The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039631	Pseudomonas veronii strain Pvy chromosome, complete genome	7110596	938	53471	7110596	terminase,transposase,lysis,protease,holin,portal	Pseudomonas_phage(20.0%)	56	NA	NA
WP_163957416.1|938_1919_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	56.4	1.4e-92
WP_155677101.1|3837_4059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141122914.1|4222_4540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141122915.1|4726_5521_-	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	65.4	7.9e-99
WP_141123693.1|6981_7488_-|lysis	lysis protein	lysis	A0A2H4IZW4	uncultured_Caudovirales_phage	65.1	1.3e-46
WP_141122916.1|7794_8304_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	65.8	4.6e-52
WP_141122917.1|9572_9752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141122918.1|9748_11443_-	hypothetical protein	NA	A0A1B3AZ88	Gordonia_phage	27.5	2.9e-10
WP_141122919.1|11556_13599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163957417.1|13944_15129_-	DUF2163 domain-containing protein	NA	A0A0B4SJM9	Proteus_phage	26.6	6.8e-14
WP_141122921.1|15055_15262_-	DUF2163 domain-containing protein	NA	NA	NA	NA	NA
WP_155677103.1|15258_15912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155677104.1|15920_18695_-	hypothetical protein	NA	A0A218MKN2	uncultured_virus	25.8	6.5e-23
WP_141122927.1|18829_19066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141122928.1|19245_19446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074844129.1|19855_20614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_090407981.1|20621_21074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053130790.1|21079_21367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141122929.1|21359_21569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141122930.1|21558_21807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141122931.1|21842_22790_-	hypothetical protein	NA	G8DH47	Emiliania_huxleyi_virus	52.4	2.2e-87
WP_141122932.1|22846_23263_-	cytoplasmic protein	NA	G8DH46	Emiliania_huxleyi_virus	48.1	4.8e-23
WP_141122933.1|23305_24670_-	S49 family peptidase	NA	A0A219YA27	Aeromonas_phage	41.5	1.9e-47
WP_155677105.1|24672_26283_-|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	43.4	8.7e-105
WP_074844112.1|26279_26501_-	hypothetical protein	NA	A0A291AUT6	Sinorhizobium_phage	54.4	3.6e-09
WP_163957418.1|26504_28586_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	45.9	6.5e-145
WP_141123687.1|28548_29043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141122940.1|29250_29982_-	hypothetical protein	NA	A0A291AUT0	Sinorhizobium_phage	35.4	2.8e-26
WP_053130823.1|30001_30346_-|holin	pyocin R2, holin	holin	B5TK61	Pseudomonas_phage	88.6	7.4e-46
WP_141122941.1|30876_31242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155677107.1|31234_33454_-	conjugal transfer protein TraC	NA	A0A2D1GN57	Marinobacter_phage	47.9	3.1e-193
WP_141122942.1|33443_33671_-	TraR/DksA family transcriptional regulator	NA	A0A218M4I6	Erwinia_phage	38.4	4.9e-06
WP_163957419.1|33663_34182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141122943.1|34515_34803_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	48.6	3.8e-11
WP_155677109.1|34910_35696_+	helix-turn-helix domain-containing protein	NA	A0A1B0Z078	Pseudomonas_phage	48.1	7.4e-57
WP_141122944.1|35941_36505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_090408042.1|36514_36805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141122945.1|36970_37405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141122946.1|37401_37725_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_141122947.1|37981_38380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163957421.1|38376_38601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_090408065.1|38597_39140_+	phosphohydrolase	NA	A0A2D1GNL9	Pseudomonas_phage	43.0	4.9e-28
WP_141122949.1|39413_41405_+	DNA cytosine methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	72.7	1.6e-201
WP_141122951.1|41699_42179_+	hypothetical protein	NA	A0A2H4J7W7	uncultured_Caudovirales_phage	42.9	1.2e-09
WP_141122952.1|42168_42441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141122953.1|42511_42727_+	DUF1233 family excisionase	NA	NA	NA	NA	NA
WP_155677110.1|42723_43944_+	DUF3596 domain-containing protein	NA	A0A2H4JGM5	uncultured_Caudovirales_phage	36.7	1.1e-56
WP_017844921.1|44226_44940_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	37.1	7.4e-40
WP_017844920.1|44967_45726_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_046490359.1|45732_46848_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_017529585.1|48018_48579_+	glycine cleavage system protein R	NA	NA	NA	NA	NA
WP_046384366.1|48589_49063_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_017844916.1|49102_50173_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017844915.1|50205_50445_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_141122956.1|50536_51973_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_046490355.1|52037_53471_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.6	5.0e-27
>prophage 2
NZ_CP039631	Pseudomonas veronii strain Pvy chromosome, complete genome	7110596	100227	108897	7110596		uncultured_Caudovirales_phage(87.5%)	12	NA	NA
WP_155677120.1|100227_100692_-	GNAT family N-acetyltransferase	NA	A0A2H4J155	uncultured_Caudovirales_phage	90.0	2.5e-68
WP_155677121.1|100821_101601_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J437	uncultured_Caudovirales_phage	92.0	6.6e-66
WP_141122965.1|101625_102909_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	99.1	7.7e-229
WP_046490311.1|102925_103396_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	93.6	8.5e-77
WP_017844875.1|103443_104157_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	97.9	7.7e-130
WP_046490310.1|104177_104600_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	91.4	1.9e-67
WP_046490307.1|104828_105908_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	64.1	3.9e-101
WP_046490305.1|105935_106973_+	permease	NA	NA	NA	NA	NA
