284.1|2057789_2058341_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 17
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	2109475	2239723	4968141	transposase,tRNA	Ralstonia_phage(20.83%)	96	NA	NA
WP_109181923.1|2109475_2110795_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408358.1|2111129_2112056_-	TolC family protein	NA	NA	NA	NA	NA
WP_011258748.1|2112185_2112791_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_109181924.1|2113129_2114899_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.5	3.0e-58
WP_011258750.1|2114895_2115489_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	4.8e-16
WP_011258751.1|2115756_2116350_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
WP_011258752.1|2116548_2117985_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
WP_011258753.1|2118226_2119429_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_011258754.1|2119471_2122300_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_011408361.1|2122480_2123413_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408362.1|2123409_2124909_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_041182090.1|2125246_2125510_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011258758.1|2125789_2126290_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_011258759.1|2126531_2127899_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_109181925.1|2130922_2131685_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408367.1|2133137_2134541_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_042464794.1|2134663_2135086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258770.1|2135718_2136555_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_044756884.1|2136564_2137551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258772.1|2137547_2138423_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_011408371.1|2138419_2138782_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042464800.1|2138784_2139033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408372.1|2139168_2139726_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_027703707.1|2139817_2140783_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408374.1|2140808_2142158_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
WP_011258777.1|2142150_2142387_+	protein SlyX	NA	NA	NA	NA	NA
WP_042464803.1|2142387_2143140_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_042464805.1|2143473_2144319_+	transporter	NA	NA	NA	NA	NA
WP_109182102.1|2144459_2145635_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011408378.1|2145648_2146959_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_103057264.1|2146883_2147942_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011408380.1|2147938_2149144_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_011408381.1|2149530_2152284_-	methionine synthase	NA	NA	NA	NA	NA
WP_011408382.1|2152426_2153566_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
WP_011258786.1|2153562_2154558_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_103057266.1|2154679_2155828_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464808.1|2155827_2155968_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_075239354.1|2156161_2156386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464810.1|2156339_2157785_+	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
WP_011258790.1|2158351_2160880_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
WP_109181926.1|2161090_2161889_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181927.1|2162959_2163721_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_094187736.1|2163753_2164516_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408388.1|2164544_2164892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259046.1|2165050_2166019_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_109181928.1|2167371_2168337_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2168781_2169966_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011408398.1|2170020_2171496_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
WP_109181929.1|2171817_2172000_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_011258800.1|2172148_2173348_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_069960202.1|2174208_2175177_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_109181915.1|2175389_2176709_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258803.1|2176845_2177814_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_109181930.1|2178093_2178892_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181931.1|2179117_2180083_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181932.1|2182312_2183278_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2184309_2185278_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181933.1|2186454_2187557_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
WP_027704061.1|2187743_2188211_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258821.1|2188571_2189336_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258822.1|2189342_2190692_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_094187763.1|2190841_2191640_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408404.1|2192079_2193399_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407175.1|2193611_2194580_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011408405.1|2194643_2195228_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_011258825.1|2195327_2196341_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_109182103.1|2197541_2197637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082322917.1|2197710_2201310_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_011408408.1|2201449_2201749_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_042464821.1|2201752_2201947_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_109181934.1|2202215_2205938_-	avirulence protein	NA	NA	NA	NA	NA
WP_069959831.1|2209205_2213333_-	avirulence protein	NA	NA	NA	NA	NA
WP_109181935.1|2213621_2214941_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109181936.1|2216772_2217858_-	peptidase C13	NA	NA	NA	NA	NA
WP_011408416.1|2218186_2218885_-	acireductone synthase	NA	NA	NA	NA	NA
WP_011408417.1|2218887_2219454_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_011408418.1|2219465_2220143_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_069959832.1|2220231_2221662_-	amino acid permease	NA	NA	NA	NA	NA
WP_011408420.1|2221738_2223220_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258841.1|2223356_2223944_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011258842.1|2224099_2225341_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
WP_011258843.1|2225549_2226968_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011408424.1|2227002_2227302_+	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_011258845.1|2227298_2229170_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011258847.1|2229459_2230479_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_094187828.1|2230472_2230883_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011258849.1|2230900_2231503_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_011408426.1|2231495_2233433_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011258851.1|2233601_2234072_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011258852.1|2234068_2234239_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_109181937.1|2234235_2234988_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_011258853.1|2235082_2235778_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_011408428.1|2235774_2236419_-	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
WP_011408429.1|2236645_2237794_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011408430.1|2237933_2238737_+	amidohydrolase	NA	NA	NA	NA	NA
WP_109181928.1|2238757_2239723_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	2340372	2451807	4968141	transposase,tRNA	Xanthomonas_phage(63.16%)	99	NA	NA
WP_012444952.1|2340372_2341785_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
WP_094187798.1|2342297_2343096_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258940.1|2343409_2343736_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258941.1|2343745_2344660_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258942.1|2344656_2345952_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011408488.1|2345948_2347040_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011258944.1|2347036_2348164_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_011258945.1|2348160_2348763_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011258946.1|2348759_2349494_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011258947.1|2349487_2350264_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011258948.1|2350253_2350874_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_109181941.1|2351459_2355314_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408491.1|2355538_2355838_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_042464821.1|2355841_2356036_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_137455828.1|2356303_2359687_-	avirulence protein	NA	NA	NA	NA	NA
WP_011258951.1|2360138_2360918_-	pectate lyase	NA	NA	NA	NA	NA
WP_075239627.1|2360959_2361058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182117.1|2361811_2361997_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
WP_012444935.1|2361996_2362200_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	70.3	6.1e-16
WP_011258952.1|2362335_2363409_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
WP_011408494.1|2363513_2363813_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
WP_011408495.1|2364176_2364416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057497.1|2364522_2366007_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	1.4e-40
WP_041182119.1|2366008_2366329_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_011408497.1|2366325_2367510_+	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	5.2e-54
WP_109181942.1|2367506_2367737_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	55.6	2.0e-10
WP_075240058.1|2367800_2368202_+	DUF4124 domain-containing protein	NA	A0A077JCA3	Xanthomonas_phage	64.3	3.9e-38
WP_075240059.1|2368845_2369106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408500.1|2369305_2369689_+	hypothetical protein	NA	A0A1D6ZIV0	Xanthomonas_phage	100.0	1.7e-70
WP_011408501.1|2369860_2370508_-	conjugal transfer protein TrbP	NA	A0A1D6ZIU7	Xanthomonas_phage	100.0	3.0e-120
WP_011408502.1|2370509_2371697_-	hypothetical protein	NA	A0A1D6ZIU8	Xanthomonas_phage	100.0	2.8e-217
