The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043559	Bacillus altitudinis strain CHB19 chromosome, complete genome	3867833	513909	557267	3867833	portal,coat,tail,head,integrase,terminase,protease,tRNA	uncultured_Caudovirales_phage(41.46%)	61	500880:500894	534112:534126
500880:500894	attL	TCCTTCGCATCTTGA	NA	NA	NA	NA
WP_135010005.1|513909_514386_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_061418121.1|514366_515056_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_008344382.1|515081_515510_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_024719329.1|515502_516531_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.7	2.1e-67
WP_135010004.1|516999_518922_-	ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	29.1	8.1e-57
WP_026050052.1|519060_519552_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_008355687.1|519567_520221_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_008344374.1|520248_520428_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_096881072.1|520434_521199_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_024719332.1|521238_521865_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_017366710.1|521922_522117_-	YdiK family protein	NA	NA	NA	NA	NA
WP_024719333.1|522113_522848_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003214120.1|523077_523362_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	50.5	3.7e-19
WP_007496015.1|523418_525053_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	55.2	2.6e-157
WP_039962457.1|525129_526338_-|integrase	tyrosine-type recombinase/integrase	integrase	S6C485	Thermus_phage	44.7	1.6e-87
WP_007496145.1|526351_526825_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_007496143.1|527335_527899_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	48.1	4.7e-29
WP_007496141.1|528205_528580_-	helix-turn-helix transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	35.9	2.9e-11
WP_039962456.1|528748_528991_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_135010002.1|529002_529308_+	DNA-binding protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	42.6	1.5e-13
WP_135010001.1|529304_530051_+	phage regulatory protein	NA	A0A2H4J4N4	uncultured_Caudovirales_phage	97.6	9.6e-131
WP_135009999.1|530109_530679_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	92.1	2.4e-97
WP_135010330.1|530681_530960_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	84.8	1.6e-35
WP_135009997.1|531166_531346_+	hypothetical protein	NA	A0A2H4JCC7	uncultured_Caudovirales_phage	93.2	1.4e-24
WP_135009995.1|531347_532298_+	hypothetical protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	97.2	5.8e-173
WP_135009993.1|532297_533137_+	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	96.4	1.6e-150
WP_135009991.1|533114_533294_+	hypothetical protein	NA	A0A2P1JTZ9	Anoxybacillus_phage	54.4	1.6e-12
WP_135009989.1|533298_533961_+	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	77.1	2.0e-79
WP_135009987.1|533863_534793_+	ATP-binding protein	NA	Q0H276	Geobacillus_phage	41.9	8.5e-44
534112:534126	attR	TCAAGATGCGAAGGA	NA	NA	NA	NA
WP_135009985.1|535063_535282_+	hypothetical protein	NA	A0A2H4JDM0	uncultured_Caudovirales_phage	95.8	9.8e-36
WP_135009983.1|535400_535856_+	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	94.0	3.6e-72
WP_113747653.1|536191_536401_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	98.5	2.0e-30
WP_135009981.1|536417_536651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135009979.1|536647_536896_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	93.8	3.0e-33
WP_135009977.1|536892_537657_+	DNA (cytosine-5-)-methyltransferase	NA	A0A0K2CYZ1	Paenibacillus_phage	42.7	9.7e-54
WP_135009975.1|537677_538046_+	hypothetical protein	NA	A0A2I7RB32	Vibrio_phage	40.9	4.4e-20
WP_135009973.1|538045_538405_+	hypothetical protein	NA	A0A060QR75	Streptococcus_phage	36.4	8.7e-05
WP_135010328.1|538843_539044_+	hypothetical protein	NA	A0A2H4JDM6	uncultured_Caudovirales_phage	78.8	1.3e-21
WP_135009971.1|539213_539639_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	92.2	9.1e-70
WP_135009969.1|539808_540021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135009967.1|540258_540747_+	Fis family transcriptional regulator	NA	A0A2H4J6J3	uncultured_Caudovirales_phage	96.3	1.1e-79
WP_135009965.1|540750_541206_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	93.4	1.1e-76
WP_149712596.1|541669_541897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135009961.1|541940_542684_+	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	86.2	2.6e-96
WP_135009959.1|542670_543975_+|terminase	PBSX family phage terminase large subunit	terminase	Q4ZC75	Staphylococcus_virus	61.4	8.2e-154
WP_135009957.1|543994_545449_+|portal	phage portal protein	portal	A0A1Q1PVT0	Bacillus_phage	50.2	8.1e-126
