The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040175	Klebsiella pneumoniae strain 2e chromosome, complete genome	5208029	1637795	1644700	5208029	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_023278799.1|1637795_1638659_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|1638669_1639443_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|1639683_1640577_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_048996022.1|1640822_1642184_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	6.7e-207
WP_087759447.1|1642502_1643225_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.1e-30
WP_087851015.1|1643221_1644700_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 2
NZ_CP040175	Klebsiella pneumoniae strain 2e chromosome, complete genome	5208029	2606401	2611656	5208029		Escherichia_phage(100.0%)	7	NA	NA
WP_004176262.1|2606401_2606662_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_063864707.1|2606959_2607820_+	class A broad-spectrum beta-lactamase SHV-77	NA	A0A077SL40	Escherichia_phage	99.0	8.4e-155
WP_002210513.1|2607840_2608602_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_117260968.1|2608592_2608826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903955.1|2608863_2609766_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_137442133.1|2609777_2611043_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	2.5e-232
WP_002210516.1|2611035_2611656_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 3
NZ_CP040175	Klebsiella pneumoniae strain 2e chromosome, complete genome	5208029	3004312	3090089	5208029	integrase,capsid,portal,head,terminase,tRNA,tail	Klebsiella_phage(47.62%)	94	3041092:3041107	3093776:3093791
WP_004213129.1|3004312_3004813_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3004929_3005376_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3005359_3006151_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004148041.1|3006252_3007437_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3007468_3008161_-	CTP synthase	NA	NA	NA	NA	NA
WP_004176547.1|3008306_3008816_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3008802_3009159_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004176548.1|3009148_3009388_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_032417006.1|3009688_3010702_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
WP_004150782.1|3010759_3010861_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|3010860_3010935_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3011052_3011178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3011237_3011501_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3011631_3012270_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3012359_3013274_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004179363.1|3013935_3014979_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004140494.1|3015281_3016490_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004213090.1|3016563_3018348_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_137442172.1|3018354_3019245_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3019365_3020874_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|3021184_3021871_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_135696610.1|3022268_3022448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3022487_3023120_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3023686_3023884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004183659.1|3023999_3025010_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140511.1|3025006_3026413_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3026468_3027356_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3027372_3027879_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004148027.1|3027905_3028400_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3028490_3028676_-	general stress protein	NA	NA	NA	NA	NA
WP_137442173.1|3029297_3030491_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3030603_3030831_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004140532.1|3030851_3031037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008807712.1|3031262_3031586_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_023159861.1|3031578_3031971_+	ACT domain protein	NA	NA	NA	NA	NA
WP_004892950.1|3031967_3032681_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3032953_3033106_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_040200296.1|3033260_3034757_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	69.0	2.8e-137
WP_137442174.1|3034825_3046807_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	48.8	0.0e+00
3041092:3041107	attL	TGCCCTGCTGCGTCAC	NA	NA	NA	NA
WP_040200292.1|3046869_3047460_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	73.4	6.9e-76
WP_077256316.1|3047506_3048190_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_040200289.1|3048244_3048955_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.2	3.6e-135
WP_040200287.1|3048956_3049712_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	4.6e-125
WP_023159871.1|3049708_3050047_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	6.4e-58
WP_095033236.1|3050046_3053403_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.9	0.0e+00
WP_071836352.1|3053402_3053621_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	90.5	5.4e-34
WP_040200283.1|3053635_3054001_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	88.5	2.1e-51
WP_023328090.1|3054058_3054520_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_017898997.1|3054551_3054953_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
WP_017880258.1|3054949_3055339_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_014228910.1|3055319_3055658_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_095033238.1|3055654_3055972_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	88.8	7.6e-45
WP_016160673.1|3055952_3056213_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	9.6e-22
WP_014228907.1|3056271_3057558_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	4.4e-216
WP_040200280.1|3057635_3058556_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_040200279.1|3058592_3059852_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	8.1e-223
