The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040255	Mycobacterium avium subsp. hominissuis strain 101115 chromosome, complete genome	5254673	3235260	3310158	5254673	transposase,protease,tRNA,integrase,bacteriocin	Enterobacteria_phage(23.08%)	58	3256233:3256251	3311951:3311969
WP_019733270.1|3235260_3236058_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_033713095.1|3236054_3237065_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_033713110.1|3237108_3238416_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_019733919.1|3238435_3238783_+	VOC family protein	NA	NA	NA	NA	NA
WP_003875794.1|3238783_3239005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033717192.1|3239133_3241431_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	62.6	4.0e-268
WP_050593748.1|3241450_3242101_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_023861906.1|3242113_3242503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085978605.1|3242568_3244167_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	29.7	1.2e-45
WP_003875800.1|3245401_3245587_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_011723733.1|3245733_3246828_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_019732695.1|3246938_3247808_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_019732696.1|3248079_3248742_-	FABP family protein	NA	NA	NA	NA	NA
WP_003877205.1|3248887_3249190_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003875806.1|3249191_3250025_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_019732697.1|3250061_3250532_-	DUF4395 domain-containing protein	NA	NA	NA	NA	NA
WP_009974936.1|3250754_3251174_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_019732698.1|3251170_3251983_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_019732699.1|3252151_3252934_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.5	9.1e-15
WP_019732700.1|3252930_3253881_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_009974939.1|3254043_3255168_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A2R8FEI2	Cedratvirus	47.7	4.5e-07
WP_003877208.1|3255219_3256263_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
3256233:3256251	attL	CGCCGGGGTGGGCAGGCGG	NA	NA	NA	NA
WP_009974941.1|3256259_3257174_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_003875815.1|3257186_3257963_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	2.8e-16
WP_003875816.1|3258035_3258704_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_033720292.1|3258762_3260880_-	LCP family protein	NA	NA	NA	NA	NA
WP_073578938.1|3260838_3261054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019732805.1|3261087_3262221_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003875819.1|3262227_3263250_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_023861897.1|3263434_3264049_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019732397.1|3264117_3265191_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_011723747.1|3265207_3265411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003877217.1|3265467_3265869_-	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	31.9	4.6e-07
WP_019732396.1|3265912_3266446_-	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	39.3	5.6e-16
WP_019732395.1|3266500_3267397_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_132160402.1|3268441_3270469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062887574.1|3271927_3272266_-	DUF3024 domain-containing protein	NA	NA	NA	NA	NA
WP_062895398.1|3272270_3272849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062895396.1|3272894_3273686_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	34.9	5.0e-29
WP_062887208.1|3273682_3275269_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_009979999.1|3278477_3279272_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	1.6e-30
WP_132160400.1|3281839_3282910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057969464.1|3285769_3286663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094494180.1|3286867_3287980_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	44.2	1.0e-67
WP_007172599.1|3291659_3292751_-|integrase	site-specific integrase	integrase	A0A0E3XBN7	Gordonia_phage	33.7	1.1e-42
WP_080691138.1|3292877_3293060_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_007172118.1|3294719_3295436_+	ParA family protein	NA	NA	NA	NA	NA
WP_007172119.1|3295435_3296326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075630248.1|3296601_3297684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080691139.1|3298294_3298783_+	hypothetical protein	NA	A0A1W6DXV0	Rhodococcus_phage	50.0	1.4e-21
WP_007172122.1|3298730_3299402_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007172123.1|3299723_3300146_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_007172124.1|3300138_3300462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137987479.1|3300476_3300725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062895396.1|3302498_3303290_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	34.9	5.0e-29
WP_062887574.1|3303917_3304256_+	DUF3024 domain-containing protein	NA	NA	NA	NA	NA
WP_033717261.1|3304973_3305582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079276894.1|3308904_3310158_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3311951:3311969	attR	CCGCCTGCCCACCCCGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP040255	Mycobacterium avium subsp. hominissuis strain 101115 chromosome, complete genome	5254673	3383557	3412319	5254673	transposase,integrase	Enterobacteria_phage(25.0%)	18	3402498:3402557	3412320:3412393
WP_062887208.1|3383557_3385144_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_062895396.1|3385140_3385932_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	34.9	5.0e-29
WP_062895398.1|3385977_3386556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062887574.1|3386560_3386899_+	DUF3024 domain-containing protein	NA	NA	NA	NA	NA
WP_046186391.1|3389660_3391448_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	36.1	1.8e-82
WP_007172236.1|3392160_3393399_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.6	1.9e-06
WP_040624285.1|3393812_3393992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080691069.1|3394276_3395083_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_007172240.1|3395129_3396695_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007172469.1|3398649_3399111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047324300.1|3399100_3401347_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3402498:3402557	attL	AACGCATTTCCCGGCATCTCCGAACGCGTGTCGTCTACATGGTGAACAGCTTCCTCACGG	NA	NA	NA	NA