WP_135009956.1|545429_546350_+|head	phage head morphogenesis protein	head	A0A1Q1PVS4	Bacillus_phage	48.2	8.6e-73
WP_135009954.1|546353_546620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135009952.1|546776_547442_+	scaffolding protein	NA	A0A1Z1LZK8	Bacillus_phage	33.1	6.1e-12
WP_135009950.1|547454_548441_+|coat	coat protein	coat	D7RWJ0	Brochothrix_phage	36.2	3.8e-50
WP_080673871.1|548400_548703_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	64.2	1.0e-22
WP_024720103.1|548703_548895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135009948.1|548899_549196_+	hypothetical protein	NA	Q4ZC67	Staphylococcus_virus	40.0	9.3e-13
WP_135009946.1|549189_549531_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_135009944.1|549523_549943_+	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	53.7	3.6e-34
WP_007496092.1|549958_550357_+	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	43.1	8.4e-25
WP_135009942.1|550370_550892_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_135009940.1|550857_551154_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	69.8	1.7e-27
WP_039167456.1|551222_551732_+	phage protein	NA	A0A1W6JQN4	Staphylococcus_phage	36.5	7.0e-16
WP_039167454.1|551749_552058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135009938.1|552062_557267_+	hypothetical protein	NA	A8ATV9	Listeria_phage	45.9	5.8e-33
>prophage 2
NZ_CP043559	Bacillus altitudinis strain CHB19 chromosome, complete genome	3867833	598729	608625	3867833		Synechococcus_phage(50.0%)	9	NA	NA
WP_008344295.1|598729_600025_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	26.9	2.9e-18
WP_007496901.1|600097_600820_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	43.7	1.8e-46
WP_008344293.1|600812_601067_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FKD5	Synechococcus_phage	33.3	1.6e-05
WP_008344292.1|601063_601747_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_024719398.1|601730_603962_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.1	1.7e-159
WP_135009885.1|603937_605368_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	1.0e-51
WP_045034422.1|605464_606505_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	44.1	8.8e-66
WP_008344288.1|606501_607071_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.5	2.9e-31
WP_135009883.1|607086_608625_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.8	6.2e-76
>prophage 3
NZ_CP043559	Bacillus altitudinis strain CHB19 chromosome, complete genome	3867833	979999	1021428	3867833	holin,portal,plate,integrase,terminase,capsid	uncultured_Caudovirales_phage(84.0%)	60	981664:981683	1023385:1023404
WP_135009080.1|979999_980860_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	44.2	4.9e-54
WP_003210924.1|980924_981155_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_076839278.1|981444_981696_+	competence protein ComK	NA	NA	NA	NA	NA
981664:981683	attL	GGTATTTCCCACAAGCCTCC	NA	NA	NA	NA
WP_135009079.1|981765_982959_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	42.6	3.3e-85
WP_135009078.1|982972_983476_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	93.4	6.3e-86
WP_135009077.1|983541_984474_-	hypothetical protein	NA	A0A2H4JCX8	uncultured_Caudovirales_phage	83.2	2.8e-119
WP_135009076.1|984668_985028_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	95.8	1.8e-55
WP_135009140.1|985190_985415_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	98.6	1.1e-34
WP_135009075.1|985426_985732_+	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	50.0	5.6e-21
WP_135009074.1|985728_986475_+	phage regulatory protein	NA	A0A2H4J4N4	uncultured_Caudovirales_phage	94.0	3.5e-125
WP_135009073.1|986533_987103_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	80.4	4.3e-83
WP_135009072.1|987099_987378_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	71.7	2.8e-27
WP_008348780.1|987584_987764_+	hypothetical protein	NA	A0A2H4JCC7	uncultured_Caudovirales_phage	93.2	2.4e-24
WP_135009071.1|987766_988717_+	hypothetical protein	NA	S6C475	Thermus_phage	60.8	9.4e-107
WP_008348775.1|988709_989582_+	recombination protein RecT	NA	S6AVW6	Thermus_phage	61.0	4.0e-88
WP_008348773.1|989556_989739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135009070.1|989743_990391_+	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	67.0	9.7e-63
WP_135009069.1|990293_991223_+	ATP-binding protein	NA	Q0H276	Geobacillus_phage	40.7	1.2e-42
WP_135009068.1|991492_991927_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	64.2	1.7e-42
WP_098676736.1|992176_992380_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	87.7	1.1e-25
WP_135009067.1|992404_992653_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	91.4	7.5e-32
WP_135009066.1|992649_993906_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	44.2	1.7e-116