WP_011408503.1|2371696_2372026_-	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	100.0	3.8e-55
WP_042464851.1|2372025_2373432_-	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	100.0	6.4e-245
WP_011408505.1|2373568_2373799_-	hypothetical protein	NA	A0A1D6ZIT7	Xanthomonas_phage	100.0	1.7e-30
WP_042464854.1|2373810_2374014_-	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	100.0	9.8e-30
WP_011408506.1|2374017_2374314_-	DNA-binding protein	NA	A0A1D6ZIU6	Xanthomonas_phage	100.0	3.6e-49
WP_011408507.1|2374310_2375351_-	replication initiation protein	NA	A0A1D6ZIT9	Xanthomonas_phage	100.0	8.2e-205
WP_109181944.1|2375503_2375716_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	98.6	1.1e-26
WP_011408509.1|2375715_2375901_-	hypothetical protein	NA	A0A1D6ZIV1	Xanthomonas_phage	100.0	1.4e-27
WP_069970101.1|2376028_2376658_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	80.6	2.5e-71
WP_011408511.1|2376782_2376965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168751.1|2377086_2377398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187780.1|2377467_2378230_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2378563_2379532_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_125168752.1|2379894_2380218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075242367.1|2380614_2380857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408516.1|2380831_2381344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181945.1|2381474_2382237_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082325281.1|2383458_2387256_+	avirulence protein	NA	NA	NA	NA	NA
WP_041182100.1|2387524_2387719_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408491.1|2387722_2388022_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_069964534.1|2388245_2392001_+	avirulence protein	NA	NA	NA	NA	NA
WP_109181946.1|2392090_2392853_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042464821.1|2393084_2393279_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011408491.1|2393282_2393582_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_109181947.1|2393722_2397823_+	avirulence protein	NA	NA	NA	NA	NA
WP_011258057.1|2397996_2398218_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011408520.1|2398214_2398886_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_011407237.1|2400140_2401097_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011409456.1|2401860_2402823_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_041182129.1|2403704_2404670_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182130.1|2404647_2408748_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011408397.1|2409056_2410241_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_041182131.1|2410291_2411191_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
WP_011408524.1|2411357_2411864_+	glyoxalase	NA	NA	NA	NA	NA
WP_011258968.1|2412338_2412971_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011258969.1|2412970_2414827_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011408525.1|2414823_2416323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258971.1|2416265_2416730_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_113331422.1|2416726_2417506_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258973.1|2417797_2418838_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258974.1|2418834_2420604_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258975.1|2420600_2421065_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011408526.1|2421068_2421731_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011408527.1|2421759_2424168_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_109181948.1|2424421_2425387_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258980.1|2426780_2427515_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_010378794.1|2427507_2428749_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014503500.1|2428772_2429225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408531.1|2429175_2429424_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_011408532.1|2429534_2430317_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_012444910.1|2430333_2430543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258983.1|2430546_2432337_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_011258984.1|2432371_2432758_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_011258985.1|2432754_2433150_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_012444907.1|2433209_2433476_-	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_109181949.1|2433419_2434292_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_011258986.1|2434420_2435518_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408534.1|2435948_2437379_+	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258988.1|2437375_2438383_+	glucokinase	NA	NA	NA	NA	NA
WP_011258989.1|2438379_2439099_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011258990.1|2439201_2441118_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011408535.1|2441173_2441833_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_044756829.1|2442053_2443430_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	1.3e-77
WP_094187715.1|2443463_2444227_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703995.1|2444269_2444473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258994.1|2445488_2445869_+	response regulator	NA	NA	NA	NA	NA
WP_044756830.1|2446083_2449479_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_094187715.1|2451044_2451807_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	2565882	2613984	4968141	transposase,tRNA	Moumouvirus(16.67%)	44	NA	NA
WP_011408598.1|2565882_2567277_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	7.6e-81
WP_011259080.1|2567278_2567536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408599.1|2567532_2567838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408600.1|2567834_2568161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408603.1|2568887_2569550_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_024744799.1|2569638_2570169_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_011408606.1|2572392_2573664_+	kynureninase	NA	NA	NA	NA	NA
WP_011408607.1|2573835_2575203_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011259089.1|2575506_2576952_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_011259090.1|2576948_2577635_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_011259091.1|2577607_2578627_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011259092.1|2578668_2579229_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_011259093.1|2579249_2580206_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_011408609.1|2580373_2581150_-	NAD kinase	NA	NA	NA	NA	NA
WP_011408610.1|2581633_2583769_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_027703372.1|2583765_2583957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259098.1|2585731_2586238_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259099.1|2586278_2586806_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408612.1|2586802_2587294_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_011408613.1|2587317_2587893_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011259101.1|2587969_2588923_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259102.1|2589011_2589884_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_103057219.1|2589880_2590648_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_011408617.1|2590838_2591537_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408618.1|2591700_2592483_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408619.1|2592491_2592872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259107.1|2592868_2593579_+	endonuclease III	NA	NA	NA	NA	NA
WP_011408621.1|2594889_2595438_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_011258802.1|2595609_2596578_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_044756431.1|2597182_2598418_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_041182144.1|2598981_2599302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259109.1|2599641_2600892_+	porin	NA	NA	NA	NA	NA
WP_103057309.1|2601026_2602100_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.4	5.0e-48
WP_011408626.1|2602287_2603379_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_069959864.1|2603491_2604466_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_069959865.1|2604465_2605335_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259114.1|2605357_2606188_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011408630.1|2606316_2607027_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_109181952.1|2607159_2607573_+	RcnB family protein	NA	NA	NA	NA	NA
WP_094187739.1|2607850_2608492_+	ribonuclease T	NA	NA	NA	NA	NA
WP_109181953.1|2608562_2609882_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464912.1|2610118_2611180_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2611230_2612415_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181954.1|2612664_2613984_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	2620703	2691829	4968141	protease,transposase,tRNA	uncultured_Mediterranean_phage(35.71%)	53	NA	NA
WP_011259125.1|2620703_2621849_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_027703908.1|2621918_2622989_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259127.1|2623175_2623607_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408638.1|2623730_2625227_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011408639.1|2625186_2625501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259129.1|2625571_2626279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259140.1|2629613_2630735_-	phytase	NA	NA	NA	NA	NA
WP_103057211.1|2633007_2633433_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011259142.1|2633625_2634258_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_109181946.1|2634654_2635417_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259143.1|2635697_2636729_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408648.1|2636735_2638529_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_012444765.1|2638525_2638810_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_027703975.1|2638800_2638983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408650.1|2639041_2639527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259147.1|2639585_2640092_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_011259148.1|2640088_2640709_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011408651.1|2640949_2642854_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_109181955.1|2642941_2643999_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_109181956.1|2644096_2645416_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239722.1|2645649_2646807_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_109181957.1|2647083_2648049_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181958.1|2648026_2649502_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
