The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP035944	Escherichia coli strain AR24.2b chromosome, complete genome	4666029	1080529	1093712	4666029		Escherichia_phage(50.0%)	12	NA	NA
WP_001374723.1|1080529_1081291_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
WP_000254708.1|1081284_1081911_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1082050_1083190_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1083252_1084245_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104456.1|1084338_1085703_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1085791_1086568_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1086572_1087211_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1087207_1088470_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1088466_1089375_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1089570_1090338_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141340.1|1090388_1091045_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|1091150_1093712_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 2
NZ_CP035944	Escherichia coli strain AR24.2b chromosome, complete genome	4666029	1182642	1207581	4666029	lysis,tail	Enterobacteria_phage(28.57%)	33	NA	NA
WP_023363292.1|1182642_1183542_-	DNA adenine methylase	NA	A0A0C5AMX6	Cyanophage	23.2	2.5e-08
WP_001596855.1|1183621_1185355_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001596854.1|1185413_1186580_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.2	1.8e-147
WP_001331174.1|1186540_1186747_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001331173.1|1186806_1187022_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001596853.1|1187018_1187381_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.5	1.5e-65
WP_023363286.1|1187371_1187908_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	4.1e-99
WP_023277820.1|1188036_1188861_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	4.3e-148
WP_000135680.1|1188926_1189289_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000196297.1|1189851_1190331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450735.1|1190751_1191378_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000205494.1|1191475_1191676_+	cell division protein	NA	NA	NA	NA	NA
WP_001434539.1|1191713_1192265_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_001250269.1|1192440_1192620_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104977.1|1192609_1193551_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	2.2e-140
WP_077785391.1|1193547_1194042_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	8.1e-86
WP_001377816.1|1194041_1194695_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	8.1e-126
WP_000210170.1|1194691_1195018_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767113.1|1195014_1195404_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_024227971.1|1195423_1196233_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	98.1	1.4e-148
WP_024173873.1|1196240_1197230_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	7.5e-192
WP_001205460.1|1197247_1197589_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131905.1|1197601_1198150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024227970.1|1198136_1199063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001504956.1|1199328_1199523_+	hypothetical protein	NA	Q8SBE3	Shigella_phage	100.0	5.1e-28
WP_000799656.1|1199672_1200725_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|1200792_1201008_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135250.1|1201007_1201505_+	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_001341210.1|1201501_1201969_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001139675.1|1201956_1202109_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_000373425.1|1202783_1203278_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_137675747.1|1203466_1206997_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	37.3	2.5e-11
WP_137675748.1|1206996_1207581_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	3.0e-103
>prophage 3
NZ_CP035944	Escherichia coli strain AR24.2b chromosome, complete genome	4666029	1730998	1740440	4666029		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569361.1|1730998_1731925_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1731929_1732661_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1732641_1732749_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1732808_1733540_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1733761_1735447_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1735443_1736163_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1736209_1736680_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1736720_1737182_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_089455097.1|1737306_1739307_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292773.1|1739303_1740440_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 4
NZ_CP035944	Escherichia coli strain AR24.2b chromosome, complete genome	4666029	2278418	2307021	4666029	integrase,tail	Escherichia_phage(25.0%)	32	2279483:2279497	2303261:2303275
WP_000041556.1|2278418_2280845_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
2279483:2279497	attL	CGCCGTCGCGGATTG	NA	NA	NA	NA
WP_001307224.1|2281043_2281349_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2281456_2282167_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2282169_2282730_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2282764_2283106_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2283240_2283567_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2283772_2284987_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836058.1|2284998_2286018_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2286075_2286186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877001.1|2286205_2287486_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001296941.1|2287520_2287757_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001372999.1|2287844_2290316_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
WP_001083281.1|2290409_2290601_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854559.1|2290597_2290786_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_072163420.1|2290869_2291112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054501.1|2291092_2292058_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_001373616.1|2292098_2292521_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
WP_001678528.1|2292650_2293595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001678529.1|2294142_2295492_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
WP_023147793.1|2295809_2296412_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
WP_023147794.1|2296771_2297752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032181055.1|2297956_2298265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|2298271_2298379_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013632.1|2298423_2298636_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
