The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040257	Moraxella osloensis strain MOXF1 chromosome, complete genome	2983035	517615	589301	2983035	tRNA,transposase	uncultured_virus(37.5%)	64	NA	NA
WP_095355955.1|517615_519502_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_076774169.1|519657_520764_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	34.2	8.6e-27
WP_138018085.1|520777_522805_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_138018086.1|522916_523327_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	2.1e-47
WP_138018087.1|523375_524482_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q19ZT4	Mycobacterium_virus	32.0	3.8e-27
WP_036595824.1|524718_525009_+	YeaC family protein	NA	NA	NA	NA	NA
WP_138018088.1|525132_526197_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_138018089.1|526273_527587_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_138018090.1|527935_529318_+	3-oxoacyl-ACP reductase	NA	A0A0P0CIK1	Ostreococcus_mediterraneus_virus	28.9	9.1e-10
WP_138018091.1|529575_530472_+	acyl dehydratase	NA	NA	NA	NA	NA
WP_138019414.1|530597_531953_+	serine hydrolase	NA	NA	NA	NA	NA
WP_138018092.1|532011_532431_+	HIT family protein	NA	NA	NA	NA	NA
WP_138018093.1|532471_533413_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_138018094.1|534048_535167_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_138018095.1|535183_535615_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_138018096.1|535715_537884_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_138018097.1|537928_539860_+	polysaccharide biosynthesis protein	NA	L7Y3T9	Megavirus	26.7	4.5e-15
WP_138018098.1|539882_540950_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.6	5.1e-101
WP_138019415.1|540943_541828_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.2	4.9e-110
WP_138018099.1|541824_542226_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_138018100.1|542228_543290_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_138018101.1|543289_544195_+	NAD(P)-dependent oxidoreductase	NA	M1I3H4	Acanthocystis_turfacea_Chlorella_virus	27.9	6.8e-14
WP_138018102.1|544172_544784_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_138018103.1|544818_545940_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.6	3.3e-42
WP_138018104.1|545939_547199_+	O-antigen translocase	NA	NA	NA	NA	NA
WP_138018105.1|547203_548109_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	37.8	2.7e-10
WP_138018106.1|548186_549140_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_138018107.1|549144_550113_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_138018108.1|550109_551186_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_138018109.1|551194_552283_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_138018110.1|552272_553343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018111.1|553339_554470_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_138018112.1|554470_555064_+	sugar transferase	NA	NA	NA	NA	NA
WP_138018113.1|555108_556236_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_138018114.1|556236_557202_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_138018115.1|557185_557839_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_138018116.1|557858_559073_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L0G1	Tupanvirus	49.4	2.0e-106
WP_138018117.1|559087_560524_+	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
WP_138018118.1|560595_561372_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_138018119.1|561549_562281_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_099808117.1|562455_562851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036605163.1|563679_564834_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1S5RFS3	Helicobacter_phage	40.8	6.1e-68
WP_138018120.1|564988_566176_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	35.6	2.9e-57
WP_138018121.1|566234_568184_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_065252739.1|568119_569523_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_138019416.1|569724_570918_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_138018122.1|571059_571887_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_138018123.1|571952_573251_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_138018124.1|573299_574415_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_138018125.1|574479_575388_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138018126.1|575389_576340_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_007115369.1|576549_577749_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_076777139.1|577900_578998_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_007115672.1|579230_580031_-	alpha/beta hydrolase	NA	A0A218MNI3	uncultured_virus	100.0	2.2e-157
WP_138018127.1|580206_582717_-	relaxase/mobilization nuclease domain-containing protein	NA	M1Q738	Cellulophaga_phage	31.5	8.2e-33
WP_138018128.1|582721_583240_-	hypothetical protein	NA	A0A218MNF9	uncultured_virus	98.8	3.2e-85
WP_138018129.1|583835_584201_-	PTD012 family protein	NA	A0A218MNF6	uncultured_virus	96.7	2.1e-67
WP_138018130.1|584260_584545_-	hypothetical protein	NA	A0A218MNB9	uncultured_virus	100.0	4.2e-47
WP_040403339.1|584720_584960_+	helix-turn-helix transcriptional regulator	NA	S5MTW4	Brevibacillus_phage	37.1	4.4e-05
WP_138018131.1|585012_585666_-	3'-5' exonuclease	NA	A0A218MNF0	uncultured_virus	94.2	1.8e-101
WP_138018132.1|585672_586353_-	SOS response-associated peptidase	NA	A0A218MNF5	uncultured_virus	93.8	2.5e-114
WP_138018133.1|586373_587693_-	Y-family DNA polymerase	NA	A0A218MNF2	uncultured_virus	98.6	4.9e-247
WP_076777055.1|587833_588286_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	100.0	7.7e-83
WP_065252193.1|588344_589301_-	replication initiation protein	NA	A0A218MNI2	uncultured_virus	100.0	5.3e-174
>prophage 2
NZ_CP040257	Moraxella osloensis strain MOXF1 chromosome, complete genome	2983035	639301	681153	2983035	transposase,integrase	uncultured_virus(50.0%)	37	631962:631999	672867:672904
631962:631999	attL	AGGGGTCAGCACAGAATTCGGAGAAAATAGCACGCTAA	NA	NA	NA	NA
WP_138018153.1|639301_642265_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	23.5	2.4e-63
WP_007116059.1|642304_643267_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_007116058.1|643350_643758_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_040403539.1|643829_644180_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_040403538.1|644193_644469_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_138018154.1|644731_646354_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	9.3e-38
WP_007116054.1|646365_647001_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_036594787.1|648517_648970_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007116051.1|649075_651088_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.2	1.8e-99