WP_011257031.1|2652041_2653010_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_075243670.1|2653277_2653517_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011259163.1|2655391_2656612_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011259164.1|2656926_2658324_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011259165.1|2658334_2659555_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259166.1|2659551_2660190_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011259167.1|2660260_2661121_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011408658.1|2661117_2661906_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011259169.1|2661916_2663122_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002812972.1|2663140_2663566_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259170.1|2663785_2664418_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259171.1|2664442_2666815_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259172.1|2666972_2668178_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011259173.1|2668498_2669830_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
WP_011408659.1|2669826_2670177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|2670208_2670616_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011259175.1|2670612_2670939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182106.1|2670970_2672347_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.1	8.9e-74
WP_011259177.1|2672583_2676750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259178.1|2676862_2677492_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011259179.1|2677598_2679527_-	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011259180.1|2679689_2682050_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_011259181.1|2682333_2683302_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011408662.1|2683359_2684481_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_042465566.1|2685908_2686661_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002813418.1|2686741_2686960_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011259186.1|2687240_2689523_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	8.7e-175
WP_005914463.1|2689666_2689987_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_011408665.1|2690237_2690696_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011259189.1|2690692_2691829_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 21
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	2773576	2843913	4968141	transposase,tRNA	Ralstonia_phage(46.15%)	47	NA	NA
WP_109181960.1|2773576_2774896_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|2775045_2776014_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_109181961.1|2776108_2776534_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_011409456.1|2776556_2777519_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109181962.1|2777757_2782998_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	39.8	1.6e-09
WP_011257031.1|2783928_2784897_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011407175.1|2786960_2787929_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_125168757.1|2789553_2790033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259260.1|2798157_2798550_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259261.1|2798558_2799020_+	cytochrome c	NA	NA	NA	NA	NA
WP_041182155.1|2799524_2799785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239029.1|2799860_2800103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181963.1|2801542_2802508_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181964.1|2802514_2803660_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_069959881.1|2803784_2804753_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	9.6e-99
WP_075239109.1|2806821_2808558_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	1.8e-15
WP_069960108.1|2809074_2810031_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.8e-41
WP_011257031.1|2810190_2811159_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011259269.1|2811915_2812026_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_012444741.1|2812246_2813512_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259272.1|2813492_2815406_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_011408714.1|2815773_2817018_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
WP_011408715.1|2817182_2818337_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.8	1.2e-47
WP_011259275.1|2818350_2818611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187751.1|2818610_2818979_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408717.1|2818975_2820271_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_041182650.1|2820394_2821345_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_011259279.1|2821957_2823301_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_011259280.1|2823340_2824441_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_011408722.1|2824446_2824899_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259282.1|2825140_2826382_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_011259283.1|2826453_2827479_-	N-acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_027703614.1|2827791_2828286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259285.1|2828456_2829887_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_011408724.1|2830384_2830822_+	SufE family protein	NA	NA	NA	NA	NA
WP_011259287.1|2830818_2832069_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259288.1|2832136_2833198_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_075242610.1|2833340_2834381_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_024710406.1|2834471_2834753_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_011408728.1|2834749_2836099_+	dihydroorotase	NA	NA	NA	NA	NA
WP_011259291.1|2836038_2836938_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.6e-13
WP_094187715.1|2837836_2838599_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259294.1|2838625_2838889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444728.1|2839260_2839749_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_011408734.1|2839972_2841292_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2841428_2842397_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_069964543.1|2842596_2843913_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	2875744	2936835	4968141	protease,transposase,tRNA	Bacillus_virus(22.22%)	51	NA	NA
WP_011259328.1|2875744_2876623_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_011259329.1|2876720_2877620_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011408747.1|2877707_2878448_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011259331.1|2878607_2879183_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408749.1|2879356_2880328_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_109181965.1|2880361_2881303_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259334.1|2881302_2883180_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_012444702.1|2883317_2885051_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_011259336.1|2885103_2885604_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_075243426.1|2885600_2887088_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_069959886.1|2887112_2888180_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_094187715.1|2888294_2889058_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182164.1|2889141_2890479_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.3e-37
WP_069959887.1|2890774_2892037_-	virulence factor	NA	NA	NA	NA	NA
WP_094187754.1|2892253_2893001_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181966.1|2893317_2895153_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	32.9	5.6e-23
WP_041182166.1|2895424_2896516_+	ribonuclease D	NA	NA	NA	NA	NA
WP_080493491.1|2896591_2896981_-	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
WP_011408757.1|2896844_2897195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259345.1|2897608_2898010_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011259346.1|2898516_2898651_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015463309.1|2898873_2899053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703932.1|2899654_2899945_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011408759.1|2899932_2900211_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_080256628.1|2900695_2900884_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408760.1|2901656_2902841_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_109181928.1|2903421_2904387_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408763.1|2908879_2909296_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_011408764.1|2909506_2909833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259352.1|2909865_2910306_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
WP_011259353.1|2910384_2911020_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_012444683.1|2911413_2912157_-	cytochrome c1	NA	NA	NA	NA	NA
WP_011259355.1|2912164_2913424_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_011259356.1|2913423_2914068_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011259357.1|2914597_2915584_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_011408766.1|2917519_2918974_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011408767.1|2919397_2920384_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_011259362.1|2920795_2921458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259363.1|2921512_2921998_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011408769.1|2921997_2922516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408770.1|2922610_2923489_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011259366.1|2923485_2924766_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011259367.1|2924781_2925783_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_011408772.1|2925934_2927299_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011408773.1|2927553_2927964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408774.1|2928119_2928950_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075240820.1|2929263_2930511_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011259371.1|2930656_2932168_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408778.1|2932154_2933741_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408779.1|2933737_2934940_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_109181967.1|2935446_2936835_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	2963477	3022111	4968141	transposase	Ralstonia_phage(60.0%)	34	NA	NA