WP_046490302.1|106992_107229_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_046490300.1|107577_108102_+	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_017844869.1|108125_108431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155677122.1|108507_108897_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	49.6	6.1e-28
>prophage 3
NZ_CP039631	Pseudomonas veronii strain Pvy chromosome, complete genome	7110596	215231	221497	7110596		Bacillus_phage(28.57%)	8	NA	NA
WP_017844770.1|215231_215996_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.6	8.6e-10
WP_046490227.1|216228_216426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017844768.1|216533_217100_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	73.8	5.6e-75
WP_002554837.1|217499_217709_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.7	2.2e-16
WP_155677154.1|217908_218916_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.6	7.3e-33
WP_155677155.1|219021_219861_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	33.3	8.3e-06
WP_003189211.1|220070_220748_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.1	3.1e-43
WP_017844765.1|220747_221497_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.4	1.8e-65
>prophage 4
NZ_CP039631	Pseudomonas veronii strain Pvy chromosome, complete genome	7110596	296050	354456	7110596	tail,holin,tRNA,plate	uncultured_Caudovirales_phage(24.0%)	58	NA	NA
WP_141122980.1|296050_297553_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.2	1.4e-83
WP_155677175.1|297624_298722_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	2.0e-07
WP_017844695.1|298962_299964_-	PleD family two-component system response regulator	NA	A0A127AWB9	Bacillus_phage	35.2	2.8e-16
WP_026139760.1|300015_301026_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q6XM27	Feldmannia_irregularis_virus	40.3	7.6e-06
WP_141122981.1|301022_303290_-	hybrid sensor histidine kinase/response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	28.0	3.3e-09
WP_155677176.1|303995_305261_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_163957425.1|305257_305770_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_046490129.1|305769_307392_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_141122982.1|307608_309054_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_046484945.1|309050_309662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052743362.1|309850_310486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046484942.1|310482_311097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017844685.1|311151_311862_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_017844684.1|312030_312942_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081610099.1|313043_314531_+	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_155677177.1|314604_315759_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_141122983.1|315880_316915_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.5	3.0e-26
WP_046484936.1|316916_317840_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010563467.1|317829_318639_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_155677178.1|320503_322129_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_017844677.1|322188_322374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017844676.1|322645_323752_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_017844675.1|323977_325879_-	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	33.3	1.3e-75
WP_046384502.1|326191_327532_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_017844673.1|327646_328120_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017844672.1|328191_328902_+	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_017844671.1|328969_329431_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	50.7	1.0e-37
WP_046384504.1|329434_330130_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_017844669.1|330243_331023_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_046484921.1|331148_332075_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017137081.1|332078_332441_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017844666.1|332516_333167_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_026139758.1|333419_334139_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_017844664.1|334337_334778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155677179.1|335157_336270_+	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_017844662.1|336326_336794_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_017844661.1|336802_337861_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.7	3.1e-111
WP_017844659.1|338526_339027_-	lysozyme	NA	B5TK84	Pseudomonas_phage	49.1	1.4e-29
WP_046484911.1|339014_339572_-	glycoside hydrolase family 19 protein	NA	B5TK83	Pseudomonas_phage	75.4	2.5e-75
WP_155677180.1|339594_340608_-	phage late control D family protein	NA	A0A2H4JH05	uncultured_Caudovirales_phage	55.7	3.1e-100
WP_046484907.1|340620_340833_-|tail	tail protein	tail	A0A2H4JGD9	uncultured_Caudovirales_phage	61.4	6.9e-18
WP_046484905.1|340825_341209_-|tail	phage tail protein	tail	B0ZSH2	Halomonas_phage	58.3	5.9e-36
WP_155677181.1|341208_342399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141122988.1|342527_343100_-|tail	phage tail assembly protein	tail	B0ZSH0	Halomonas_phage	39.8	8.1e-29
WP_017844651.1|343151_343658_-|tail	phage tail protein	tail	Q6R4W3	Vibrio_virus	34.5	1.3e-22
WP_017844650.1|343657_344824_-|tail	tail protein	tail	B0ZSG8	Halomonas_phage	56.7	3.6e-124
WP_167331308.1|344826_345000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046484900.1|345086_345389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046484898.1|345401_346184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046384530.1|346231_346762_-|tail	tail fiber protein	tail	B0ZSG1	Halomonas_phage	56.3	2.7e-47
WP_046484896.1|346758_347397_-|tail	phage tail protein I	tail	A0A2H4JDK0	uncultured_Caudovirales_phage	50.6	2.8e-38
WP_046384532.1|347393_348389_-|plate	baseplate J protein	plate	A0A2H4JC04	uncultured_Caudovirales_phage	63.8	1.0e-111
WP_046484893.1|348385_348718_-|plate	phage baseplate protein	plate	A0A2H4JI46	uncultured_Caudovirales_phage	66.4	5.7e-35
WP_046484891.1|348727_349339_-|plate	phage baseplate assembly protein V	plate	A0A2H4JBW8	uncultured_Caudovirales_phage	53.9	1.6e-43