WP_007116050.1|651160_651865_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_007116049.1|651915_652458_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_076777065.1|652531_654493_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_138018155.1|654624_656838_-	cation-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	99.7	0.0e+00
WP_007116046.1|656950_657163_-	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	100.0	2.7e-30
WP_076777061.1|657204_657954_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	100.0	2.5e-131
WP_138018156.1|658062_658455_+	MerR family DNA-binding protein	NA	NA	NA	NA	NA
WP_138018157.1|658675_659548_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_007116042.1|659740_660151_+	DedA family protein	NA	NA	NA	NA	NA
WP_138018158.1|660495_661488_-|transposase	transposase	transposase	A0A218MNH3	uncultured_virus	99.1	4.2e-190
WP_138018159.1|661994_662591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018160.1|663103_663934_+	cation transporter	NA	NA	NA	NA	NA
WP_138018161.1|664023_665305_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	48.4	1.1e-73
WP_138018162.1|665536_666217_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_138018163.1|666239_666587_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	99.1	1.1e-57
WP_138018164.1|666602_666896_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A218MNF3	uncultured_virus	96.9	1.1e-50
WP_138018165.1|666957_668250_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	67.0	1.7e-151
WP_007116029.1|668358_668880_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	37.6	1.3e-20
WP_050325899.1|669345_670098_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	67.1	1.9e-86
WP_138018166.1|670119_670533_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	53.0	1.6e-31
WP_007116025.1|670882_672403_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	71.1	3.2e-189
WP_099834574.1|673677_674442_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
672867:672904	attR	TTAGCGTGCTATTTTCTCCGAATTCTGTGCTGACCCCT	NA	NA	NA	NA
WP_138018167.1|674761_676585_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_007116540.1|677094_677301_-|transposase	transposase	transposase	A0A218MND5	uncultured_virus	100.0	2.4e-31
WP_007116539.1|677384_678302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018168.1|679143_679440_-	DUF2218 domain-containing protein	NA	A0A218MNG7	uncultured_virus	100.0	1.2e-49
WP_007115237.1|679754_680228_-	damage-inducible protein CinA	NA	A0A218MNG4	uncultured_virus	100.0	5.0e-85
WP_138018169.1|680610_681153_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP040257	Moraxella osloensis strain MOXF1 chromosome, complete genome	2983035	752498	834702	2983035	tRNA,transposase	Mycobacterium_virus(16.67%)	96	NA	NA
WP_065253904.1|752498_753857_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_138018211.1|754394_756266_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_138018212.1|756526_757207_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_138018213.1|757265_758033_-	PAP2 family lipid A phosphatase	NA	NA	NA	NA	NA
WP_138018214.1|758158_759820_-	phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_138018215.1|760011_760482_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_076775585.1|760670_761069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138019422.1|761361_761583_-	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_138018216.1|761578_761977_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_138018217.1|761979_762951_-	D-2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	25.2	2.3e-23
WP_062333171.1|762965_763295_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_007116581.1|763272_763545_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_007115011.1|763662_763965_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	100.0	2.2e-49
WP_138018218.1|763957_764500_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_138018219.1|764652_765441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076777121.1|765433_766288_+	NAD-dependent deacetylase	NA	S5M4R0	Bacillus_phage	24.3	3.6e-09
WP_138018220.1|766280_767117_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_138018221.1|767146_768308_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_138018222.1|768783_769173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018223.1|769184_769388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018224.1|769629_769959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128681997.1|770013_770517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018225.1|770738_771440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018226.1|771623_772103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018227.1|772137_772731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018228.1|772967_773342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018229.1|773367_773754_-	hypothetical protein	NA	K0G8N7	Mycobacterium_virus	41.5	1.9e-13
WP_138018230.1|773825_774368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018231.1|774622_775123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018232.1|775164_775503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018233.1|775844_776822_-	TonB C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_128682142.1|777030_777237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018234.1|777417_778119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018235.1|778352_778898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128682151.1|779111_779900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018236.1|780046_780433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018237.1|780443_780797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018238.1|780789_781362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128682159.1|781620_782283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018239.1|782575_783019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018240.1|783275_783488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018241.1|783553_784090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018242.1|784366_784642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018243.1|784813_785380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018244.1|785512_785776_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	28.6	3.4e-06
WP_138018245.1|785772_786276_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_138018246.1|786514_787777_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	52.1	6.3e-58
WP_138018247.1|787787_788750_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_138018248.1|788777_790340_+	DUF389 domain-containing protein	NA	NA	NA	NA	NA
WP_138018249.1|790937_791813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018250.1|791809_792022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018251.1|792079_792250_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_138018252.1|792661_794485_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_138018253.1|794498_794741_-	nodulation protein N	NA	NA	NA	NA	NA