WP_135009065.1|993926_994913_+	site-specific DNA-methyltransferase	NA	A0A2H4JD00	uncultured_Caudovirales_phage	94.2	7.6e-168
WP_135009064.1|995033_996368_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_017360268.1|996381_996912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135009063.1|997011_997467_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	98.7	3.2e-81
WP_075611155.1|997886_998114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135009062.1|998157_998925_+	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	97.6	3.2e-129
WP_135009061.1|998911_1000114_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	98.2	4.8e-233
WP_135009060.1|1000118_1001540_+|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	95.3	1.5e-254
WP_008348727.1|1001523_1001742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135009059.1|1001824_1002403_+	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	96.9	3.8e-95
WP_135009058.1|1002414_1003350_+|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	90.4	2.7e-159
WP_135009057.1|1003507_1004371_+	hypothetical protein	NA	A0A2H4JD21	uncultured_Caudovirales_phage	94.8	9.0e-149
WP_008348715.1|1004370_1004706_+	hypothetical protein	NA	A0A2H4J6J9	uncultured_Caudovirales_phage	98.2	3.2e-54
WP_135009056.1|1004710_1005211_+	hypothetical protein	NA	A0A2H4J4S5	uncultured_Caudovirales_phage	97.0	2.2e-86
WP_008348711.1|1005210_1005561_+	hypothetical protein	NA	A0A2H4JDP3	uncultured_Caudovirales_phage	94.8	9.5e-57
WP_135009055.1|1005553_1006033_+	hypothetical protein	NA	A0A2H4J4R9	uncultured_Caudovirales_phage	97.5	3.9e-85
WP_008348702.1|1006037_1007072_+	DUF3383 family protein	NA	A0A2H4J8B9	uncultured_Caudovirales_phage	98.8	4.3e-190
WP_008348701.1|1007086_1007488_+	DUF3277 family protein	NA	A0A2H4J4R5	uncultured_Caudovirales_phage	89.1	4.0e-59
WP_039956529.1|1007579_1007882_+	hypothetical protein	NA	A0A2H4J4Q2	uncultured_Caudovirales_phage	71.0	9.1e-32
WP_135009054.1|1008030_1011660_+	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	95.0	0.0e+00
WP_045034736.1|1011659_1012205_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4JD33	uncultured_Caudovirales_phage	99.4	6.2e-95
WP_135009053.1|1012215_1012566_+	hypothetical protein	NA	A0A2H4J6L1	uncultured_Caudovirales_phage	93.1	1.6e-56
WP_135009052.1|1012552_1013548_+	hypothetical protein	NA	A0A2H4J4T4	uncultured_Caudovirales_phage	97.6	7.2e-158
WP_008348688.1|1013547_1013892_+	hypothetical protein	NA	A0A2H4JDQ2	uncultured_Caudovirales_phage	98.2	1.5e-59
WP_135009051.1|1013888_1014251_+	DUF2634 domain-containing protein	NA	A0A2H4J4S8	uncultured_Caudovirales_phage	92.5	4.6e-54
WP_135009139.1|1014240_1015416_+|plate	baseplate J/gp47 family protein	plate	A0A2H4J8D2	uncultured_Caudovirales_phage	97.4	4.7e-209
WP_008348675.1|1015412_1016042_+	DUF2612 domain-containing protein	NA	A0A2H4J4S3	uncultured_Caudovirales_phage	97.1	6.6e-109
WP_135009050.1|1016056_1017145_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	98.3	9.8e-209
WP_135009049.1|1017155_1017494_+|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	96.4	7.3e-54
WP_008348673.1|1017493_1017685_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	100.0	6.6e-28
WP_008348672.1|1017753_1018032_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	94.6	2.4e-39
WP_135009048.1|1018051_1018315_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	81.6	7.9e-32
WP_135009047.1|1018373_1019192_+	peptidase M15	NA	A0A2H4J4U2	uncultured_Caudovirales_phage	96.1	8.3e-120
WP_025207092.1|1019221_1019458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025207093.1|1019476_1020070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009046.1|1020331_1020550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135009045.1|1020551_1020794_+	helix-turn-helix domain-containing protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	82.5	1.3e-28
WP_135009044.1|1020963_1021428_+	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	42.0	7.7e-22
1023385:1023404	attR	GGTATTTCCCACAAGCCTCC	NA	NA	NA	NA
>prophage 4
NZ_CP043559	Bacillus altitudinis strain CHB19 chromosome, complete genome	3867833	1687197	1693445	3867833		Bacillus_phage(66.67%)	6	NA	NA
WP_017359034.1|1687197_1687590_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	56.5	8.8e-27
WP_017359033.1|1687549_1689652_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	82.8	0.0e+00
WP_024720404.1|1689669_1690650_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	80.9	1.4e-150
WP_135008866.1|1690733_1691351_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	45.3	6.6e-45
WP_135008865.1|1691406_1692165_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N6W8I1	Bacillus_phage	53.8	5.1e-47