WP_131727298.1|3404191_3404716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007172252.1|3404589_3405369_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_007172254.1|3405721_3406171_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_007172255.1|3406480_3407188_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007172469.1|3408470_3408932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047324300.1|3408921_3411168_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_137987483.1|3411176_3412319_-|integrase	tyrosine-type recombinase/integrase	integrase	S5MBZ0	Brevibacillus_phage	29.9	5.8e-10
3412320:3412393	attR	AACGCATTTCCCGGCATCTCCGAACGCGTGTCGTCTACATGGTGAACAGCTTCCTCACGGCCTCAGATAACCAA	NA	NA	NA	NA
>prophage 3
NZ_CP040255	Mycobacterium avium subsp. hominissuis strain 101115 chromosome, complete genome	5254673	3431412	3496297	5254673	transposase,integrase	Enterobacteria_phage(28.57%)	42	3437200:3437216	3499649:3499665
WP_011724019.1|3431412_3432717_-|transposase	IS256-like element IS666 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	83.4	2.1e-210
WP_033721575.1|3435154_3436171_+	diiron oxygenase	NA	NA	NA	NA	NA
WP_074021023.1|3436106_3436331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172270.1|3436383_3437247_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
3437200:3437216	attL	TGAGCCAGCGCCGGTGA	NA	NA	NA	NA
WP_075362367.1|3437876_3438683_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_007172273.1|3438752_3439622_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_007172274.1|3439593_3441222_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007172275.1|3441218_3442172_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007172276.1|3442499_3442907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062887574.1|3446398_3446737_+	DUF3024 domain-containing protein	NA	NA	NA	NA	NA
WP_007172277.1|3446839_3447127_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_007172278.1|3447153_3447606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050485493.1|3447593_3448715_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_085981753.1|3449097_3449865_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	34.2	1.2e-32
WP_079669096.1|3449903_3451412_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_137987484.1|3457690_3457876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033721569.1|3458259_3459768_-	carboxylesterase/lipase family protein	NA	A0A0M4JT58	Mollivirus	32.8	8.1e-28
WP_033721570.1|3459900_3460797_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_007172283.1|3460849_3461290_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_033721572.1|3461338_3461983_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007172286.1|3462106_3463600_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
WP_007172287.1|3463596_3464694_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_007172600.1|3464736_3465945_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_007172288.1|3466215_3466761_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_007172562.1|3470067_3473001_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_007172563.1|3472997_3473417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172294.1|3473521_3474715_-	cytochrome P450	NA	NA	NA	NA	NA
WP_033717422.1|3474780_3475362_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033717424.1|3476007_3476631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087139652.1|3476615_3477227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172298.1|3477917_3478994_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_007172299.1|3478990_3479314_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007172300.1|3479454_3480582_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_047324308.1|3482189_3483701_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	33.0	3.0e-54
WP_062887574.1|3484611_3484950_-	DUF3024 domain-containing protein	NA	NA	NA	NA	NA
WP_062895398.1|3484954_3485533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062895396.1|3485578_3486370_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	34.9	5.0e-29
WP_007168486.1|3490328_3490670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007168487.1|3490690_3491098_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_137987485.1|3491101_3491374_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_007172498.1|3494066_3495116_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	27.1	3.8e-08
WP_094494180.1|3495184_3496297_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	44.2	1.0e-67
3499649:3499665	attR	TGAGCCAGCGCCGGTGA	NA	NA	NA	NA
>prophage 1
NZ_CP040253	Mycobacterium avium subsp. hominissuis strain 101115 plasmid pMARIA, complete sequence	40211	0	5700	40211	transposase	Mycobacterium_phage(100.0%)	3	NA	NA
WP_133438222.1|1472_1658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133438221.1|2097_2388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011724019.1|4395_5700_+|transposase	IS256-like element IS666 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	83.4	2.1e-210
>prophage 2
NZ_CP040253	Mycobacterium avium subsp. hominissuis strain 101115 plasmid pMARIA, complete sequence	40211	11979	12771	40211		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_062895396.1|11979_12771_-	ATP-binding protein	NA	A0A1B1IWL7	uncultured_Mediterranean_phage	33.5	6.8e-10
>prophage 3
NZ_CP040253	Mycobacterium avium subsp. hominissuis strain 101115 plasmid pMARIA, complete sequence	40211	18732	21120	40211		Enterobacteria_phage(50.0%)	3	NA	NA
WP_055576341.1|18732_19329_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.5	5.8e-38
WP_068021939.1|19496_20285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137987263.1|20550_21120_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	53.9	1.6e-40
>prophage 4
NZ_CP040253	Mycobacterium avium subsp. hominissuis strain 101115 plasmid pMARIA, complete sequence	40211	25378	39074	40211	transposase,integrase	Mycobacterium_phage(75.0%)	12	11820:11836	31200:31216
11820:11836	attL	GTCGCCGGCCGACGCTG	NA	NA	NA	NA
WP_033717226.1|25378_26461_-|integrase	tyrosine-type recombinase/integrase	integrase	S5MBZ0	Brevibacillus_phage	29.9	5.5e-10
WP_137987264.1|26655_27621_+|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	43.8	4.6e-61
WP_137987269.1|27742_28168_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_133438219.1|28265_28997_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_133438218.1|29113_29341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133438217.1|29333_29909_-	ParA family protein	NA	W0LIU2	Mycobacterium_phage	58.2	4.0e-52
WP_055577712.1|30282_30486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133438216.1|30717_31965_+	rep protein	NA	A0A286MQ55	Mycobacterium_phage	40.7	6.2e-42
31200:31216	attR	CAGCGTCGGCCGGCGAC	NA	NA	NA	NA
WP_133438215.1|32338_35140_+	relaxase domain-containing protein	NA	V5UQN3	Mycobacterium_phage	32.3	1.3e-103
WP_137987265.1|35439_36750_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	89.1	1.9e-227
WP_055578314.1|36756_37458_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	93.1	5.8e-130
WP_137987266.1|37808_39074_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.9	1.3e-39