WP_069959890.1|2963477_2964461_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	1.5e-99
WP_075243462.1|2964402_2964642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408792.1|2964909_2969934_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_011408793.1|2970211_2970871_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408794.1|2970885_2972190_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259395.1|2972202_2975373_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_109181969.1|2976348_2977314_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408798.1|2978020_2979016_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_059317461.1|2979176_2981693_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_011259401.1|2981689_2982646_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_069963855.1|2982804_2984547_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_011408800.1|2984865_2986002_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_011258802.1|2986668_2987637_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_012445230.1|2987997_2989233_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_069959892.1|2989251_2991597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182891.1|2991614_2992346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325293.1|2992377_2994720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|2994744_2995473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959894.1|2995501_2997844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465604.1|2997868_2998612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325294.1|2998642_3001477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964550.1|3001473_3002403_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069964551.1|3002411_3005174_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.2	1.5e-43
WP_041182637.1|3010058_3010448_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_082325566.1|3011974_3014464_-	avirulence protein	NA	NA	NA	NA	NA
WP_041182637.1|3014503_3014893_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_011408813.1|3015047_3016007_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|3015939_3016254_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_011408815.1|3016481_3017801_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259409.1|3018905_3019322_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_103057251.1|3019318_3019627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182107.1|3019568_3019946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259411.1|3020007_3020643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|3021142_3022111_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
>prophage 24
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	3143641	3155416	4968141	tRNA	Escherichia_phage(22.22%)	13	NA	NA
WP_011259503.1|3143641_3143941_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
WP_011259504.1|3143983_3144214_-	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259505.1|3144457_3145207_-	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011408881.1|3145211_3145907_-	hypothetical protein	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_109181974.1|3145842_3146070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444559.1|3146092_3146392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057240.1|3146779_3147184_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	56.6	1.1e-32
WP_003481884.1|3147909_3148122_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_011259507.1|3148261_3150910_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_012444556.1|3151011_3151500_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011408884.1|3151802_3152837_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_011408885.1|3153009_3153651_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408886.1|3153739_3155416_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 25
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	3248346	3349477	4968141	plate,transposase	Ralstonia_phage(66.67%)	73	NA	NA
WP_069959920.1|3248346_3249444_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465048.1|3249860_3252941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033013236.1|3255976_3256684_+	response regulator	NA	NA	NA	NA	NA
WP_011408941.1|3256680_3257673_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259589.1|3257669_3260129_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_011259590.1|3260242_3261223_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408942.1|3261231_3262260_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_080496453.1|3262180_3262477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181977.1|3262426_3263224_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181978.1|3263286_3264084_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444504.1|3264144_3264471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703483.1|3264467_3267371_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_011259593.1|3267367_3268090_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011408946.1|3268086_3268734_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_011408947.1|3268730_3272189_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011408948.1|3272192_3273509_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_011408949.1|3273510_3274848_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_069959924.1|3274844_3276236_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_011408951.1|3276232_3276772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444497.1|3276780_3278718_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
WP_011408952.1|3278982_3279441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168760.1|3279828_3280323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703476.1|3280388_3280886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408953.1|3281074_3283780_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	4.3e-80
WP_011408954.1|3283812_3284823_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011259602.1|3284786_3286664_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259603.1|3286667_3287171_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011259604.1|3287158_3287992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259605.1|3288027_3288531_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_027703472.1|3288630_3290145_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_024711387.1|3290137_3290644_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_109181902.1|3291947_3293267_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|3293479_3294448_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181979.1|3294583_3295900_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257310.1|3296070_3297306_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3297491_3298460_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109181980.1|3298511_3300428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259611.1|3300452_3301190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408961.1|3301220_3303563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465640.1|3303580_3304327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465052.1|3304355_3307190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465054.1|3307847_3309677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445381.1|3309690_3310290_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_012445382.1|3310377_3310734_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_012445383.1|3310730_3311153_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408967.1|3311168_3311402_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_069960235.1|3311428_3311689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704270.1|3312037_3313822_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_027704269.1|3313854_3314841_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_042465057.1|3315251_3318965_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_094187765.1|3319490_3320254_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445389.1|3320357_3321005_-	response regulator	NA	NA	NA	NA	NA
WP_011408973.1|3321226_3321988_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011258802.1|3322145_3323114_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408974.1|3323247_3323613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408975.1|3323671_3324103_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011259625.1|3324114_3325377_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408976.1|3325360_3326653_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011408977.1|3327022_3327793_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011408979.1|3331065_3331323_-	stress-induced protein	NA	NA	NA	NA	NA
WP_011408980.1|3331762_3332746_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011258802.1|3333061_3334030_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408981.1|3334158_3335121_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109181928.1|3336104_3337070_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408985.1|3338277_3339255_+	siroheme synthase	NA	NA	NA	NA	NA
WP_042465070.1|3340063_3340258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408987.1|3341651_3342014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408988.1|3341997_3342567_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_011259640.1|3342604_3343858_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011408989.1|3344063_3344441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082323433.1|3346114_3346321_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011408991.1|3346369_3347605_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|3348442_3349477_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 26
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	3490587	3551061	4968141	protease,transposase,tRNA	Burkholderia_virus(14.29%)	54	NA	NA