WP_046484889.1|349342_349858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017844641.1|349878_350223_-|holin	pyocin R2, holin	holin	B5TK61	Pseudomonas_phage	85.3	2.7e-48
WP_026139757.1|350933_351668_-	helix-turn-helix transcriptional regulator	NA	B5TK58	Pseudomonas_phage	87.7	3.7e-119
WP_141122989.1|351864_354456_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	21.9	4.3e-29
>prophage 5
NZ_CP039631	Pseudomonas veronii strain Pvy chromosome, complete genome	7110596	1719456	1796540	7110596	protease,tRNA,transposase	Natrialba_phage(14.29%)	54	NA	NA
WP_017848941.1|1719456_1720827_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_155677505.1|1721378_1723274_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_026140276.1|1723270_1723915_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_155677506.1|1723933_1724815_+	AAA family ATPase	NA	Q8JL10	Natrialba_phage	35.3	7.3e-21
WP_017848938.1|1724741_1725614_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.4	2.1e-12
WP_155677507.1|1725762_1726173_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_017848936.1|1726189_1727059_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_002555987.1|1727194_1727452_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_015886647.1|1727509_1727980_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_017848934.1|1727992_1728529_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_017848933.1|1728550_1730095_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_155677508.1|1730145_1731006_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_010565871.1|1731033_1732413_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_017848931.1|1732457_1732883_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_046484441.1|1732996_1734364_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A2K9L821	Tupanvirus	33.7	3.0e-29
WP_026140274.1|1734592_1735360_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155677509.1|1735370_1737206_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.0	6.6e-133
WP_082118777.1|1737366_1738473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155677510.1|1738612_1740565_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_046484447.1|1741608_1742247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155677511.1|1742243_1744280_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052743356.1|1744272_1745625_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_046484451.1|1745911_1746682_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167331312.1|1746756_1747917_+	cytochrome P450	NA	NA	NA	NA	NA
WP_046484455.1|1747913_1748258_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_046484524.1|1748285_1749842_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	48.6	2.5e-125
WP_141123097.1|1750009_1750258_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082118779.1|1750254_1750623_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_082118774.1|1751305_1751581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141123098.1|1752743_1754363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155677512.1|1754974_1755124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155677513.1|1755515_1756160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155677514.1|1756214_1770032_+	S8 family serine peptidase	NA	A0A2H4JEI4	uncultured_Caudovirales_phage	30.3	2.6e-11
WP_082118771.1|1770058_1772218_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	27.9	1.8e-44
WP_046484342.1|1772221_1773646_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155678900.1|1773702_1775043_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_141123105.1|1775095_1775305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155677515.1|1775861_1776056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141123107.1|1776056_1776815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155677516.1|1776951_1777278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167331313.1|1777722_1779432_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_155677518.1|1779424_1780861_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_046484332.1|1780939_1782214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155677519.1|1782274_1783174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046484329.1|1783485_1783674_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_046484327.1|1783776_1784058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155677520.1|1785226_1787089_+	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
WP_017850067.1|1787589_1788522_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_046484323.1|1788523_1789144_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_046484319.1|1789588_1790887_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_155677521.1|1790889_1792659_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_046381592.1|1792669_1793293_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_046484315.1|1793612_1795538_+|protease	protease modulator HflK	protease	NA	NA	NA	NA
WP_017850060.1|1795550_1796540_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 6
NZ_CP039631	Pseudomonas veronii strain Pvy chromosome, complete genome	7110596	2234672	2281246	7110596	transposase,holin	Catovirus(16.67%)	39	NA	NA
WP_046381793.1|2234672_2236376_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.1	1.0e-50
WP_017844938.1|2236516_2237989_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017844937.1|2238099_2238693_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_046487928.1|2239026_2241018_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.7	2.0e-18
WP_155677613.1|2241188_2242373_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	37.6	7.8e-26
WP_017844934.1|2242369_2243215_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_017844933.1|2243284_2244232_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_017844932.1|2244647_2246024_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017844931.1|2246549_2247653_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_017844930.1|2247744_2248008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046487925.1|2248105_2248603_-	4-hydroxybenzoyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_046487924.1|2248615_2249581_-	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_017844927.1|2249723_2250611_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_017844926.1|2250698_2251643_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_017844925.1|2251837_2252782_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_046487921.1|2252850_2254029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155677614.1|2254961_2255378_-	DUF3010 family protein	NA	NA	NA	NA	NA