WP_008344008.1|1692485_1693445_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	39.6	3.9e-52
>prophage 5
NZ_CP043559	Bacillus altitudinis strain CHB19 chromosome, complete genome	3867833	2047076	2054784	3867833		Ostreococcus_lucimarinus_virus(16.67%)	10	NA	NA
WP_135009198.1|2047076_2048168_-	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	28.2	1.1e-21
WP_007500947.1|2048167_2049340_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	35.2	5.9e-42
WP_008344547.1|2049416_2050193_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_003216015.1|2050337_2050784_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	42.3	1.5e-27
WP_024718506.1|2050913_2051876_-	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	26.0	1.7e-07
WP_007500957.1|2051900_2052605_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_024718505.1|2052608_2053376_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_008344541.1|2053491_2053722_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_003215789.1|2053745_2054315_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	57.3	1.8e-49
WP_003215863.1|2054505_2054784_-	non-specific DNA-binding protein Hbs	NA	A7KV42	Bacillus_phage	74.2	5.6e-28
>prophage 6
NZ_CP043559	Bacillus altitudinis strain CHB19 chromosome, complete genome	3867833	2092639	2099082	3867833		Staphylococcus_phage(50.0%)	10	NA	NA
WP_017367523.1|2092639_2093791_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	37.7	1.9e-24
WP_061419515.1|2093901_2094381_-	DUF3907 family protein	NA	NA	NA	NA	NA
WP_008344462.1|2094494_2095088_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.0	9.0e-15
WP_007501021.1|2095077_2095836_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	36.8	6.5e-10
WP_008359694.1|2096046_2096139_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_072367786.1|2096226_2096751_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_017359785.1|2096775_2097129_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041507130.1|2097242_2097707_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	66.7	1.2e-43
WP_017359786.1|2097733_2098357_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	58.6	2.6e-57
WP_135009206.1|2098368_2099082_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	40.8	2.3e-41
>prophage 7
NZ_CP043559	Bacillus altitudinis strain CHB19 chromosome, complete genome	3867833	2291727	2383474	3867833	holin,portal,plate,tail,terminase,capsid,tRNA,bacteriocin	Bacillus_phage(27.91%)	115	NA	NA
WP_017367626.1|2291727_2293086_-|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_024718812.1|2293085_2293856_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_017358022.1|2293879_2294815_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_017367628.1|2294837_2295971_-	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	31.4	3.0e-27
WP_008342469.1|2296136_2297975_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.2	2.8e-139
WP_008342471.1|2297999_2298557_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_008342473.1|2298620_2299652_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_135009256.1|2299733_2300873_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_008342476.1|2300987_2302826_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.1	5.2e-21
WP_017358024.1|2302991_2303324_-	YqxA family protein	NA	NA	NA	NA	NA
WP_007501337.1|2303337_2304546_-	stage II sporulation protein P	NA	NA	NA	NA	NA
WP_135009257.1|2304612_2305728_-	GPR endopeptidase	NA	NA	NA	NA	NA
WP_008342485.1|2305926_2306193_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017358025.1|2306328_2307348_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_008342491.1|2307586_2307721_+	YqzM family protein	NA	NA	NA	NA	NA
WP_135009789.1|2307760_2310088_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	31.5	6.4e-32
WP_008342495.1|2310080_2310650_-	ComE operon protein 2	NA	A0A127AWN5	Bacillus_phage	50.4	1.7e-31
WP_135009258.1|2310715_2311345_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_135009259.1|2311435_2312284_+	late competence protein ComER	NA	NA	NA	NA	NA
WP_135009260.1|2312332_2313076_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_008342502.1|2313072_2313429_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_017358029.1|2313441_2314005_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_135009261.1|2313994_2314564_-	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	29.9	9.8e-19
WP_008342507.1|2314577_2314868_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_135009262.1|2314861_2315704_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_007501357.1|2315725_2316826_-	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_008356191.1|2316828_2317350_-	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_003217327.1|2317712_2317853_+	sporulation histidine kinase inhibitor Sda	NA	NA	NA	NA	NA