WP_094187736.1|3490587_3491351_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_125168762.1|3492183_3492429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259756.1|3492374_3494741_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011409066.1|3494737_3495412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259758.1|3495621_3496560_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011259759.1|3496682_3498032_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259760.1|3498028_3498916_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011409067.1|3499233_3500040_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011259762.1|3500485_3501703_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011409068.1|3501808_3502777_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
WP_011259764.1|3503161_3503830_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_011259765.1|3503826_3504600_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_094187839.1|3505173_3507240_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|3507806_3508832_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409070.1|3508916_3509990_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259771.1|3509982_3511086_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_011259772.1|3511096_3512023_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011259773.1|3512103_3512754_+	SCO family protein	NA	NA	NA	NA	NA
WP_011409071.1|3512750_3513599_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_041182211.1|3514149_3515733_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_012445550.1|3515652_3515838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057205.1|3517155_3518373_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_103057775.1|3518333_3518570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409076.1|3518731_3519238_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_011259780.1|3519359_3520760_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_012445553.1|3521022_3521598_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011409078.1|3521594_3522029_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259782.1|3522056_3522224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133262000.1|3522224_3522749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259783.1|3522994_3523180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|3523214_3523784_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259785.1|3523876_3524728_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259787.1|3526115_3528131_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445555.1|3528401_3529100_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409081.1|3529140_3529548_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_011409082.1|3529985_3530948_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409084.1|3532231_3533482_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011409085.1|3533489_3534734_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011259794.1|3534961_3535441_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027704197.1|3535551_3536088_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259796.1|3536197_3536947_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_011259797.1|3537154_3537646_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_125168763.1|3537658_3537886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409088.1|3538759_3540079_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_109181983.1|3540222_3541929_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011409090.1|3541962_3543267_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259802.1|3543298_3543559_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011409091.1|3543560_3544436_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027704198.1|3546270_3546735_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|3546786_3546975_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_069963878.1|3546947_3547268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465665.1|3547264_3548632_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011409095.1|3548777_3549359_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_011259808.1|3549615_3551061_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 27
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	3570161	3620309	4968141	integrase,transposase,tRNA	Ralstonia_phage(33.33%)	40	3594426:3594485	3611096:3611759
WP_011259825.1|3570161_3572804_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_011259826.1|3572876_3573488_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011409107.1|3573692_3574550_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011409108.1|3574805_3575255_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_109181928.1|3575554_3576520_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3576644_3577407_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704065.1|3578017_3578311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407489.1|3578905_3580225_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109181985.1|3580294_3580495_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_011409111.1|3580528_3581542_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259831.1|3581509_3581701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181986.1|3581791_3583111_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182217.1|3583198_3584413_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_011259834.1|3584558_3585086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181987.1|3585082_3586048_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187771.1|3586288_3587051_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409116.1|3587353_3589486_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011258529.1|3590036_3591005_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011258803.1|3591165_3592134_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_082325317.1|3593209_3593623_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|3593619_3594383_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
3594426:3594485	attL	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTC	NA	NA	NA	NA
WP_094187763.1|3595254_3596052_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409118.1|3596085_3596478_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_027704094.1|3596568_3596961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239728.1|3599299_3599719_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
WP_075239565.1|3600946_3601171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445601.1|3601435_3603220_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_011259851.1|3603410_3603611_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011409125.1|3604146_3604941_+	thiazole synthase	NA	NA	NA	NA	NA
WP_075239634.1|3604933_3605227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259853.1|3605242_3606001_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011259854.1|3606076_3607939_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_011409127.1|3607996_3608338_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259856.1|3608597_3608873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409129.1|3611919_3612633_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
3611096:3611759	attR	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTCAGCACAAGCCCAAACGCGGATGACGGCGTACAACGGCGGCCACACGCAGCTGGGTGCCGGAGGAGTTGCGGATTGTGCATCGCCCCGAAGAAGTGCAGACGCGCTTGGTCCCAGGTCATTGGGAAGGCGACTTGATCAAGGGCGCATTCAATCGTTCTTGCGTGGGCACGTTGGTGGAACGCAAGACGCGCTTTGTCGTGCTGTGCCGCATGGATGGCTGCACGGCCGCAGATGCGCTGGAAGGGTTTACCCGGCAAATGAAGAAACTGCCGGCCTCAATGCGGACAAGTCTGACCTACGATCGCGGTACCGAGCTCACGTGCTACGCCGAGCTGATGCAAGGATTGAACATCGACGTGTGGTTCGCTGATCCACATGCGCCGTGGCAGCGGGGAAGTAACGAGAACACCAACGGCCTGCTGCGCCAATTCCTGCCCAAGGGCGCCGACCTGTCCACTGTCAGCCAAGAGTATCTCAATCACATCGCACTGCTGATGAATACCCGCCCTCGTCAGACGCTCGGATGGAAGACACCAAGCGAGGCAATGGAGGAAGAAATCGCAGCACTCAAATCACGTGTTGCACTTGAATCTTGAGACTGCCC	NA	NA	NA	NA
WP_012445603.1|3612693_3613116_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_094187715.1|3613247_3614011_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409134.1|3617084_3617996_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_033013519.1|3618511_3618649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181988.1|3619343_3620309_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	3667759	3738670	4968141	plate,transposase	Ralstonia_phage(15.38%)	51	NA	NA
WP_011407175.1|3667759_3668728_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407587.1|3669748_3670783_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011259895.1|3671166_3671892_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409154.1|3672023_3672485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704153.1|3675651_3677772_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_027704154.1|3678038_3678884_-	transporter	NA	NA	NA	NA	NA
WP_075239009.1|3679140_3679503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|3679875_3680844_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011259903.1|3681168_3683139_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_011259904.1|3683567_3684965_+	endoproteinase ArgC	NA	NA	NA	NA	NA
WP_027704156.1|3685077_3685896_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011409162.1|3686206_3689404_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	6.0e-81
WP_075239010.1|3689444_3689627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259908.1|3689639_3691058_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_082348427.1|3691067_3691670_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011409164.1|3691719_3692325_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
WP_011259911.1|3692474_3692696_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409165.1|3692705_3693131_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
WP_094187731.1|3693622_3694420_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409167.1|3695497_3696277_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409168.1|3696491_3697121_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027704159.1|3697181_3697937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069963882.1|3698265_3699042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069963883.1|3699014_3699281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182229.1|3699450_3701025_+	protein kinase	NA	NA	NA	NA	NA
WP_011409172.1|3701273_3701540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964578.1|3701818_3704998_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.3	4.6e-73