WP_046487917.1|2255580_2256543_+	tyrosinase family protein	NA	NA	NA	NA	NA
WP_017849538.1|2256583_2256985_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_017849539.1|2257204_2258182_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_017849540.1|2258233_2258764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155677615.1|2258780_2260844_+	dimethylglycine demethylation protein DgcA	NA	NA	NA	NA	NA
WP_155677616.1|2261017_2262964_+	dimethylglycine demethylation protein DgcB	NA	NA	NA	NA	NA
WP_046487912.1|2262963_2264184_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_046487910.1|2264199_2264970_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_155677617.1|2265656_2266952_-	glycine-betaine demethylase subunit GbcA	NA	NA	NA	NA	NA
WP_017847881.1|2267235_2268336_+	glycine-betaine demethylase subunit GbcB	NA	NA	NA	NA	NA
WP_155677618.1|2268396_2269443_-	threonine aldolase	NA	NA	NA	NA	NA
WP_046487908.1|2269533_2270262_+	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_017847878.1|2270514_2271768_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.2	2.8e-98
WP_155677619.1|2271790_2273044_+	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
WP_017847877.1|2273059_2273362_+	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_155677620.1|2273358_2276382_+	sarcosine oxidase subunit alpha family protein	NA	NA	NA	NA	NA
WP_046487905.1|2276490_2277123_+	sarcosine oxidase subunit gamma family protein	NA	NA	NA	NA	NA
WP_046487903.1|2277293_2278151_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_017847873.1|2278329_2279529_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	29.7	1.1e-11
WP_052743384.1|2279557_2279959_-	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_163957482.1|2280186_2280672_-	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_141123138.1|2280820_2281246_-|transposase	transposase	transposase	S5FM71	Shigella_phage	34.4	8.4e-07
>prophage 7
NZ_CP039631	Pseudomonas veronii strain Pvy chromosome, complete genome	7110596	2458962	2467004	7110596		Staphylococcus_phage(50.0%)	9	NA	NA
WP_046482543.1|2458962_2460669_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	79.1	3.4e-272
WP_163957625.1|2460761_2461244_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_046482541.1|2461224_2462361_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.0	1.9e-45
WP_017849579.1|2462408_2463086_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	34.6	4.9e-17
WP_017849578.1|2463102_2464194_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	36.5	2.0e-52
WP_017849577.1|2464282_2464759_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.4	1.0e-29
WP_017849576.1|2464755_2465256_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_155677681.1|2465274_2466243_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_017849574.1|2466386_2467004_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.9	4.4e-41
>prophage 8
NZ_CP039631	Pseudomonas veronii strain Pvy chromosome, complete genome	7110596	3708033	3736684	7110596	tail,integrase,lysis,plate	Pseudomonas_phage(35.71%)	37	3707977:3707996	3736821:3736840
3707977:3707996	attL	CTCCAGCTAATCCGCACATA	NA	NA	NA	NA
WP_155678083.1|3708033_3709218_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0Z061	Pseudomonas_phage	51.4	4.2e-104
WP_155678084.1|3709438_3709594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155678085.1|3710084_3710234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155678086.1|3710287_3710719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155678087.1|3710769_3710925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155678088.1|3711580_3711757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141123280.1|3711990_3712323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155678089.1|3712368_3713664_-	DNA cytosine methyltransferase	NA	Q6V7R9	Burkholderia_virus	52.2	2.0e-107
WP_134939265.1|3713722_3714034_-	hypothetical protein	NA	A0A2H4JAQ1	uncultured_Caudovirales_phage	41.7	7.0e-11
WP_141123281.1|3714103_3714574_-	hypothetical protein	NA	A0A2H4J101	uncultured_Caudovirales_phage	86.1	1.8e-71
WP_141123282.1|3714570_3714816_-	hypothetical protein	NA	A0A2H4J1H1	uncultured_Caudovirales_phage	86.1	2.9e-28
WP_155678090.1|3715549_3716197_-	AAA family ATPase	NA	A0A059VF62	Pseudomonas_phage	70.6	3.4e-84
WP_167331316.1|3716207_3716354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141123283.1|3716361_3717456_-	hypothetical protein	NA	Q9MC69	Pseudomonas_phage	44.7	1.6e-30
WP_141123284.1|3717498_3717996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141123285.1|3718047_3718275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155678091.1|3718364_3718925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155678092.1|3719081_3719417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155678093.1|3721321_3721465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141123289.1|3721468_3721849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141123290.1|3721850_3722489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141123291.1|3722490_3723312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167331317.1|3723320_3723497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141123293.1|3725122_3725605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141123294.1|3725619_3726087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141123295.1|3726090_3726294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155678094.1|3726325_3728437_+	hypothetical protein	NA	A4PE52	Ralstonia_virus	28.1	7.6e-40
WP_141123298.1|3729423_3730530_+	rhs element Vgr protein	NA	NA	NA	NA	NA
WP_141123299.1|3730526_3731108_+|plate	phage baseplate protein	plate	B3GAJ7	uncultured_virus	34.7	2.2e-13