WP_135009263.1|2318217_2318961_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_135009264.1|2319017_2319758_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_007501361.1|2319924_2321046_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	46.5	1.6e-84
WP_135009791.1|2321275_2321647_+	sigma-70 family RNA polymerase sigma factor	NA	U5PUF5	Bacillus_phage	37.6	5.4e-10
WP_135009265.1|2321661_2323164_-	recombinase family protein	NA	A6M972	Geobacillus_virus	28.0	6.6e-30
WP_135009266.1|2323509_2324100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135009267.1|2324607_2325294_-	hypothetical protein	NA	D2XR29	Bacillus_phage	32.0	2.4e-27
WP_135009268.1|2325470_2325665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009793.1|2325719_2326292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009269.1|2326484_2326676_+	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	87.1	4.4e-24
WP_135009270.1|2326793_2327078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009271.1|2327540_2327990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135009272.1|2328311_2328656_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_135009273.1|2328672_2329245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009274.1|2329317_2330130_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	73.9	1.5e-65
WP_046343279.1|2330188_2330452_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	74.7	1.3e-29
WP_025092921.1|2330467_2330680_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	58.0	6.0e-14
WP_080934077.1|2330741_2330882_-	XkdX family protein	NA	NA	NA	NA	NA
WP_135009275.1|2330881_2331256_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	38.7	7.1e-10
WP_135009276.1|2331261_2332392_-	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	62.6	2.5e-37
WP_096881285.1|2332409_2332793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009277.1|2332805_2333729_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	27.7	3.2e-11
WP_135009278.1|2333715_2334762_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	40.1	8.6e-61
WP_135009795.1|2334754_2335183_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	33.3	6.7e-12
WP_135009279.1|2335182_2335464_-	DUF2577 family protein	NA	S6C459	Thermus_phage	40.4	7.7e-09
WP_135009280.1|2335460_2336555_-|portal	phage portal protein	portal	H7BV96	unidentified_phage	28.7	6.9e-37
WP_135009281.1|2336566_2337229_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2SUI2	Clostridium_phage	32.1	1.5e-26
WP_135009282.1|2337221_2342198_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	41.6	2.7e-43
WP_096881278.1|2342377_2342827_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_008361958.1|2343322_2343766_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	46.5	2.2e-26
WP_135009283.1|2343767_2345114_-|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	41.2	7.9e-83
WP_135009284.1|2345116_2345338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009285.1|2345324_2345780_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_135009286.1|2345784_2346291_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	48.8	4.8e-41
WP_135009287.1|2346287_2346644_-	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_135009288.1|2346640_2347033_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_135009289.1|2347038_2347380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009290.1|2347385_2348315_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	66.1	7.8e-106
WP_135009291.1|2348338_2349283_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.2	9.5e-59
WP_135009292.1|2349315_2350101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009293.1|2350106_2350292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009294.1|2350315_2351395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009295.1|2351485_2352400_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	39.8	4.3e-48
WP_135009296.1|2352396_2353917_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.1	2.3e-139
WP_135009297.1|2353916_2355215_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	62.6	2.5e-155
WP_135009298.1|2355214_2355931_-	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	64.6	2.2e-60
WP_135009299.1|2356090_2356387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095285470.1|2356794_2357211_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_135009300.1|2358030_2358375_-	structural protein	NA	Q38579	Bacillus_phage	52.6	3.6e-24
WP_073980085.1|2358468_2358651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009301.1|2359117_2359489_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	74.6	2.4e-42
WP_106032704.1|2360151_2360355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009303.1|2360509_2360920_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	43.5	3.5e-10