WP_138018254.1|794805_795570_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_051500637.1|795988_797032_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138018255.1|797536_797731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018256.1|797760_798417_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	44.4	1.2e-36
WP_138018244.1|798448_798712_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	28.6	3.4e-06
WP_138018245.1|798708_799212_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_128681906.1|799623_799824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018257.1|799933_800149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018258.1|800188_801337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018259.1|802038_802831_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_138018260.1|803023_805681_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.5	7.3e-157
WP_057063737.1|805763_807056_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_138018261.1|807075_807906_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_057063733.1|807979_809311_-	DUF3422 family protein	NA	NA	NA	NA	NA
WP_057063731.1|809342_809921_-	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
WP_009518307.1|809996_811106_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	31.3	1.3e-35
WP_009518278.1|811163_811439_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_128682224.1|814505_814928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128682226.1|815151_815394_+	DUF727 domain-containing protein	NA	NA	NA	NA	NA
WP_128682228.1|816049_816799_-	replication initiation protein	NA	NA	NA	NA	NA
WP_128682230.1|817025_817802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128682232.1|818176_818596_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_128682234.1|818741_819248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128682236.1|819352_819742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128682238.1|819762_820332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128682240.1|820518_820779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099833455.1|820824_821889_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_128681941.1|822239_822779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681940.1|822772_823240_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_128681938.1|823331_824621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681936.1|824857_825964_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q19ZT4	Mycobacterium_virus	31.5	3.5e-28
WP_128681933.1|826145_826754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681931.1|826822_827038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681929.1|827257_827746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681928.1|828082_828481_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_138018262.1|828489_829296_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_128681926.1|829435_830617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018263.1|830953_831481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018264.1|831701_832445_+	phosphoribosyltransferase	NA	A0A0R6PHM5	Moraxella_phage	35.9	7.8e-32
WP_128681920.1|833002_833344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018265.1|833580_833955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018266.1|833906_834702_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP040257	Moraxella osloensis strain MOXF1 chromosome, complete genome	2983035	858383	933300	2983035	transposase	Mycobacterium_virus(18.18%)	49	NA	NA
WP_138018282.1|858383_859490_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q19ZT4	Mycobacterium_virus	30.2	1.0e-27
WP_128682458.1|859646_860672_-	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_138018283.1|861228_866034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681855.1|866092_866518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128681853.1|866898_867426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128681851.1|867749_868652_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_128681849.1|868661_869429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128681847.1|869412_870978_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_000052512.1|872712_874188_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|874243_875128_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_015060246.1|875317_875929_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	27.7	2.4e-07
WP_015589625.1|876103_877000_-	RTG family carbenicillin-hydrolyzing class A beta-lactamase CARB-16	NA	Q38058	Escherichia_phage	47.1	4.4e-66
WP_128681841.1|877363_877996_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	32.1	1.6e-06
WP_011954794.1|878010_878313_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_110817442.1|878314_878662_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_128681839.1|878790_879357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115304630.1|879870_880622_-|transposase	IS5-like element IS1301 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.7	1.3e-15
WP_128682222.1|880702_881335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059246498.1|882865_883636_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_072690052.1|883952_884060_-	DUF2474 family protein	NA	NA	NA	NA	NA
WP_138018284.1|884068_885073_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_138018266.1|886247_887042_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_138018285.1|886986_887367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018286.1|887540_888392_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_138018287.1|888638_889928_+	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_138018288.1|889939_890674_-	phage Gp37/Gp68 family protein	NA	A0A2P1A0W3	Gordonia_phage	44.1	8.7e-60
WP_138018289.1|891787_894151_+	DEAD/DEAH box helicase family protein	NA	A0A096XUV7	Cronobacter_phage	23.3	1.5e-07
WP_138018290.1|894192_895806_+	SAM-dependent DNA methyltransferase	NA	A0A2H4UVB0	Bodo_saltans_virus	28.4	8.7e-20
WP_138018291.1|895809_897327_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_128681478.1|897362_898607_-	replication initiation protein	NA	NA	NA	NA	NA
WP_138018292.1|899479_912838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018293.1|913144_916399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681452.1|916461_918903_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_138018294.1|918945_920052_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q19ZT4	Mycobacterium_virus	31.5	5.9e-28