WP_155678095.1|3731104_3731473_+|tail	phage tail protein	tail	B3GAJ8	uncultured_virus	36.8	1.1e-10
WP_141123300.1|3731474_3732602_+|plate	baseplate protein	plate	A0A291L9V0	Bordetella_phage	26.3	6.9e-16
WP_141123301.1|3732602_3733259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155678096.1|3733314_3735198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141123305.1|3735194_3735596_+|tail	tail fiber assembly protein	tail	A0A0A0YSY3	Erwinia_phage	47.3	3.7e-12
WP_046484864.1|3735652_3736186_+	glycoside hydrolase family 19 protein	NA	A0A059VA40	Pseudomonas_phage	77.4	7.7e-74
WP_141123306.1|3736182_3736449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163957509.1|3736399_3736684_+|lysis	lysis protein	lysis	A0A1B0VMJ3	Pseudomonas_phage	68.2	3.6e-22
3736821:3736840	attR	CTCCAGCTAATCCGCACATA	NA	NA	NA	NA
>prophage 9
NZ_CP039631	Pseudomonas veronii strain Pvy chromosome, complete genome	7110596	4087307	4128590	7110596	tail,transposase,integrase,head,protease	Pseudomonas_phage(69.57%)	45	4106705:4106764	4127048:4127109
WP_046485627.1|4087307_4087766_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046485625.1|4088518_4089937_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_046382834.1|4089920_4091090_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155678173.1|4091079_4094301_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.9	3.1e-69
WP_017848227.1|4094510_4094921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167331319.1|4094917_4095079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046485621.1|4095290_4095953_+	peptidase C39 family protein	NA	NA	NA	NA	NA
WP_046485620.1|4095996_4096698_-	VIT family protein	NA	NA	NA	NA	NA
WP_017848223.1|4096711_4097701_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_046485617.1|4097690_4099871_-	nitric oxide synthase	NA	NA	NA	NA	NA
WP_017848221.1|4099896_4100367_-	DUF2271 domain-containing protein	NA	NA	NA	NA	NA
WP_141123356.1|4100449_4100773_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_046485615.1|4100904_4101564_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_046485612.1|4101560_4102895_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_167331345.1|4102925_4105004_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_155678175.1|4105111_4105501_-	DUF2946 family protein	NA	NA	NA	NA	NA
WP_017848215.1|4105710_4106634_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
4106705:4106764	attL	TTAGGAGTATGGATCAGAAAACGATAGAGAGCCTTTAAATAAAGGCTGTAAGACGATGAT	NA	NA	NA	NA
WP_155678176.1|4106767_4107964_-|integrase	tyrosine-type recombinase/integrase	integrase	J7HXC4	Pseudomonas_phage	53.8	3.1e-115
WP_046485605.1|4108151_4108373_-	hypothetical protein	NA	A0A2H4J1L2	uncultured_Caudovirales_phage	74.6	3.4e-20
WP_046485604.1|4108409_4108871_-	hypothetical protein	NA	A0A1B0VM52	Pseudomonas_phage	85.1	2.9e-69
WP_155678177.1|4108930_4110787_-	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	51.6	2.0e-169
WP_167331320.1|4110829_4111987_-	RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	34.3	3.9e-46
WP_155678178.1|4112508_4113690_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.8	7.7e-50
WP_141123358.1|4113843_4114080_+	DUF1654 domain-containing protein	NA	A0A127KNY9	Pseudomonas_phage	56.2	3.3e-13
WP_141123359.1|4114127_4114520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046485574.1|4114932_4115172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046485572.1|4115175_4116057_-	LexA family transcriptional regulator	NA	H2BD63	Pseudomonas_phage	39.6	4.5e-47
WP_141123360.1|4116162_4116390_+	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
WP_155678179.1|4116428_4116851_+	Rha family transcriptional regulator	NA	A0A2D1GNM7	Pseudomonas_phage	41.4	5.0e-20
WP_141123362.1|4116922_4117195_+	hypothetical protein	NA	A0A0H5AUF7	Pseudomonas_phage	69.6	8.5e-21
WP_163957636.1|4117169_4117625_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2D1GNL2	Pseudomonas_phage	94.1	4.4e-62
WP_046485497.1|4118326_4118677_+|tail	tail protein	tail	A0A2D1GNJ1	Pseudomonas_phage	89.7	3.9e-58
WP_141123363.1|4118724_4119429_+|tail	phage minor tail protein L	tail	A0A2D1GNF3	Pseudomonas_phage	96.2	2.5e-133
WP_046485491.1|4119431_4120214_+	C40 family peptidase	NA	A0A2D1GNP8	Pseudomonas_phage	90.0	5.8e-147
WP_046485487.1|4120210_4120798_+|tail	tail assembly protein	tail	A0A2D1GNM2	Pseudomonas_phage	86.5	2.2e-90
WP_141123364.1|4121210_4121945_+	DUF1983 domain-containing protein	NA	A0A2D1GNE3	Pseudomonas_phage	50.9	1.5e-51
WP_155678180.1|4123020_4123788_+|tail	phage tail protein	tail	A0A059VJZ6	Pseudomonas_phage	54.1	6.3e-37
WP_155678181.1|4123787_4124123_+	hypothetical protein	NA	A0A059VFX9	Pseudomonas_phage	47.5	3.5e-16
WP_046485475.1|4124115_4124394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046485473.1|4124453_4124879_+	cell wall hydrolase	NA	A0A2D1GNI1	Pseudomonas_phage	93.6	1.5e-75
WP_046485470.1|4124878_4125397_+	lysozyme	NA	A0A2H4IZW4	uncultured_Caudovirales_phage	78.9	2.0e-63
WP_046485467.1|4125405_4125615_-	hypothetical protein	NA	A0A1B0VP78	Pseudomonas_phage	53.8	5.2e-10
WP_046485464.1|4125690_4126434_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046382845.1|4127309_4127594_-	hypothetical protein	NA	NA	NA	NA	NA
4127048:4127109	attR	TTAGGAGTATGGATCAGAAAACGATAGAGAGCCTTTAAATAAAGGCTGTAAGACGATGATTG	NA	NA	NA	NA
WP_017848149.1|4127735_4128590_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.3	7.1e-29
>prophage 10
NZ_CP039631	Pseudomonas veronii strain Pvy chromosome, complete genome	7110596	4894952	4950596	7110596	tail,terminase,integrase,plate,holin,coat	Pseudomonas_phage(43.75%)	80	4894771:4894822	4950038:4950051
4894771:4894822	attL	CGGATTGCAAATCCGCCTACGCCGGTTCGATTCCGACCTCGGCCTCCACTCT	NA	NA	NA	NA
WP_155678351.1|4894952_4895930_+|integrase	tyrosine-type recombinase/integrase	integrase	W6MYA3	Pseudomonas_phage	64.3	2.2e-111
4894771:4894822	attL	CGGATTGCAAATCCGCCTACGCCGGTTCGATTCCGACCTCGGCCTCCACTCT	NA	NA	NA	NA
WP_141123422.1|4895926_4896172_-	hypothetical protein	NA	W6MVE5	Pseudomonas_phage	65.4	2.1e-26
WP_155678352.1|4896259_4897909_-	DUF4942 domain-containing protein	NA	A0A059VA49	Pseudomonas_phage	58.0	1.3e-180
WP_141123423.1|4897967_4898693_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	47.7	4.3e-51