WP_135009304.1|2361071_2361332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106156855.1|2361434_2361647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009305.1|2361664_2362924_-	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	44.8	1.6e-117
WP_135009306.1|2362931_2363156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056702503.1|2363188_2363392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009307.1|2363465_2363750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106156862.1|2363881_2364322_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	68.9	1.4e-49
WP_106048440.1|2364318_2364513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009308.1|2364699_2365629_-	ATP-binding protein	NA	A0A2H4J4P8	uncultured_Caudovirales_phage	93.6	1.0e-137
WP_135009309.1|2366474_2366660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009310.1|2366659_2367460_-	hypothetical protein	NA	A0A0A7RUC1	Clostridium_phage	45.6	1.6e-59
WP_135009311.1|2367419_2368340_-	hypothetical protein	NA	A0A0A7RUE9	Clostridium_phage	62.2	2.1e-87
WP_025092875.1|2368448_2368670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009312.1|2368702_2368894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087976836.1|2369254_2369524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034667563.1|2369526_2369778_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047947372.1|2370019_2370238_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_135009313.1|2370411_2370759_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	38.9	1.1e-07
WP_135009314.1|2370852_2371323_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	38.9	2.9e-24
WP_048003094.1|2371423_2372083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135009315.1|2373036_2373738_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017358037.1|2373848_2373989_-	GapA-binding peptide SR1P	NA	NA	NA	NA	NA
WP_135009316.1|2374117_2375458_-	MFS transporter	NA	NA	NA	NA	NA
WP_135009317.1|2375635_2376394_-	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_135009318.1|2376410_2377370_-	transketolase family protein	NA	NA	NA	NA	NA
WP_017358041.1|2377366_2378203_-	transketolase	NA	NA	NA	NA	NA
WP_017358042.1|2378461_2378734_-	DUF3986 family protein	NA	NA	NA	NA	NA
WP_135009319.1|2378764_2379175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009320.1|2379195_2379624_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_024718790.1|2379852_2380080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009321.1|2380182_2381595_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_135009322.1|2381749_2382304_-	delta-aminolevulinic acid dehydratase	NA	NA	NA	NA	NA
WP_125589997.1|2382257_2382812_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017358050.1|2383147_2383474_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
>prophage 8
NZ_CP043559	Bacillus altitudinis strain CHB19 chromosome, complete genome	3867833	2813481	2838906	3867833	holin,portal,plate,tail,terminase,capsid	Clostridium_phage(27.27%)	34	NA	NA
WP_046344321.1|2813481_2814300_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	69.3	2.1e-62
WP_019743388.1|2814319_2814583_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	69.0	7.7e-27
WP_017367922.1|2814595_2814808_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	53.6	5.1e-13
WP_135009770.1|2814838_2816044_-	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	51.1	1.7e-65
WP_024719681.1|2816117_2817245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017359000.1|2817262_2817646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009768.1|2817657_2818581_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	27.8	1.6e-10
WP_008344084.1|2818567_2819614_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.8	6.6e-69
WP_024719684.1|2819606_2820029_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_017358996.1|2820043_2820310_-	DUF2577 family protein	NA	S6C459	Thermus_phage	37.5	4.7e-08
WP_017367933.1|2820306_2821317_-	hypothetical protein	NA	H7BV96	unidentified_phage	28.4	1.0e-34
WP_007500584.1|2821328_2821997_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2SUI2	Clostridium_phage	29.6	2.9e-22
WP_135009766.1|2821989_2825922_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	45.3	9.4e-44
WP_008344097.1|2825977_2826115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012011040.1|2826156_2826597_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	36.8	9.9e-11
WP_072368332.1|2826748_2826838_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003213309.1|2827102_2827546_-|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	46.5	7.6e-27
WP_024719687.1|2827547_2828894_-|portal	phage portal protein	portal	A0A0A7RTT5	Clostridium_phage	40.3	1.1e-76