WP_128682201.1|920336_920654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128682203.1|920650_921691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128682205.1|921724_922621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018295.1|922631_923186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018296.1|923185_923968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018297.1|924041_926009_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_128682214.1|926011_926770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128682216.1|926772_927408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018298.1|927502_927685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018299.1|927921_928593_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_128682220.1|928659_928932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051500637.1|929064_930108_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_122129129.1|930242_930527_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_128681947.1|930631_931495_+	sulfonamide-resistant dihydropteroate synthase Sul4	NA	A0A0B5J4J5	Pandoravirus	32.9	3.4e-31
WP_014325823.1|932007_933300_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP040257	Moraxella osloensis strain MOXF1 chromosome, complete genome	2983035	939421	1011892	2983035	transposase,integrase	Mycobacterium_virus(18.18%)	60	935893:935908	981938:981953
935893:935908	attL	GCTGCTTGAGCTGCTG	NA	NA	NA	NA
WP_001120888.1|939421_940915_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|940945_941197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|941090_941393_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|941479_942295_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_128682406.1|943422_943887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018301.1|944980_946087_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q19ZT4	Mycobacterium_virus	31.0	5.9e-28
WP_128681663.1|946328_947480_-	replication initiation protein	NA	A0A218MNI2	uncultured_virus	26.8	5.6e-13
WP_128681662.1|948754_950425_-	ATP-dependent helicase	NA	A0A075DXT4	Acinetobacter_phage	32.9	2.8e-61
WP_128681661.1|950666_952853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681660.1|952854_955188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681659.1|955473_955758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018302.1|955826_956348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128681657.1|956479_957664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128681656.1|958397_958715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681655.1|958916_959297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681654.1|959335_960133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681653.1|960153_961416_+|integrase	integrase family protein	integrase	A0A0R6PH06	Moraxella_phage	28.1	2.0e-24
WP_128681652.1|961590_962004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681651.1|962114_962504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681650.1|962508_963453_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_138018303.1|963508_964108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018304.1|964374_966933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681647.1|966949_967603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681646.1|967614_968775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681645.1|968792_969758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681644.1|969798_970956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681643.1|970968_972264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681642.1|972288_973179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681641.1|973241_973763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128681640.1|973773_974247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128681639.1|974478_974997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128681638.1|975049_975784_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_128681637.1|975777_977097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128681636.1|977090_977528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128681635.1|977586_978027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018305.1|978150_983454_+	DotA/TraY family protein	NA	NA	NA	NA	NA
981938:981953	attR	CAGCAGCTCAAGCAGC	NA	NA	NA	NA
WP_128681633.1|983471_983699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018306.1|983985_985089_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q19ZT4	Mycobacterium_virus	35.2	7.0e-29
WP_128682322.1|985119_986745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018307.1|986902_989311_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	32.0	2.6e-60
WP_138018308.1|989322_990963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018309.1|990965_992219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018310.1|992258_993365_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_128681984.1|993391_993655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018311.1|993669_995022_-	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_138018312.1|995021_996551_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_138018313.1|996562_997054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018314.1|997405_997747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018315.1|998274_998832_-	single-stranded DNA-binding protein	NA	A0A0R6PHK0	Moraxella_phage	46.7	7.4e-19
WP_138018221.1|998825_999987_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_138018316.1|1000314_1000602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076777125.1|1000601_1002506_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_138018317.1|1002502_1002850_+	serine/threonine protein phosphatase	NA	S5MD19	Sinorhizobium_phage	41.8	2.0e-14
WP_076777127.1|1003207_1004290_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_138018318.1|1004669_1004933_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	28.6	2.0e-06
WP_138018319.1|1004929_1005433_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_138018320.1|1005396_1006284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018321.1|1006337_1009193_-	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	69.0	0.0e+00
WP_138018322.1|1009203_1010574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018323.1|1010632_1011892_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	95.9	1.1e-105
>prophage 6
NZ_CP040257	Moraxella osloensis strain MOXF1 chromosome, complete genome	2983035	1357854	1366914	2983035		Vibrio_phage(33.33%)	6	NA	NA
WP_138018495.1|1357854_1361226_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2D0YEC8	Vibrio_phage	29.7	2.1e-60
WP_138018496.1|1361261_1362245_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	38.5	5.2e-52
WP_138018497.1|1362814_1363081_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A218MNF3	uncultured_virus	74.1	1.1e-28
WP_138018498.1|1363148_1364441_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	67.1	3.5e-149
WP_138018499.1|1364466_1364877_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	59.1	1.7e-36