WP_141123424.1|4898689_4898935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110622342.1|4898984_4899224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141123425.1|4899220_4899646_-	DUF4159 domain-containing protein	NA	NA	NA	NA	NA
WP_141123426.1|4899738_4899960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141123428.1|4900173_4900614_-	hypothetical protein	NA	A0A2H4J2S6	uncultured_Caudovirales_phage	55.1	4.6e-16
WP_141123429.1|4900610_4901114_-	DUF4406 domain-containing protein	NA	G3KAZ6	Pseudomonas_phage	56.4	2.1e-25
WP_155678353.1|4901331_4902792_-	cytosine methyltransferase	NA	A0A2I7RFJ9	Vibrio_phage	48.2	2.0e-108
WP_093199303.1|4902850_4903174_-	hypothetical protein	NA	A0A2H4JAQ1	uncultured_Caudovirales_phage	55.9	7.3e-19
WP_155678354.1|4903237_4903831_-	hypothetical protein	NA	A0A1B0VMB1	Pseudomonas_phage	53.5	4.0e-47
WP_046483875.1|4903833_4904502_-	exonuclease	NA	F8TUK8	EBPR_podovirus	42.3	3.2e-37
WP_155678355.1|4904498_4905482_-	hypothetical protein	NA	A0A2R9YJJ1	Escherichia_phage	45.7	1.2e-61
WP_141123431.1|4905537_4906623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126588732.1|4906721_4906949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141123432.1|4907154_4907421_-	hypothetical protein	NA	A0A2H4J404	uncultured_Caudovirales_phage	69.6	5.2e-23
WP_141123433.1|4908071_4908326_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_141123434.1|4908346_4908607_-	hypothetical protein	NA	A0A1B0VMC2	Pseudomonas_phage	96.5	1.7e-42
WP_141123435.1|4908626_4909061_-	hypothetical protein	NA	W6MVG2	Pseudomonas_phage	65.8	3.0e-52
WP_102642911.1|4909082_4909382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141123729.1|4909945_4910182_-	hypothetical protein	NA	A0A1S5SF27	Streptococcus_phage	55.6	8.5e-17
WP_141123436.1|4910531_4910765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141123437.1|4910761_4911040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134939209.1|4911847_4912189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141123438.1|4912242_4912626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134939211.1|4912622_4912940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134939214.1|4912963_4913701_-	LexA family transcriptional regulator	NA	A0A2H4J0J9	uncultured_Caudovirales_phage	62.0	9.6e-83
WP_141123439.1|4913784_4914024_+	helix-turn-helix domain-containing protein	NA	A0A2H4J0V8	uncultured_Caudovirales_phage	70.9	2.7e-23
WP_077506582.1|4914053_4914242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141123730.1|4914764_4915202_+	HNH endonuclease	NA	V9SKR2	Achromobacter_phage	45.8	8.9e-28
WP_141123440.1|4916096_4916873_+	hypothetical protein	NA	A0A1B0VMD9	Pseudomonas_phage	74.1	3.4e-99
WP_141123441.1|4916869_4917058_+	DUF1382 family protein	NA	A0A2H4J9M2	uncultured_Caudovirales_phage	94.1	1.2e-10
WP_141123442.1|4917054_4917330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141123443.1|4918338_4918803_+	hypothetical protein	NA	A0A0H5AUD0	Pseudomonas_phage	77.9	4.3e-65
WP_046487382.1|4918799_4919105_+	hypothetical protein	NA	Q9MC48	Pseudomonas_phage	35.4	3.3e-05
WP_155678356.1|4919101_4919731_+	recombination protein NinG	NA	A0A2H4JA27	uncultured_Caudovirales_phage	70.3	6.3e-75
WP_141123444.1|4919795_4920122_+	hypothetical protein	NA	Q7Y3W3	Yersinia_phage	34.7	1.3e-10
WP_141123445.1|4920118_4920799_+	hypothetical protein	NA	A0A2H4J9G7	uncultured_Caudovirales_phage	70.5	1.6e-84
WP_155678358.1|4920795_4921068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167331346.1|4921767_4922085_+|holin	phage holin, lambda family	holin	A0A0A0YUH2	Pseudomonas_phage	68.3	3.3e-32
WP_046486922.1|4922081_4922324_+	hypothetical protein	NA	A0A0H5ARQ8	Pseudomonas_phage	45.6	6.9e-06
WP_141123446.1|4922374_4923007_+	hypothetical protein	NA	A0A1B0VRJ1	Pseudomonas_phage	77.6	1.5e-92
WP_141123447.1|4923006_4923528_+	HNH endonuclease	NA	A0A291LHR1	Salmonella_phage	36.4	2.3e-22
WP_141123448.1|4923638_4924115_+	DUF2280 domain-containing protein	NA	A0A1B0VMH2	Pseudomonas_phage	79.1	2.0e-65
WP_141123449.1|4924089_4925409_+|terminase	terminase	terminase	A0A1B0VP58	Pseudomonas_phage	89.3	1.3e-236
WP_155678360.1|4925411_4926803_+	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	59.4	9.7e-153
WP_141123450.1|4926923_4927682_+	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	63.8	2.4e-68
WP_141123451.1|4927698_4928853_+|coat	P22 coat - protein 5 family protein	coat	W6EBZ8	Rhizobium_phage	57.2	1.5e-106
WP_126589702.1|4928903_4929149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155678361.1|4929151_4930513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126589700.1|4930541_4930934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141123454.1|4930935_4931574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141123455.1|4931575_4932397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167331317.1|4932405_4932582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141123456.1|4932643_4934203_+|tail	phage tail protein	tail	B3GAJ6	uncultured_virus	43.6	1.5e-93
WP_155678362.1|4934260_4934692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155678363.1|4934781_4935192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155678364.1|4935376_4935862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141123457.1|4936090_4936447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141123458.1|4936678_4938706_+	hypothetical protein	NA	A4PE52	Ralstonia_virus	29.4	4.4e-45
WP_141123459.1|4938709_4939693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141123460.1|4939693_4940800_+	rhs element Vgr protein	NA	NA	NA	NA	NA
WP_141123299.1|4940796_4941378_+|plate	phage baseplate protein	plate	B3GAJ7	uncultured_virus	34.7	2.2e-13
WP_155678095.1|4941374_4941743_+|tail	phage tail protein	tail	B3GAJ8	uncultured_virus	36.8	1.1e-10
WP_141123300.1|4941744_4942872_+|plate	baseplate protein	plate	A0A291L9V0	Bordetella_phage	26.3	6.9e-16
WP_141123301.1|4942872_4943529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141123302.1|4943584_4944337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141123303.1|4944333_4944840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141123305.1|4945461_4945863_+|tail	tail fiber assembly protein	tail	A0A0A0YSY3	Erwinia_phage	47.3	3.7e-12