WP_000980999.1|2298851_2299103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|2299169_2299448_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_001373319.1|2299449_2300499_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.2e-108
WP_000904112.1|2300511_2300886_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762889.1|2300882_2301704_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.7e-78
WP_001373320.1|2302449_2304612_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	96.6	0.0e+00
2303261:2303275	attR	CGCCGTCGCGGATTG	NA	NA	NA	NA
WP_032181053.1|2305443_2306841_+	chaperone of endosialidase	NA	K7PGT9	Enterobacteria_phage	85.2	1.4e-204
WP_072163404.1|2306895_2307021_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	82.5	1.5e-12
>prophage 5
NZ_CP035944	Escherichia coli strain AR24.2b chromosome, complete genome	4666029	2707208	2717986	4666029	integrase	Enterobacteria_phage(40.0%)	11	2705181:2705204	2716689:2716712
2705181:2705204	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
WP_000379042.1|2707208_2709164_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
WP_001753331.1|2711528_2712068_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_072163463.1|2712250_2712562_+	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
WP_001372461.1|2712558_2713239_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
WP_000149533.1|2713235_2713394_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_001678641.1|2713390_2714455_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
WP_001678640.1|2714608_2714827_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
WP_000488406.1|2714874_2715114_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|2715253_2715490_+	excisionase	NA	NA	NA	NA	NA
WP_000741339.1|2715479_2716622_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	99.7	8.1e-206
WP_000444487.1|2716735_2717986_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2716689:2716712	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 6
NZ_CP035944	Escherichia coli strain AR24.2b chromosome, complete genome	4666029	3115082	3143622	4666029	lysis,capsid,integrase,transposase,tail	Enterobacteria_phage(45.71%)	48	3116998:3117012	3143696:3143710
WP_001356070.1|3115082_3116372_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
WP_000767389.1|3116430_3116907_+	kinase inhibitor	NA	NA	NA	NA	NA
3116998:3117012	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001753290.1|3117652_3118984_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_072163407.1|3119057_3119234_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.5	9.4e-21
WP_000239881.1|3119383_3120052_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_072035100.1|3119996_3120134_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
WP_001372490.1|3120942_3121503_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
WP_000105084.1|3121891_3122125_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|3122181_3122592_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|3122943_3123096_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001228702.1|3123124_3123331_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001372488.1|3123547_3124045_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
WP_000839582.1|3124044_3124260_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_085947917.1|3124821_3126094_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001470134.1|3126379_3126514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000592543.1|3126865_3127825_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|3128017_3128542_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|3128697_3129075_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971068.1|3129160_3129301_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001372483.1|3129297_3129660_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
WP_001372487.1|3129656_3129947_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
WP_000224914.1|3129939_3130110_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001372486.1|3130109_3130565_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072157016.1|3130561_3130663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|3130755_3131208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720581.1|3131204_3131765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001403556.1|3132021_3132213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000145917.1|3132249_3132543_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001372464.1|3132539_3133241_-	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_001415152.1|3133237_3134167_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.2e-109
WP_001182899.1|3134253_3134793_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067458.1|3134862_3135093_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|3135197_3135887_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000389051.1|3136009_3136759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210934.1|3136755_3137583_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000233576.1|3138091_3138298_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|3138373_3138670_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3138675_3139461_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_001372450.1|3139457_3140138_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_072126246.1|3140134_3140317_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_023148020.1|3140289_3140481_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_001395510.1|3140491_3140773_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763365.1|3140871_3141093_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_000120065.1|3141303_3141906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525073.1|3142030_3142216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|3142148_3142316_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|3142355_3142574_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|3142551_3143622_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3143696:3143710	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 7
NZ_CP035944	Escherichia coli strain AR24.2b chromosome, complete genome	4666029	4017507	4024066	4666029	transposase	uncultured_Caudovirales_phage(16.67%)	7	NA	NA
WP_000684856.1|4017507_4018464_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4018464_4019232_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|4019789_4020047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254876.1|4021098_4022250_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000747102.1|4022169_4022520_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_000227281.1|4022620_4023193_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|4023241_4024066_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