WP_069963885.1|3704997_3705672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959956.1|3705671_3706418_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_075242182.1|3706414_3707926_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_011409179.1|3707918_3708353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182476.1|3708363_3709893_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	29.3	2.5e-45
WP_011409181.1|3710195_3711188_-	restriction endonuclease	NA	A0A1B1IUE7	uncultured_Mediterranean_phage	29.2	1.5e-30
WP_044756557.1|3711240_3711549_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_109182111.1|3712129_3715603_+	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	21.9	1.9e-08
WP_109181989.1|3715742_3716741_+	Abi family protein	NA	NA	NA	NA	NA
WP_011409185.1|3716787_3718332_+	type I restriction-modification system subunit M	NA	A0A220A2U5	Liberibacter_phage	23.9	2.0e-13
WP_115844559.1|3718309_3719677_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011259929.1|3719710_3720019_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011259930.1|3720025_3720289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082323166.1|3721011_3721767_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_109181990.1|3722060_3723092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181991.1|3723100_3725035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181992.1|3724946_3725909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181993.1|3725986_3728851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181994.1|3728869_3729775_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069963891.1|3729716_3732488_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	5.1e-44
WP_011259938.1|3732580_3732934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259939.1|3732964_3735694_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_011259940.1|3735779_3736871_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_069959967.1|3736834_3738670_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 29
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	4156216	4251340	4968141	transposase	Ralstonia_phage(17.65%)	66	NA	NA
WP_109182118.1|4156216_4157824_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075242322.1|4157985_4158249_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_075242321.1|4158253_4158913_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
WP_011260279.1|4159099_4160464_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_011409411.1|4160679_4161375_+	VIT family protein	NA	NA	NA	NA	NA
WP_011409413.1|4162321_4162945_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011409414.1|4163146_4163887_+	cytochrome c4	NA	NA	NA	NA	NA
WP_011409415.1|4163980_4164631_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260284.1|4164722_4165538_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011409416.1|4165587_4166325_+	endonuclease	NA	NA	NA	NA	NA
WP_011409419.1|4168253_4169243_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_109182011.1|4169365_4171939_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_109182012.1|4172131_4172894_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|4172967_4173936_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011409421.1|4174669_4174936_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094187728.1|4175867_4176666_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|4178312_4179545_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_011409423.1|4179584_4180547_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|4180722_4181679_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258802.1|4181890_4182859_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187715.1|4183194_4183957_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182013.1|4187367_4188333_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012444134.1|4188794_4189025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409428.1|4189649_4191692_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_011409429.1|4191693_4193592_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011260297.1|4193593_4194847_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_011260298.1|4194843_4195449_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_011409430.1|4195868_4197023_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_011260300.1|4197025_4198054_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_011409431.1|4198050_4199127_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260302.1|4199167_4200445_-	sugar MFS transporter	NA	NA	NA	NA	NA
WP_011409432.1|4200489_4201257_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409433.1|4201471_4202638_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_011260306.1|4205181_4208079_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
WP_011260307.1|4208229_4210920_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409437.1|4211201_4212158_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.6e-42
WP_082325343.1|4212191_4212404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182014.1|4212648_4213884_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260311.1|4215319_4216504_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011409442.1|4216571_4217309_+	pteridine reductase	NA	NA	NA	NA	NA
WP_011260313.1|4217477_4217993_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011260314.1|4218084_4219587_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
WP_011260315.1|4219590_4220031_-	response regulator	NA	NA	NA	NA	NA
WP_011409443.1|4220027_4221839_-	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
WP_011409444.1|4222124_4222487_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_011260318.1|4222646_4223699_+	oxidoreductase	NA	NA	NA	NA	NA
WP_011260319.1|4224038_4224980_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
WP_075239460.1|4225000_4226338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409446.1|4226509_4226890_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_012444115.1|4227014_4227776_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_011409450.1|4230024_4231428_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.5	8.1e-131
WP_011260326.1|4231550_4232606_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.3e-80
WP_103057229.1|4232778_4233633_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011260328.1|4233924_4236108_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.6	2.8e-82
WP_041182498.1|4236606_4237602_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_041182275.1|4237697_4239509_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_011260331.1|4239753_4240767_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_011260332.1|4240781_4241480_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_011409453.1|4241467_4241746_-	YbeD family protein	NA	NA	NA	NA	NA
WP_011260334.1|4242811_4244017_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
WP_011260335.1|4244517_4245933_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_011260336.1|4245929_4247069_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_125168765.1|4248294_4248837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409455.1|4248808_4250083_-	DUF3380 domain-containing protein	NA	B3FJ91	Pseudomonas_phage	33.7	1.2e-21
WP_075242420.1|4250082_4250301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409456.1|4250377_4251340_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	4265403	4320260	4968141	protease,transposase	Erwinia_phage(25.0%)	40	NA	NA
WP_011257031.1|4265403_4266372_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_094187763.1|4266427_4267225_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260350.1|4268366_4268822_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_027703680.1|4268818_4269319_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260353.1|4270569_4271646_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_011409470.1|4273372_4274134_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_011409471.1|4274306_4275197_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_011409472.1|4275318_4277331_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409473.1|4277502_4278222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182583.1|4278530_4279145_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011260359.1|4279318_4280686_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.1	6.2e-43
WP_011260360.1|4280796_4281348_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_011409475.1|4281863_4282781_-	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	27.7	2.2e-12
WP_011260362.1|4282980_4283661_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_011260363.1|4283648_4284503_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_044756411.1|4284492_4284729_-	sugar transporter	NA	NA	NA	NA	NA
WP_044757316.1|4284786_4285185_-	YbaN family protein	NA	NA	NA	NA	NA
WP_027703683.1|4285528_4287664_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	2.1e-29
WP_011409479.1|4287787_4288972_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011409480.1|4289297_4289729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409481.1|4289811_4291905_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409482.1|4291972_4292284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260370.1|4292671_4293241_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_011260371.1|4293349_4294315_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260372.1|4294873_4295674_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_011409484.1|4296224_4297139_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011409485.1|4297169_4297907_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011260375.1|4297937_4298990_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
WP_011260376.1|4298994_4299663_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011260377.1|4299814_4301752_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_094187780.1|4302478_4303241_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075240244.1|4303367_4303628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260378.1|4303555_4305205_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_011409489.1|4306605_4308093_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.7	1.0e-123
WP_011260380.1|4308300_4309749_+	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.3	7.5e-47
WP_109182017.1|4310983_4313608_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.6	1.9e-08
WP_011260383.1|4313863_4316734_+	insulinase family protein	NA	NA	NA	NA	NA