WP_138018500.1|1365228_1366914_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	28.7	5.9e-27
>prophage 7
NZ_CP040257	Moraxella osloensis strain MOXF1 chromosome, complete genome	2983035	1766289	1818127	2983035	tRNA,transposase	uncultured_Caudovirales_phage(23.08%)	46	NA	NA
WP_138018714.1|1766289_1768050_+|tRNA	proline--tRNA ligase	tRNA	A0A1V0SEQ8	Hokovirus	23.0	2.0e-06
WP_138018715.1|1768201_1770385_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	59.0	5.5e-235
WP_036593367.1|1770713_1770923_-	CsbD family protein	NA	NA	NA	NA	NA
WP_050325425.1|1771240_1771729_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_050325509.1|1772060_1773119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007115798.1|1773430_1775011_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	33.1	3.2e-11
WP_050325427.1|1775016_1775421_+	DUF596 domain-containing protein	NA	NA	NA	NA	NA
WP_096488442.1|1775585_1775843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018716.1|1776323_1777238_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_138019468.1|1777264_1778047_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_138018717.1|1778092_1779760_+	GAF domain-containing hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	37.4	1.1e-54
WP_007115790.1|1779929_1781438_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	31.2	3.1e-19
WP_050325430.1|1781500_1782679_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_060995594.1|1783074_1784199_+	N-ethylmaleimide reductase	NA	NA	NA	NA	NA
WP_138018718.1|1784408_1784780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018719.1|1784788_1785700_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_138018720.1|1785974_1787048_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	51.0	6.5e-80
WP_138018721.1|1787393_1787969_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.7	3.2e-33
WP_007115782.1|1788161_1788914_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_138018722.1|1788993_1789602_+	TerD family protein	NA	NA	NA	NA	NA
WP_138018723.1|1789878_1790970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018724.1|1790966_1791242_+	RnfH family protein	NA	NA	NA	NA	NA
WP_099808566.1|1791328_1791682_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_050325439.1|1792033_1792471_+	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_138018725.1|1792625_1794212_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_138018726.1|1794383_1794968_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
WP_138018727.1|1795154_1798310_+	DUF2339 domain-containing protein	NA	NA	NA	NA	NA
WP_138018728.1|1798841_1800521_+	DUF3999 family protein	NA	NA	NA	NA	NA
WP_138019469.1|1800634_1801477_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_138018729.1|1801544_1802456_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_138018730.1|1802526_1803459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036593399.1|1803570_1804218_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_060995581.1|1804284_1804866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018731.1|1804932_1805907_+	glutathione synthase	NA	NA	NA	NA	NA
WP_138018732.1|1805978_1807952_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_138018733.1|1809660_1810032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018734.1|1810195_1810378_-|transposase	transposase	transposase	A0A2P1JR32	Mycobacterium_phage	48.8	6.7e-06
WP_138018735.1|1810381_1810777_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138018736.1|1810773_1811214_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_138018737.1|1811276_1812014_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	53.5	6.7e-68
WP_138018738.1|1812022_1812331_-|transposase	transposase	transposase	B6ETC4	Enterobacteria_phage	52.9	1.0e-22
WP_138018739.1|1813045_1813435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067763188.1|1813543_1813942_+	hypothetical protein	NA	A0A2H4J146	uncultured_Caudovirales_phage	41.1	6.9e-11
WP_138018740.1|1814059_1814596_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	60.7	5.7e-61
WP_138018741.1|1814694_1816023_-	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_138018742.1|1816912_1818127_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.1	1.1e-48
>prophage 8
NZ_CP040257	Moraxella osloensis strain MOXF1 chromosome, complete genome	2983035	2227076	2320054	2983035	tRNA,protease,transposase	uncultured_virus(29.17%)	89	NA	NA
WP_040403991.1|2227076_2227361_+|tRNA	DNA-binding protein for site-specific recombination, transcription of rRNA and tRNA operons and DNA replication	tRNA	NA	NA	NA	NA
WP_076775925.1|2227513_2229094_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.8	1.1e-67
WP_138018962.1|2229181_2230270_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_138018963.1|2230298_2232404_-	AAA family ATPase	NA	A0A172Q090	Acinetobacter_phage	31.2	3.7e-63
WP_138018964.1|2232538_2233051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018965.1|2233072_2233216_-	DUF1543 domain-containing protein	NA	NA	NA	NA	NA
WP_138018966.1|2233321_2234311_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_138019490.1|2234564_2236382_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	28.6	1.2e-09
WP_138018967.1|2236404_2237349_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_138018968.1|2237367_2238150_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_138018969.1|2238259_2239069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018970.1|2239059_2239914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138019491.1|2239891_2240968_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_138018971.1|2241005_2241761_-	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_138018972.1|2241779_2242877_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_138018973.1|2242892_2243762_-	glycosyl transferase	NA	D6PFI0	uncultured_phage	31.9	5.5e-05
WP_007116867.1|2243772_2244600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007116868.1|2244694_2245639_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_138018974.1|2245725_2248548_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_050323873.1|2249001_2249382_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_050323871.1|2249402_2249921_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_007117400.1|2250135_2250558_+|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	100.0	1.8e-73
WP_138018975.1|2250554_2250926_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_138018976.1|2251010_2252723_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	91.9	3.5e-293
WP_138018977.1|2252928_2254020_-	macro domain-containing protein	NA	F8SJY4	Pseudomonas_phage	33.1	2.2e-14