WP_017898992.1|3059851_3060031_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_012542167.1|3060024_3061746_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.1e-190
WP_012542168.1|3061745_3062180_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_023316687.1|3062428_3062860_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	62.7	1.1e-41
WP_064793022.1|3062856_3063180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440987.1|3063131_3063494_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	5.2e-58
WP_032440986.1|3063655_3063877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071838913.1|3063984_3064173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017898986.1|3065253_3065604_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.8	1.8e-10
WP_032439908.1|3065600_3066098_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	82.7	9.0e-77
WP_023289178.1|3066075_3066345_-	hypothetical protein	NA	K7P6H9	Enterobacteria_phage	85.9	4.2e-36
WP_137442346.1|3067359_3067803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032440985.1|3067804_3068674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023316683.1|3068702_3069047_-	hypothetical protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	1.8e-55
WP_023316682.1|3069059_3070091_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	49.6	1.2e-96
WP_017898980.1|3070090_3070294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023316681.1|3070290_3070683_-	hypothetical protein	NA	K7PHB4	Enterobacterial_phage	36.6	2.7e-12
WP_077253879.1|3070723_3071014_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	6.1e-17
WP_023316680.1|3071025_3071259_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	68.4	1.0e-22
WP_023316679.1|3071726_3072773_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_023316678.1|3073121_3074612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023316677.1|3074611_3076264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137442175.1|3077859_3078300_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021462583.1|3078313_3078778_-	Replication protein 14	NA	A0A0U2JGJ0	Escherichia_phage	69.5	1.7e-61
WP_049110569.1|3078770_3079754_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	56.4	5.6e-46
WP_017898969.1|3079805_3080360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004147982.1|3080362_3080584_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	75.3	1.2e-28
WP_004147981.1|3080854_3081109_+	hypothetical protein	NA	H6WRX4	Salmonella_phage	54.8	1.6e-13
WP_100040994.1|3081696_3081915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016160636.1|3081924_3082119_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3082161_3082506_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_023316673.1|3082647_3084786_+	exonuclease	NA	S4TNL0	Salmonella_phage	43.0	5.0e-100
WP_012542206.1|3084838_3085084_+	excisionase	NA	NA	NA	NA	NA
WP_014228877.1|3085064_3086192_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	3.3e-119
WP_004150800.1|3086309_3087560_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3087800_3088451_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150802.1|3088467_3088926_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_137442176.1|3088982_3090089_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
3093776:3093791	attR	TGCCCTGCTGCGTCAC	NA	NA	NA	NA
>prophage 4
NZ_CP040175	Klebsiella pneumoniae strain 2e chromosome, complete genome	5208029	3349100	3358564	5208029	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004179158.1|3349100_3350822_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3350866_3351568_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3351921_3352140_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3352260_3354540_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3354570_3354888_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3355213_3355435_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3355511_3357452_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3357448_3358564_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 5
NZ_CP040175	Klebsiella pneumoniae strain 2e chromosome, complete genome	5208029	3839253	3884033	5208029	holin,integrase,head,terminase,tRNA,coat	Cronobacter_phage(20.75%)	71	3832618:3832664	3881104:3881150
3832618:3832664	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_137442232.1|3839253_3841731_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.4	1.0e-197
WP_137442233.1|3841717_3842113_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.8	6.1e-36
WP_065907790.1|3842109_3842580_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	5.6e-28
WP_085820418.1|3842579_3842999_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.1	1.6e-29
WP_137442234.1|3843097_3846466_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	74.6	0.0e+00
WP_032428681.1|3846525_3846939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137442235.1|3847079_3847553_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	40.0	7.9e-14
WP_072061015.1|3847589_3848021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129312537.1|3848031_3848397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049182521.1|3848393_3848699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129312539.1|3849003_3849693_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	53.7	2.3e-62
WP_137442236.1|3849761_3850526_-	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	43.6	3.6e-40
WP_137442237.1|3850584_3850968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032431569.1|3850964_3851333_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	83.6	1.0e-48
WP_040027499.1|3851335_3851698_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	48.3	5.6e-20
WP_004178850.1|3851697_3851871_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	2.4e-13
WP_137442238.1|3851870_3852251_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	4.1e-29
WP_096904591.1|3852253_3852529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040027496.1|3852561_3853617_-|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.2	2.2e-101
WP_016529582.1|3853613_3854075_-	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