WP_011409493.1|4317281_4318211_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011409494.1|4318249_4319254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|4319496_4320260_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	4370166	4418105	4968141	transposase	Ralstonia_phage(75.0%)	45	NA	NA
WP_011257031.1|4370166_4371135_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011409528.1|4371566_4372892_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_109182019.1|4373256_4374327_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_011260425.1|4374497_4374986_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409530.1|4375342_4375933_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_133262007.1|4375944_4377453_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.6	5.0e-62
WP_011260428.1|4377895_4378789_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_011409533.1|4380171_4380837_+	pyruvate dehydrogenase E1 subunit alpha	NA	NA	NA	NA	NA
WP_109182021.1|4381469_4382435_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260435.1|4382967_4383348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057253.1|4383550_4384456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409537.1|4384524_4385820_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_094187850.1|4385910_4386474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260439.1|4386899_4388165_-	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409539.1|4388161_4389139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444011.1|4389242_4390046_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_109182022.1|4390221_4391031_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_109182023.1|4391038_4391837_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187851.1|4391879_4392527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409543.1|4392621_4393197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181902.1|4393408_4394728_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011409545.1|4394877_4395846_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409546.1|4395971_4396724_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011260447.1|4396761_4397202_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_103057307.1|4397116_4397341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409547.1|4397408_4397750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260449.1|4397975_4398353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260450.1|4398563_4398761_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_011409548.1|4399067_4399814_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409549.1|4399906_4400713_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_012444005.1|4400936_4402349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260454.1|4402345_4403443_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_094187763.1|4403597_4404396_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099051302.1|4404449_4405248_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409552.1|4405467_4406430_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182024.1|4406877_4407641_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260456.1|4407922_4408699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409554.1|4408695_4410012_+	amino acid permease	NA	NA	NA	NA	NA
WP_011408623.1|4410528_4411764_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260459.1|4412357_4412639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960022.1|4413199_4413637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|4413639_4414608_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409559.1|4414968_4416147_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_125168767.1|4416143_4416509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960023.1|4417142_4418105_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	4423272	4492605	4968141	transposase,tRNA	Acinetobacter_phage(25.0%)	55	NA	NA
WP_069964611.1|4423272_4424337_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.6	4.3e-100
WP_002808376.1|4424616_4424832_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_011409564.1|4425154_4425601_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
WP_012443989.1|4427078_4428041_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_011260472.1|4428130_4429879_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
WP_041182298.1|4431206_4431452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059317500.1|4431451_4431718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013369.1|4431942_4432989_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_011409569.1|4433172_4434753_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011409570.1|4435141_4436038_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_011260477.1|4436040_4437204_-	heme A synthase	NA	NA	NA	NA	NA
WP_011260478.1|4437214_4437790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409571.1|4437817_4438537_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_012443949.1|4438597_4438816_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_011260481.1|4438915_4439791_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_012443948.1|4439829_4440426_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011409573.1|4440422_4440596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260484.1|4440576_4442181_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_069964612.1|4442219_4443173_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_044757542.1|4443189_4443666_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_011260487.1|4443942_4447143_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_109182027.1|4448358_4449324_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_069960028.1|4449336_4449807_-	bacterioferritin	NA	NA	NA	NA	NA
WP_027703893.1|4450149_4450365_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011260490.1|4450445_4451063_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005990700.1|4451611_4452004_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260491.1|4452007_4452436_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_069960112.1|4452621_4453275_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_011409578.1|4453531_4453846_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260494.1|4454005_4454800_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_011260495.1|4454937_4455630_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_011409579.1|4455950_4456667_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011260497.1|4456659_4457457_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
WP_011409580.1|4457593_4458631_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_011260499.1|4458748_4459378_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_041182300.1|4459374_4459533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409581.1|4459529_4460111_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_094187806.1|4461538_4462640_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
WP_011409585.1|4463244_4465476_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_069960113.1|4465665_4467378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964614.1|4467526_4468903_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.5	3.7e-80
WP_094187777.1|4471110_4471909_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069964474.1|4472893_4473862_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_069960033.1|4474028_4475000_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
WP_109182028.1|4475192_4476377_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011260517.1|4476844_4477660_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_011409596.1|4478418_4479735_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011260520.1|4479994_4481239_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011260521.1|4481331_4484580_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_011409597.1|4484713_4487854_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011409598.1|4488143_4489511_-	VOC family protein	NA	NA	NA	NA	NA
WP_012443929.1|4489520_4489730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113013964.1|4489645_4489927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|4490255_4491221_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182029.1|4491639_4492605_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	4505314	4579046	4968141	integrase,transposase,tRNA	Leptospira_phage(20.0%)	51	4520040:4520059	4533923:4533942
WP_011260538.1|4505314_4505791_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011409604.1|4505817_4506279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010370565.1|4506664_4506985_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_011260540.1|4507086_4508103_+	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011260541.1|4508174_4509338_+	Fic family protein	NA	NA	NA	NA	NA
WP_011260542.1|4509334_4510966_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.5	1.7e-63
WP_042465275.1|4510967_4513469_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_011260544.1|4513465_4514368_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409606.1|4514589_4514973_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011260546.1|4515291_4516962_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_011409607.1|4517190_4518201_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.6	1.5e-14
WP_011260548.1|4518265_4518424_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_075240671.1|4518441_4518660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260549.1|4518658_4520035_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
4520040:4520059	attL	GGTTTTTCAGGGGCGACTAT	NA	NA	NA	NA
WP_041182305.1|4520045_4520579_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409609.1|4521007_4522267_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_011260552.1|4522405_4523713_-	MFS transporter	NA	NA	NA	NA	NA
WP_011407587.1|4525797_4526832_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409611.1|4527182_4527728_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_011409612.1|4527753_4528020_-	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011260556.1|4528194_4530033_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011260557.1|4530263_4531139_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
WP_012445230.1|4532624_4533860_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_103057293.1|4534281_4534545_-	xanthomonadin biosynthesis protein	NA	NA	NA	NA	NA
4533923:4533942	attR	GGTTTTTCAGGGGCGACTAT	NA	NA	NA	NA
WP_075240199.1|4536836_4537736_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_011260561.1|4538683_4541485_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