WP_141123461.1|4945919_4946453_+	glycoside hydrolase family 19 protein	NA	A0A059VA40	Pseudomonas_phage	78.0	7.7e-74
WP_141123462.1|4946449_4946965_+	DUF2514 domain-containing protein	NA	A0A059VF51	Pseudomonas_phage	39.6	1.2e-12
WP_155678365.1|4947272_4948325_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	56.7	5.7e-105
4947124:4947175	attR	CGGATTGCAAATCCGCCTACGCCGGTTCGATTCCGACCTCGGCCTCCACTCT	NA	NA	NA	NA
WP_046484861.1|4948326_4948569_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	41.8	2.7e-10
4947124:4947175	attR	CGGATTGCAAATCCGCCTACGCCGGTTCGATTCCGACCTCGGCCTCCACTCT	NA	NA	NA	NA
WP_046484859.1|4948571_4948793_-	hypothetical protein	NA	A0A2H4J1L2	uncultured_Caudovirales_phage	77.5	5.3e-21
WP_163957642.1|4948829_4949300_-	hypothetical protein	NA	A0A1B0VM52	Pseudomonas_phage	82.8	4.0e-66
WP_046484857.1|4949395_4949848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155678366.1|4949913_4950315_-	HNH endonuclease	NA	A0A1P8DTS4	Salmonella_phage	46.2	1.2e-26
WP_046484854.1|4950305_4950596_-	hypothetical protein	NA	A0A0S2SY28	Pseudomonas_phage	54.4	3.3e-23
>prophage 11
NZ_CP039631	Pseudomonas veronii strain Pvy chromosome, complete genome	7110596	7070290	7102818	7110596	terminase,transposase,lysis,holin,portal	Emiliania_huxleyi_virus(15.79%)	31	NA	NA
WP_141123664.1|7070290_7071271_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	56.7	1.2e-93
WP_141123344.1|7071463_7072489_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.1	1.8e-07
WP_155677101.1|7073192_7073414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141122914.1|7073577_7073895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155678877.1|7074082_7074880_-	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	65.1	3.3e-97
WP_141123666.1|7075292_7076315_+	acyltransferase	NA	NA	NA	NA	NA
WP_141123693.1|7076344_7076851_-|lysis	lysis protein	lysis	A0A2H4IZW4	uncultured_Caudovirales_phage	65.1	1.3e-46
WP_141122916.1|7077158_7077668_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	65.8	4.6e-52
WP_141123668.1|7078103_7078943_-	hypothetical protein	NA	D4P7M2	Rhodococcus_phage	36.4	2.2e-30
WP_141123669.1|7078942_7080814_-	hypothetical protein	NA	A0A222ZJQ9	Arthrobacter_phage	29.3	1.1e-18
WP_163957600.1|7080826_7083340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141123672.1|7083323_7083782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141123673.1|7083778_7085152_-	DUF2163 domain-containing protein	NA	A0A0B4SJM9	Proteus_phage	26.1	7.2e-15
WP_155678879.1|7085296_7088068_-	hypothetical protein	NA	A0A218MKN2	uncultured_virus	25.7	3.4e-24
WP_141123676.1|7088131_7088437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141122928.1|7088616_7088817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163957602.1|7089225_7090446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053130790.1|7090451_7090739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141123677.1|7090930_7091125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141122931.1|7091215_7092163_-	hypothetical protein	NA	G8DH47	Emiliania_huxleyi_virus	52.4	2.2e-87
WP_141122932.1|7092219_7092636_-	cytoplasmic protein	NA	G8DH46	Emiliania_huxleyi_virus	48.1	4.8e-23
WP_141123680.1|7092674_7092869_-	hypothetical protein	NA	G8DH45	Emiliania_huxleyi_virus	47.4	1.2e-05
WP_141123681.1|7092853_7094041_-	S49 family peptidase	NA	A0A219YA27	Aeromonas_phage	41.5	1.6e-47
WP_155678880.1|7094043_7095654_-|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	43.4	8.7e-105
WP_074844112.1|7095650_7095872_-	hypothetical protein	NA	A0A291AUT6	Sinorhizobium_phage	54.4	3.6e-09
WP_163957647.1|7095875_7097882_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	46.0	5.0e-142
WP_141123687.1|7097919_7098414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141123688.1|7098705_7099350_-	hypothetical protein	NA	A0A291AUT0	Sinorhizobium_phage	36.6	3.3e-23
WP_053130823.1|7099369_7099714_-|holin	pyocin R2, holin	holin	B5TK61	Pseudomonas_phage	88.6	7.4e-46
WP_141122941.1|7100240_7100606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155678881.1|7100598_7102818_-	conjugal transfer protein TraC	NA	A0A2D1GN57	Marinobacter_phage	48.2	2.8e-194
>prophage 1
NZ_CP039632	Pseudomonas veronii strain Pvy plasmid unnamed, complete sequence	194607	31311	78192	194607	integrase,transposase	Pseudomonas_phage(27.27%)	40	29761:29777	70499:70515
29761:29777	attL	GGTTGGTCAGCTCGTGC	NA	NA	NA	NA
WP_167331362.1|31311_32499_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.6	1.9e-48
WP_155678971.1|33443_34709_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A077KET4	Ralstonia_phage	39.3	2.3e-68
WP_141123757.1|35436_36234_-	serine/threonine protein phosphatase	NA	A0A291L9W7	Bordetella_phage	43.6	2.3e-42
WP_155679005.1|36252_36930_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155678972.1|36955_37345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155678973.1|37470_38352_-	hypothetical protein	NA	A0A059VA49	Pseudomonas_phage	39.7	2.5e-53
WP_167331363.1|38545_38965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141123780.1|40493_40742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043859960.1|40807_41053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011077965.1|41857_42064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013100883.1|42339_42537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155678974.1|42677_45314_+	conjugal transfer mating pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_141123760.1|45357_46197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043859963.1|46277_46451_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	41.1	2.4e-05
WP_141123781.1|47186_49040_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	50.2	2.1e-102
WP_155678975.1|49178_50165_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_009399901.1|50308_50623_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_155678976.1|50693_52046_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_141123763.1|52061_52643_+	aromatic-ring-hydroxylating dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_141123764.1|52712_53492_+	3-(cis-5,6-dihydroxycyclohexa-1, 3-dien-1-yl)propanoate dehydrogenase	NA	NA	NA	NA	NA