WP_056702583.1|2828897_2829110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047946736.1|2829096_2829552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025207873.1|2829556_2830054_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.2	5.3e-37
WP_056702588.1|2830050_2830407_-	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_024719690.1|2830403_2830787_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_135009764.1|2830800_2831724_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	63.9	9.7e-109
WP_135009762.1|2831746_2832835_-|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	40.7	4.0e-61
WP_047946732.1|2832869_2834327_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	53.2	8.4e-139
WP_135009760.1|2834323_2835637_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	62.0	2.7e-152
WP_008344125.1|2835633_2836281_-|terminase	terminase	terminase	A0A2P1JTW4	Anoxybacillus_phage	43.7	2.5e-42
WP_135009758.1|2836433_2836952_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J6J3	uncultured_Caudovirales_phage	46.9	2.6e-34
WP_008344129.1|2837076_2837283_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	68.5	9.0e-15
WP_135009756.1|2837279_2837684_-	holliday junction resolvase	NA	NA	NA	NA	NA
WP_017358978.1|2837786_2837969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017358976.1|2838129_2838369_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007500560.1|2838528_2838906_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.4	1.6e-17
>prophage 9
NZ_CP043559	Bacillus altitudinis strain CHB19 chromosome, complete genome	3867833	3059729	3069605	3867833		Thermus_phage(33.33%)	11	NA	NA
WP_058336929.1|3059729_3061328_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	28.9	5.6e-19
WP_024719826.1|3061695_3062241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008347656.1|3062252_3062750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008347658.1|3063692_3064163_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	62.5	1.4e-47
WP_024719828.1|3064302_3066642_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.2	9.4e-92
WP_008347663.1|3066661_3067408_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003212746.1|3067531_3067765_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_008347666.1|3067952_3068243_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	47.5	8.8e-08
WP_008347669.1|3068280_3068514_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007500204.1|3068668_3069073_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	43.3	4.2e-16
WP_008347673.1|3069203_3069605_+	transcriptional regulator	NA	S6C481	Thermus_phage	55.1	1.0e-17
>prophage 10
NZ_CP043559	Bacillus altitudinis strain CHB19 chromosome, complete genome	3867833	3134416	3143420	3867833		Streptococcus_phage(33.33%)	10	NA	NA
WP_110487117.1|3134416_3135397_+	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	26.9	4.9e-18
WP_017357906.1|3135577_3136066_+	ribonuclease	NA	NA	NA	NA	NA
WP_058336953.1|3136118_3136862_-	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_008348124.1|3136901_3137159_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_008348125.1|3137185_3138136_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.1	4.3e-51
WP_008348128.1|3138152_3139112_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	40.4	3.2e-62
WP_096881894.1|3139112_3140036_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	26.3	4.5e-05
WP_008348133.1|3140039_3140504_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_024719880.1|3140861_3141812_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.1	4.8e-87
WP_041091649.1|3142046_3143420_-	peptidase C40	NA	A0A0A0RVE6	Bacillus_phage	54.3	8.1e-27
>prophage 11
NZ_CP043559	Bacillus altitudinis strain CHB19 chromosome, complete genome	3867833	3406585	3455402	3867833	coat,protease,transposase	Escherichia_phage(25.0%)	56	NA	NA
WP_135009579.1|3406585_3407248_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_008343530.1|3407355_3407541_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_024719439.1|3407593_3408406_-	peptidase M84	NA	NA	NA	NA	NA
WP_039165237.1|3408780_3410109_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_008343536.1|3410148_3411033_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_135009578.1|3411183_3411735_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_039165233.1|3411718_3412744_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_056408369.1|3412743_3412998_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_008343543.1|3413032_3413596_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_008343545.1|3413609_3414371_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_056408372.1|3414388_3415231_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_135009577.1|3415247_3415958_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_135009576.1|3415954_3416698_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	2.4e-33