WP_047718166.1|3854074_3855430_-	hypothetical protein	NA	F1C5D9	Cronobacter_phage	53.1	3.0e-130
WP_023339708.1|3855507_3855708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137442239.1|3855700_3856702_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.6	2.0e-115
WP_137442240.1|3856628_3858098_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.6	2.4e-149
WP_137442241.1|3858110_3859583_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.5	4.5e-249
WP_065810377.1|3859582_3860098_-|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	74.1	4.8e-65
WP_137442242.1|3860126_3860594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137442243.1|3860691_3860943_-	Rz1 lytic protein	NA	Q8SBD8	Shigella_phage	69.5	4.9e-23
WP_065810379.1|3860827_3861217_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	42.9	7.9e-20
WP_023304960.1|3861213_3861693_-	glycoside hydrolase family 104 protein	NA	A5VW81	Enterobacteria_phage	83.0	1.9e-71
WP_032456970.1|3861676_3862000_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	80.4	2.7e-42
WP_074184069.1|3862124_3862340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137442350.1|3862742_3863432_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	7.9e-55
WP_023283343.1|3863431_3863572_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004151286.1|3863568_3864204_-	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_032413853.1|3864196_3864367_-	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
WP_114262281.1|3864372_3864969_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	6.2e-56
WP_032434127.1|3865075_3865333_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	71.2	4.9e-26
WP_123297955.1|3865414_3865960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137442351.1|3866115_3866562_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	58.8	8.2e-45
WP_023286281.1|3866652_3866874_-	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	2.2e-11
WP_023284955.1|3866870_3867086_-	hypothetical protein	NA	R9TNC2	Aeromonas_phage	94.4	1.5e-36
WP_117041394.1|3867085_3867472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130953484.1|3867468_3867675_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	97.1	1.1e-31
WP_016831916.1|3868096_3868399_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_114262157.1|3868395_3869133_-	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	55.2	6.2e-66
WP_064155319.1|3869129_3870095_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	78.0	2.6e-64
WP_040218315.1|3870154_3870952_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	71.5	2.5e-89
WP_004141720.1|3871038_3871359_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	3.8e-36
WP_004178811.1|3871398_3871632_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
WP_024622727.1|3871736_3872426_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.0e-86
WP_077251895.1|3872448_3872568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807816.1|3872645_3873080_+	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	64.6	9.1e-49
WP_114262158.1|3873076_3873724_+	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	63.0	3.5e-20
WP_004223168.1|3873753_3873957_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	70.1	2.3e-18
WP_071813908.1|3874393_3874600_+	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	4.0e-31
WP_137442244.1|3874680_3874965_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	1.1e-39
WP_137442245.1|3874980_3875826_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.2	1.5e-68
WP_137442246.1|3875822_3876503_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.9	1.8e-123
WP_117245252.1|3876499_3876928_+	regulator	NA	M9NYX4	Enterobacteria_phage	80.3	2.2e-63
WP_137442247.1|3876924_3877581_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.9	2.1e-113
WP_137442248.1|3877577_3878747_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	67.8	3.7e-145
WP_009307984.1|3878743_3878965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064182145.1|3878961_3879498_+	hypothetical protein	NA	J9Q748	Salmonella_phage	74.9	9.4e-72
WP_064783763.1|3879494_3879713_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	50.7	5.8e-12
WP_137442249.1|3879714_3880050_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_023339677.1|3879926_3881090_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.9e-203
WP_137442250.1|3881159_3881483_-	hypothetical protein	NA	NA	NA	NA	NA
3881104:3881150	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_040210634.1|3881521_3882388_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.2	1.0e-30
WP_004143016.1|3882389_3882602_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_040088581.1|3882647_3884033_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 1
NZ_CP040176	Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence	247125	7671	57372	247125	transposase,integrase	Escherichia_phage(23.81%)	55	7617:7636	53926:53945
7617:7636	attL	GGCTTTGTTGAATAAATCAG	NA	NA	NA	NA
WP_072143344.1|7671_8640_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	2.0e-173
WP_000427619.1|8913_9918_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_080925134.1|10780_11026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087833528.1|12188_12410_-	antirestriction protein	NA	NA	NA	NA	NA
WP_032440563.1|12723_12954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187354.1|13051_13390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440562.1|13579_14440_-	DUF4942 domain-containing protein	NA	I6RTT5	Marinomonas_phage	29.9	2.8e-17
WP_023285836.1|14512_14692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023285835.1|15334_15601_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032440561.1|15645_16095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440560.1|16212_16710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440579.1|16702_16948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440559.1|17389_17833_-	plasmid stability family protein	NA	NA	NA	NA	NA
WP_032440558.1|17835_18810_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.7	7.2e-86
WP_086556681.1|19050_19728_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	8.7e-22
WP_032440556.1|19857_20343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440555.1|20427_20676_-	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	51.5	1.6e-10