WP_065263255.1|2254021_2254672_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_062335085.1|2254722_2254950_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_062334983.1|2254988_2255279_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_138018978.1|2255705_2255915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138018979.1|2255948_2256305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018980.1|2256301_2256556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036590400.1|2257692_2257908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018981.1|2257918_2258551_-	AAA family ATPase	NA	A2I303	Vibrio_virus	52.4	2.3e-48
WP_138019492.1|2259361_2260714_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	23.2	1.2e-09
WP_138018982.1|2260797_2262057_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	95.9	1.8e-105
WP_138019493.1|2262378_2264421_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_007117400.1|2264672_2265095_+|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	100.0	1.8e-73
WP_138018975.1|2265091_2265463_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_138018983.1|2265722_2267462_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	94.5	3.9e-300
WP_138018975.1|2267541_2267913_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_007117400.1|2267909_2268332_-|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	100.0	1.8e-73
WP_138018984.1|2268362_2268902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018985.1|2269067_2270228_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.3	3.3e-21
WP_138018986.1|2270238_2272368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065253243.1|2272446_2272749_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	99.0	6.3e-49
WP_138018987.1|2272741_2273284_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_138018988.1|2273258_2274146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018989.1|2274129_2276259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018990.1|2276248_2277310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138019494.1|2277688_2278866_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	59.5	2.2e-97
WP_100271187.1|2278849_2279404_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_138018991.1|2279400_2279892_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138018992.1|2279925_2281794_-	glutathione-regulated potassium-efflux system protein KefB	NA	NA	NA	NA	NA
WP_138018993.1|2281812_2282568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138018994.1|2282860_2283904_-	cation transporter	NA	NA	NA	NA	NA
WP_138018995.1|2284035_2286276_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_138018996.1|2286424_2286805_-	RidA family protein	NA	NA	NA	NA	NA
WP_138018997.1|2286832_2289061_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	39.8	2.9e-13
WP_036601878.1|2289366_2289633_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_138018998.1|2289714_2290149_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	49.2	1.8e-28
WP_138018999.1|2290174_2290786_-	starvation protein A	NA	NA	NA	NA	NA
WP_007116514.1|2290934_2291648_-	cytochrome c1	NA	NA	NA	NA	NA
WP_095355706.1|2291647_2292883_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_007116512.1|2292884_2293469_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_007116510.1|2293719_2294106_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_007116509.1|2294116_2294545_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_062334373.1|2294737_2295829_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_138019000.1|2296153_2297038_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_096488653.1|2297086_2297917_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2I7QSF5	Vibrio_phage	31.4	2.5e-07
WP_138019001.1|2297944_2298466_-	thioesterase	NA	NA	NA	NA	NA
WP_138019002.1|2298598_2300062_-	transglycosylase SLT domain-containing protein	NA	G0YQ82	Erwinia_phage	36.0	5.3e-08
WP_050324502.1|2300727_2301483_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_138019003.1|2301555_2303943_-	site-specific recombinase	NA	NA	NA	NA	NA
WP_138019004.1|2304243_2305407_+	DNA polymerase III subunit	NA	NA	NA	NA	NA
WP_138019005.1|2305467_2305815_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_138019495.1|2306150_2306867_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_138019006.1|2306985_2308659_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_007116365.1|2308929_2309226_+	integration host factor subunit beta	NA	B5TA87	Burkholderia_phage	35.2	8.2e-09
WP_007116364.1|2309386_2309746_+	LapA family protein	NA	NA	NA	NA	NA
WP_040403692.1|2309823_2310525_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_138019007.1|2310542_2311334_+	metallophosphoesterase	NA	A0A2I7SAC8	Vibrio_phage	33.1	4.5e-30
WP_138019008.1|2311448_2312198_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_007116360.1|2312287_2313454_-	acyl-CoA desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	31.8	6.0e-31
WP_138019009.1|2313658_2315302_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_040403691.1|2315305_2315941_-	response regulator	NA	NA	NA	NA	NA
WP_062334414.1|2316267_2316861_+	6-carboxytetrahydropterin synthase	NA	NA	NA	NA	NA
WP_138019010.1|2316936_2317374_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_138019011.1|2317366_2318962_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.4	2.7e-37
WP_138019012.1|2319001_2320054_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP040257	Moraxella osloensis strain MOXF1 chromosome, complete genome	2983035	2492696	2610950	2983035	transposase,protease	uncultured_virus(35.14%)	101	NA	NA
WP_050323871.1|2492696_2493215_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_050323873.1|2493235_2493616_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138019119.1|2493846_2493987_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_007117301.1|2494086_2495316_+	TerD family protein	NA	NA	NA	NA	NA
WP_138019120.1|2495501_2496203_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	80.8	1.0e-57
WP_138019507.1|2496291_2496897_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	46.5	1.6e-35
WP_138019121.1|2497191_2498745_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_065252124.1|2498880_2499177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060995182.1|2499173_2499821_-	AAA family ATPase	NA	Q2A085	Sodalis_phage	39.9	2.0e-39
WP_060996129.1|2500040_2501051_-	replication initiation protein	NA	NA	NA	NA	NA
WP_138019508.1|2501343_2501409_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_138019122.1|2502198_2502789_+	3'-5' exonuclease	NA	A0A218MNF0	uncultured_virus	92.9	1.8e-103
WP_138019123.1|2502834_2503077_-	helix-turn-helix transcriptional regulator	NA	S5MTW4	Brevibacillus_phage	37.5	6.2e-07
WP_101964911.1|2503242_2503527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138019124.1|2503543_2503894_+	hypothetical protein	NA	A0A218MNF6	uncultured_virus	40.5	1.7e-21
WP_138019125.1|2504055_2504535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138019126.1|2504881_2505358_+	plasmid mobilization relaxosome protein MobC	NA	A0A218MNF9	uncultured_virus	38.8	3.2e-15