WP_011409617.1|4541561_4541852_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_109182030.1|4542209_4543237_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.4	3.9e-42
WP_075240612.1|4543415_4544006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133260589.1|4544146_4545052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014504812.1|4545241_4547929_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_109182031.1|4550989_4551958_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.8e-97
WP_141062011.1|4552410_4556352_+	avirulence protein	NA	NA	NA	NA	NA
WP_011409629.1|4558040_4558553_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	68.8	1.6e-44
WP_075244060.1|4558549_4558777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075243631.1|4559060_4559507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075243633.1|4559625_4561632_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_012443890.1|4561628_4562060_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_011260579.1|4562056_4562476_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_109182032.1|4562961_4563714_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_011409633.1|4563924_4564515_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_011409634.1|4564648_4565596_+	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_027703830.1|4566491_4566992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409640.1|4570079_4570640_+	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	29.6	2.1e-13
WP_011409641.1|4570735_4573561_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_011260589.1|4573722_4574241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409642.1|4574240_4575161_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_011260591.1|4575589_4576213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465293.1|4576222_4576408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465296.1|4576510_4577131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182033.1|4578080_4579046_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	4656587	4714890	4968141	transposase,tRNA	Leptospira_phage(33.33%)	34	NA	NA
WP_109182036.1|4656587_4657553_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260658.1|4657653_4658079_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094187715.1|4658121_4658884_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260659.1|4658946_4659978_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.0e-70
WP_011260660.1|4661338_4662595_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011260661.1|4662591_4663482_+	allantoinase PuuE	NA	NA	NA	NA	NA
WP_012443820.1|4663478_4663874_+	DUF3225 domain-containing protein	NA	NA	NA	NA	NA
WP_075239612.1|4663893_4664472_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_115801912.1|4664357_4665215_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_011409690.1|4665147_4666536_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082322876.1|4667575_4667770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260667.1|4671321_4673406_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260668.1|4673505_4675533_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011260669.1|4675775_4677386_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_011260670.1|4677396_4678560_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011409694.1|4678688_4679309_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260672.1|4679870_4680206_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_075242289.1|4681830_4682142_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_011409699.1|4683260_4683779_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_011409700.1|4684050_4685769_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011260679.1|4685859_4686246_-	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_011260680.1|4686307_4687633_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_113331519.1|4687747_4689061_-	type III effector protein XopR	NA	NA	NA	NA	NA
WP_011260682.1|4689159_4689885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409701.1|4690101_4690764_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409702.1|4690842_4691937_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011409705.1|4693441_4696201_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.9	3.5e-146
WP_011409706.1|4696453_4698043_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_011409707.1|4698042_4700280_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011409708.1|4700568_4701477_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011409709.1|4701566_4703381_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_103057247.1|4703766_4712223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182038.1|4712690_4713488_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409735.1|4713570_4714890_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	4725141	4766939	4968141	transposase,tRNA	Escherichia_phage(25.0%)	28	NA	NA
WP_011260702.1|4725141_4726059_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_012443788.1|4726149_4726659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259480.1|4726662_4728000_+	xylose isomerase	NA	NA	NA	NA	NA
WP_011409721.1|4728225_4729293_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409722.1|4729468_4731664_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409723.1|4731660_4733625_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409724.1|4733636_4734896_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_011260707.1|4734895_4736596_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011260708.1|4736598_4739313_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260709.1|4739535_4741008_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_011260711.1|4741985_4743041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260712.1|4743268_4744687_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_011409725.1|4744727_4745705_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_011409726.1|4747121_4748603_-	MFS transporter	NA	NA	NA	NA	NA
WP_099051314.1|4748944_4751818_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409728.1|4751916_4753404_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260718.1|4753435_4754470_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_094187716.1|4754886_4755684_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082324403.1|4756560_4756698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182039.1|4756990_4757947_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_109182040.1|4758674_4759437_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075242372.1|4759454_4760555_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011260725.1|4760620_4761742_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_011260726.1|4761751_4762846_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260727.1|4762920_4763601_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_109182041.1|4763633_4764432_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409735.1|4764560_4765880_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465802.1|4765982_4766939_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.4e-41
>prophage 36
NZ_CP033187	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4968141	4799592	4848166	4968141	tail,transposase	Arthrobacter_phage(25.0%)	37	NA	NA
WP_011409756.1|4799592_4800138_+|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_011260754.1|4800206_4800734_+|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011260755.1|4800792_4801329_+|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
WP_109182045.1|4801416_4802382_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027704180.1|4802664_4803297_-	superoxide dismutase family protein	NA	M1ICI8	Paramecium_bursaria_Chlorella_virus	41.0	7.8e-17
WP_011409759.1|4803367_4803847_-	superoxide dismutase family protein	NA	I3XM75	Mamestra_brassicae_nuclear_polyhedrosis_virus	40.6	6.1e-14
WP_011409760.1|4804468_4805896_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_011260761.1|4805888_4806944_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011260762.1|4807214_4808690_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	32.2	2.0e-31
WP_011260763.1|4808679_4809018_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_011260764.1|4809295_4810705_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_011260765.1|4810926_4811724_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_011260766.1|4811860_4812667_+	META domain-containing protein	NA	NA	NA	NA	NA
WP_011409764.1|4813820_4814432_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_011409765.1|4814626_4816699_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011260769.1|4817112_4818102_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409766.1|4818161_4818965_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_011260771.1|4819084_4819513_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_011260772.1|4819804_4821820_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_011260773.1|4821816_4822389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409767.1|4822392_4822869_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409768.1|4822884_4823517_-	ParA family protein	NA	A0A142F1W4	Mycobacterium_phage	36.6	1.6e-09
WP_011260776.1|4823869_4824787_-	AEC family transporter	NA	NA	NA	NA	NA
WP_011260779.1|4825878_4829586_+	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_011260780.1|4829728_4830349_+	helix-turn-helix transcriptional regulator	NA	A0A0K1LLP9	Caulobacter_phage	41.9	1.9e-07
WP_011260781.1|4830345_4831623_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_011260782.1|4831667_4832654_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_011409772.1|4832650_4833934_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_011260784.1|4834005_4835187_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_042465359.1|4835473_4836946_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011409774.1|4836942_4837680_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.1	1.5e-19
WP_011409775.1|4837728_4838061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260788.1|4838113_4839319_-	aminotransferase	NA	NA	NA	NA	NA
WP_011409777.1|4839478_4840324_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.7	3.7e-06
WP_011409779.1|4842017_4843055_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_011258802.1|4845547_4846516_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109182046.1|4847063_4848166_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