WP_032440554.1|21460_22519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032440553.1|22511_22721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015344981.1|22792_23077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032440552.1|23216_23858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493286.1|24093_24423_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|24403_24685_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_001351729.1|27152_27545_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|27682_28567_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|28598_29798_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000470728.1|29876_30554_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|30585_30828_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000777554.1|31030_31504_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
WP_000706306.1|31597_32077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000679427.1|32207_32555_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|32548_33388_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|33317_33497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|33515_34016_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001297012.1|34321_34435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|34522_35287_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_019725122.1|35627_36164_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	60.6	6.8e-46
WP_001067855.1|36175_36880_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001535719.1|36946_38344_+	HAMP domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.2	1.1e-58
WP_019725138.1|38491_39139_-	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	48.3	3.9e-48
WP_012477564.1|39202_39793_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001493762.1|39929_40502_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_014839878.1|40538_41930_+|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_004201172.1|43277_43568_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201171.1|43761_44091_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201169.1|44095_45127_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201168.1|45137_45776_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|45780_46146_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_032495384.1|46149_46962_-	subclass B1 metallo-beta-lactamase NDM-6	NA	NA	NA	NA	NA
WP_021740570.1|47390_50408_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	7.2e-52
WP_001067855.1|51028_51733_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015344961.1|51791_52034_+	tetracycline repressor protein class D	NA	NA	NA	NA	NA
WP_012579081.1|53981_54905_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
53926:53945	attR	GGCTTTGTTGAATAAATCAG	NA	NA	NA	NA
WP_001617865.1|54984_55860_-	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_000608644.1|56109_57372_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 2
NZ_CP040176	Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence	247125	88123	95963	247125		Escherichia_phage(71.43%)	10	NA	NA
WP_000922630.1|88123_89413_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.5e-171
WP_001556710.1|89461_91213_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_020324593.1|91230_91593_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_001114073.1|91640_91994_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
WP_077253206.1|92546_92903_+	recombination enhancement function domain protein	NA	Q71TG3	Escherichia_phage	65.2	4.2e-36
WP_000124733.1|92902_93133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000611681.1|93464_93986_+	hypothetical protein	NA	A0A222YZ79	Escherichia_phage	53.8	6.4e-49
WP_004118613.1|93982_94312_+	hypothetical protein	NA	A0A222YYR0	Escherichia_phage	65.1	6.7e-36
WP_003031541.1|94304_95507_+	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	63.6	3.9e-126
WP_000990392.1|95543_95963_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	31.4	1.8e-06
>prophage 1
NZ_CP040177	Klebsiella pneumoniae strain 2e plasmid unnamed2, complete sequence	28566	12216	19761	28566	integrase	Escherichia_phage(50.0%)	8	7285:7344	25263:25390
7285:7344	attL	GGCTTTGTTGAATAAATCAGATTTCGGGTAAGTCTCCCCCGTAGCGGGTTGTGTTTTCAG	NA	NA	NA	NA
WP_000776034.1|12216_12648_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_001754953.1|12647_13919_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.4e-150
WP_006797589.1|14000_14978_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	5.0e-87
WP_000368714.1|14974_16180_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|16594_16864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|17040_17907_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000764642.1|18669_18927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|18984_19761_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
25263:25390	attR	GGCTTTGTTGAATAAATCAGATTTCGGGTAAGTCTCCCCCGTAGCGGGTTGTGTTTTCAGGCAATACGCACGCTTTCAGGCATACCTGCTTTCGTCATTTTGTTCAGCGCTCGTACCAGGGCCATAGC	NA	NA	NA	NA
>prophage 1
NZ_CP040178	Klebsiella pneumoniae strain 2e plasmid unnamed3, complete sequence	59952	35794	45411	59952	integrase,transposase	Burkholderia_phage(42.86%)	11	38944:38961	46128:46145
WP_001749982.1|35794_36514_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
WP_108742639.1|37456_38119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749988.1|38470_39040_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
38944:38961	attL	CCTGATAGATTTGCTCAC	NA	NA	NA	NA
WP_015344971.1|39179_39464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845048.1|39432_40446_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|40601_41075_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|41295_41562_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|41704_42469_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_024139167.1|42510_42723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749969.1|42735_43944_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|43977_45411_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
46128:46145	attR	GTGAGCAAATCTATCAGG	NA	NA	NA	NA