WP_155678977.1|53539_54991_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_141123765.1|55018_55927_+	2,3-dihydroxybiphenyl 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_012727770.1|56182_56818_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_011117406.1|56866_57871_+	trans-o-hydroxybenzylidenepyruvate hydratase-aldolase	NA	NA	NA	NA	NA
WP_011117407.1|58124_58724_+	2-hydroxychromene-2-carboxylate isomerase	NA	NA	NA	NA	NA
WP_155678978.1|60885_61302_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_011117411.1|61407_62025_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_011117412.1|62036_63101_+	alkene reductase	NA	NA	NA	NA	NA
WP_011117413.1|63483_64515_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011154419.1|64531_64909_+	glutathione-S-transferase-like protein	NA	NA	NA	NA	NA
WP_011117414.1|66232_67144_-	SdiA-regulated domain-containing protein	NA	NA	NA	NA	NA
WP_011117415.1|67190_67550_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_031319755.1|67549_68293_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	61.1	5.0e-79
WP_011117418.1|69704_70619_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
70499:70515	attR	GCACGAGCTGACCAACC	NA	NA	NA	NA
WP_155678979.1|70923_71700_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	28.1	1.2e-14
WP_110389057.1|72195_72513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163957669.1|72404_73457_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	85.1	9.4e-108
WP_141123767.1|74823_76215_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	39.9	2.8e-83
WP_080505072.1|76254_76611_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_155678981.1|76629_78192_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	7.0e-83
>prophage 2
NZ_CP039632	Pseudomonas veronii strain Pvy plasmid unnamed, complete sequence	194607	82012	137806	194607	transposase	Micromonas_sp._RCC1109_virus(18.18%)	51	NA	NA
WP_155678983.1|82012_82996_-|transposase	IS5-like element ISAch1 family transposase	transposase	A0A077K814	Ralstonia_phage	57.7	5.2e-92
WP_003292087.1|83669_84572_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043221467.1|84727_86041_+	salicylate 1-monooxygenase	NA	NA	NA	NA	NA
WP_003292091.1|86483_86822_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_009397178.1|86818_87742_+	catechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_009397179.1|87776_89237_+	2-hydroxymuconic semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_009397180.1|89248_90112_+	alpha/beta fold hydrolase	NA	A0A023W6C9	Mycobacterium_phage	38.2	8.8e-11
WP_009397181.1|90108_90894_+	2-oxopent-4-enoate hydratase	NA	NA	NA	NA	NA
WP_009397182.1|90908_91832_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	37.7	2.0e-37
WP_003450283.1|91844_92885_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	36.4	4.1e-47
WP_003292101.1|92881_93676_+	2-oxo-3-hexenedioate decarboxylase	NA	NA	NA	NA	NA
WP_003292102.1|93724_93916_+	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_003292104.1|93946_94387_+	heme-binding protein	NA	NA	NA	NA	NA
WP_155678984.1|95221_96655_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_011078030.1|97819_99070_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	2.2e-47
WP_141123344.1|99365_100391_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011078029.1|100664_102323_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.4	5.6e-22
WP_141123769.1|102548_103121_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	99.2	5.7e-59
WP_155678985.1|103124_106097_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	96.1	0.0e+00
WP_075751106.1|107284_107371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009397190.1|107593_107782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155678986.1|108088_109888_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014819614.1|110092_111013_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_141123770.1|111005_111764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009397194.1|111996_112365_+	DUF3742 family protein	NA	NA	NA	NA	NA
WP_014819613.1|112394_113915_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_014819612.1|113930_114284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014819611.1|114280_115687_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_141123771.1|116640_117090_-	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_014819608.1|117255_117750_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_014819607.1|117945_118686_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_155678989.1|118698_121590_-	conjugative transfer ATPase	NA	NA	NA	NA	NA
WP_014819605.1|121589_122024_-	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_003150544.1|122173_123103_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	46.9	1.9e-40
WP_003089107.1|123304_123544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003150546.1|123543_123954_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_003299771.1|123957_126951_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.6	5.7e-259
WP_003089113.1|126963_127176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003150552.1|127183_127459_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_155678990.1|127471_127825_-	mercury transporter MerT	NA	NA	NA	NA	NA
WP_003089120.1|127900_128299_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003150556.1|128309_128492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003463565.1|128707_129628_-	cation transporter	NA	NA	NA	NA	NA
WP_023294894.1|130409_130781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000091614.1|130777_131104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000741275.1|131127_131463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001172026.1|131477_131813_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_003151133.1|131793_132171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141123773.1|132362_132953_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	49.2	7.3e-41
WP_155678991.1|132949_135982_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_023118183.1|136414_137806_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