WP_138019127.1|2505351_2507847_+	relaxase/mobilization nuclease domain-containing protein	NA	M1Q738	Cellulophaga_phage	29.8	5.3e-24
WP_138019128.1|2508287_2508488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138019129.1|2508972_2509764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138019130.1|2509907_2510567_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	48.4	2.3e-51
WP_138019131.1|2510802_2511981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138019509.1|2512521_2513040_+	hypothetical protein	NA	G3ENA3	Psychrobacter_phage	58.5	2.6e-10
WP_138019132.1|2513323_2517115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138019133.1|2517214_2517802_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_138019134.1|2517879_2518881_+	hypothetical protein	NA	A0A249XNQ1	Brevibacterium_phage	31.2	7.5e-30
WP_138019135.1|2518841_2519867_+	thymidylate synthase	NA	Q5DN81	Alphaproteobacteria_virus	30.4	2.1e-27
WP_138019136.1|2519956_2520442_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_138019137.1|2520442_2521048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138019138.1|2521072_2521945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138019139.1|2521941_2522505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138019140.1|2522532_2524626_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_138019141.1|2525323_2525623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138019142.1|2525827_2526724_+	EamA family transporter	NA	NA	NA	NA	NA
WP_138019143.1|2526967_2527582_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A1V0SJ11	Klosneuvirus	45.0	3.0e-21
WP_138019510.1|2527568_2527814_-	metal-binding protein	NA	NA	NA	NA	NA
WP_138019144.1|2527828_2528560_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_138019145.1|2528546_2529407_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.5	1.8e-19
WP_138019146.1|2529596_2530457_-	trypsin-like peptidase domain-containing protein	NA	A0A2H4JE36	uncultured_Caudovirales_phage	32.7	2.1e-33
WP_138019147.1|2530460_2530814_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_138019148.1|2530822_2531101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138019149.1|2531157_2531433_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_138019150.1|2531478_2532192_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.1	1.7e-36
WP_135890339.1|2532731_2533415_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_138019151.1|2533550_2534021_-	CinA family protein	NA	A0A218MNG4	uncultured_virus	54.5	5.0e-45
WP_007117400.1|2534788_2535211_+|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	100.0	1.8e-73
WP_138018975.1|2535207_2535579_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_138019152.1|2535658_2537371_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	91.0	2.9e-292
WP_138018975.1|2537630_2538002_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_007117400.1|2537998_2538421_-|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	100.0	1.8e-73
WP_138018975.1|2538694_2539066_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_007117400.1|2539062_2539485_-|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	100.0	1.8e-73
WP_138019172.1|2539716_2540322_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	46.5	6.1e-35
WP_138019153.1|2540696_2541002_+	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_060996097.1|2541353_2543378_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.2	9.2e-19
WP_138019154.1|2543380_2544406_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_138019155.1|2544402_2545167_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.2	1.9e-09
WP_065253156.1|2545263_2546331_-	SIP domain-containing protein	NA	NA	NA	NA	NA
WP_138019156.1|2546574_2548929_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_076775761.1|2549046_2549676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138019157.1|2549697_2551776_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_138019158.1|2551778_2553623_-	short-chain oxidoreductase	NA	NA	NA	NA	NA
WP_138019159.1|2553639_2555055_-	MFS transporter	NA	NA	NA	NA	NA
WP_007114887.1|2555088_2555703_-	acetyltransferase	NA	NA	NA	NA	NA
WP_060996104.1|2555703_2557074_-	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_138019160.1|2557066_2558887_-	siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_138019161.1|2559257_2560563_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	46.6	8.2e-69
WP_060996055.1|2560734_2561748_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_138019162.1|2561747_2563460_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000913089.1|2563465_2563927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060996052.1|2563929_2565324_+	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_138019163.1|2566253_2567048_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_138019164.1|2568010_2569684_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_060994876.1|2569688_2570108_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_138019165.1|2570114_2570882_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_138019166.1|2571241_2572030_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_007117400.1|2572089_2572512_+|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	100.0	1.8e-73
WP_138018975.1|2572508_2572880_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_138019167.1|2572959_2574699_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	94.1	1.1e-297
WP_060994872.1|2574875_2575106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138019168.1|2575436_2576584_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	70.5	4.3e-106
WP_138019169.1|2576678_2578712_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_060994930.1|2578814_2579636_-	hypothetical protein	NA	M1I4F3	Paramecium_bursaria_Chlorella_virus	29.1	2.8e-14
WP_060994929.1|2579843_2582378_-	relaxase/mobilization nuclease domain-containing protein	NA	M1Q738	Cellulophaga_phage	35.7	2.2e-38
WP_060994928.1|2582382_2582889_-	hypothetical protein	NA	A0A218MNF9	uncultured_virus	67.4	1.2e-55
WP_060994927.1|2583238_2583634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138019170.1|2584296_2587311_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_128681895.1|2587321_2588626_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_076775775.1|2588764_2589685_-|protease	CAAX protease	protease	A0A0S2MYH0	Enterococcus_phage	27.9	2.5e-16
WP_138019171.1|2589740_2592134_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	27.0	3.9e-24
WP_138019511.1|2592646_2593711_+	replication initiation protein	NA	A0A218MNI2	uncultured_virus	49.4	9.3e-71
WP_060994865.1|2593803_2594007_-	helix-turn-helix transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	46.8	1.5e-09
WP_099808731.1|2594214_2594493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060994415.1|2594643_2595261_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	1.4e-31