WP_024719448.1|3416802_3417303_-	YwgA family protein	NA	NA	NA	NA	NA
WP_007497716.1|3417333_3418635_-	HD domain-containing protein	NA	A0A1V0SGM3	Hokovirus	30.3	1.6e-24
WP_003215259.1|3418805_3419027_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_045033901.1|3419269_3420070_+	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	48.0	6.0e-06
WP_041507923.1|3420105_3420339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009575.1|3420335_3422612_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_017368242.1|3422715_3423201_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_135009574.1|3423236_3424082_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_024719452.1|3424318_3424714_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_135009573.1|3424746_3425022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039165214.1|3425276_3425714_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_135009572.1|3425722_3427510_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_008343583.1|3427521_3427800_-	YwqI/YxiC family protein	NA	NA	NA	NA	NA
WP_041507929.1|3427804_3428203_-	DUF5082 family protein	NA	NA	NA	NA	NA
WP_008343586.1|3428373_3428640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135009571.1|3428653_3429988_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_135009570.1|3430031_3430910_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_135009569.1|3430921_3431593_-	RraA family protein	NA	NA	NA	NA	NA
WP_008343595.1|3431733_3432585_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008343597.1|3432721_3433693_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_047945784.1|3433932_3434703_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_135009568.1|3434770_3435931_+	MFS transporter	NA	NA	NA	NA	NA
WP_046344710.1|3435946_3436426_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_135009567.1|3436571_3437804_+	MFS transporter	NA	NA	NA	NA	NA
WP_047945786.1|3437953_3438559_+	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_017368257.1|3438560_3439268_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_135009566.1|3439264_3440026_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	3.2e-25
WP_135009565.1|3440041_3441463_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_135009564.1|3441477_3442674_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_135009563.1|3442689_3443487_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_008343612.1|3443573_3444029_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_135009562.1|3444021_3444876_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.8	4.3e-34
WP_024719470.1|3444879_3445845_-	dTDP-glucose 4,6-dehydratase	NA	K7QJG5	Escherichia_phage	45.6	5.5e-78
WP_135009561.1|3445841_3446582_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	41.6	2.1e-45
WP_135009560.1|3446584_3447613_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_039165189.1|3447609_3448350_-	glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_116306425.1|3448339_3449464_-|coat	spore coat protein	coat	A0A1B1IVE2	uncultured_Mediterranean_phage	29.9	3.4e-23
WP_135009559.1|3449465_3450341_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_135009558.1|3450337_3451516_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_135009557.1|3451537_3452950_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_123796458.1|3452956_3453736_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_135009556.1|3453902_3454577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007497781.1|3454859_3455402_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
>prophage 12
NZ_CP043559	Bacillus altitudinis strain CHB19 chromosome, complete genome	3867833	3791083	3799797	3867833	tRNA	uncultured_Mediterranean_phage(16.67%)	8	NA	NA
WP_008342028.1|3791083_3792358_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.1	1.7e-95
WP_008342025.1|3792459_3793287_+	chemotaxis sensory transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.4	7.1e-10
WP_024719578.1|3793596_3794256_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	33.2	1.1e-21
WP_017366700.1|3794252_3794876_-	deoxynucleoside kinase	NA	A0A1G5SAJ8	Enterococcus_phage	28.8	2.0e-12
WP_035391604.1|3794955_3796257_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2P1CIG4	Microbacterium_phage	34.8	1.4e-07
WP_135009452.1|3796314_3796857_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_135009451.1|3796936_3797413_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_135009450.1|3798084_3799797_+	DNA polymerase III subunit gamma/tau	NA	D9ZNI9	Clostridium_phage	34.1	1.2e-54