WP_060994414.1|2595261_2595630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138019172.1|2596233_2596839_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	46.5	6.1e-35
WP_138019153.1|2597213_2597519_+	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_138019173.1|2599545_2608701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138019174.1|2608781_2609636_+	OmpA family protein	NA	NA	NA	NA	NA
WP_138018841.1|2609907_2610399_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_100271187.1|2610395_2610950_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP040257	Moraxella osloensis strain MOXF1 chromosome, complete genome	2983035	2892238	2935381	2983035	transposase,tRNA	uncultured_virus(36.36%)	39	NA	NA
WP_138019335.1|2892238_2892793_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_138019209.1|2892780_2893281_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138019336.1|2893419_2893995_-	DUF934 domain-containing protein	NA	NA	NA	NA	NA
WP_138019337.1|2893998_2895708_-	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_138019338.1|2895975_2897232_+	sulfate adenylyltransferase	NA	A0A2P1ELS9	Moumouvirus	26.8	8.8e-36
WP_138019339.1|2897394_2898135_-	sulfate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.3	2.3e-28
WP_050325393.1|2898176_2899031_-	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_095355755.1|2899027_2899840_-	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_083710830.1|2900172_2901321_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_138019340.1|2901575_2903162_+	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_062330598.1|2903179_2903380_+	exodeoxyribonuclease VII	NA	NA	NA	NA	NA
WP_138019341.1|2903445_2905494_-	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	37.6	2.8e-71
WP_138019522.1|2905647_2907201_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_138019342.1|2907233_2908535_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_138019343.1|2908830_2909388_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_138019344.1|2909491_2910604_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_076776599.1|2910862_2912038_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_060995929.1|2912108_2912987_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_050325403.1|2913050_2913845_-	ATP-binding cassette domain-containing protein	NA	R4TX06	Phaeocystis_globosa_virus	27.4	1.2e-06
WP_138019345.1|2914049_2915222_-	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_138019346.1|2915484_2916255_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_138019347.1|2916334_2916604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138019348.1|2916649_2917525_-	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	34.9	3.0e-27
WP_095355367.1|2917819_2918530_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	37.0	7.7e-29
WP_095355366.1|2918637_2918952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138019349.1|2919097_2919598_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_076776581.1|2919648_2920779_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_138019350.1|2920861_2923108_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_138019351.1|2923164_2924001_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_050325417.1|2924183_2924822_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_138019352.1|2925011_2926010_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_062333819.1|2926202_2926955_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	29.8	1.4e-09
WP_076777139.1|2927419_2928517_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_138019353.1|2928759_2929902_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	100.0	9.2e-226
WP_138019354.1|2930228_2931050_+	acetoacetate decarboxylase	NA	A0A218MNG2	uncultured_virus	100.0	1.2e-155
WP_138019355.1|2931152_2931948_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_138019523.1|2932171_2933746_+	histidine-type phosphatase	NA	A0A218MNG5	uncultured_virus	100.0	3.7e-201
WP_007115011.1|2934543_2934846_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	100.0	2.2e-49
WP_138018169.1|2934838_2935381_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP040258	Moraxella osloensis strain MOXF1 plasmid pMOXF1, complete sequence	248441	8643	66226	248441	integrase,transposase	uncultured_virus(20.0%)	50	1071:1087	14310:14326
1071:1087	attL	ATCAAACAAAATGGTGT	NA	NA	NA	NA
WP_138019532.1|8643_9447_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_138019533.1|9430_11578_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_138019534.1|11607_13290_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_138019535.1|13292_14801_+|transposase	transposase	transposase	NA	NA	NA	NA
14310:14326	attR	ATCAAACAAAATGGTGT	NA	NA	NA	NA
WP_138019536.1|14937_17265_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_138019537.1|17261_18509_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_138019538.1|18605_21890_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	24.1	6.0e-60
WP_138019539.1|22123_23338_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.1	1.1e-48
WP_138019540.1|26615_27533_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_138019541.1|27737_29276_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_138019542.1|29272_30073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138019543.1|30393_33174_-	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	39.8	5.1e-177
WP_138019544.1|33247_33655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138019545.1|33781_34969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270932.1|34965_35199_-	antitoxin VbhA family protein	NA	NA	NA	NA	NA
WP_138019546.1|35228_35513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138019547.1|35655_36069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270935.1|36304_36673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138019548.1|36835_37942_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q19ZT4	Mycobacterium_virus	31.5	5.9e-28
WP_138019549.1|37977_38490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138019550.1|38512_39262_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_100270939.1|39326_39626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138019551.1|39788_39986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270940.1|40098_40722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138019552.1|40763_40985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100270942.1|41002_41209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138019553.1|41576_42080_-	single-stranded DNA-binding protein	NA	E1ABY7	Pseudoalteromonas_phage	45.5	4.0e-16
WP_128681853.1|42313_42841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128681851.1|43164_44067_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_128681849.1|44076_44844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128681847.1|44827_46393_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_000052512.1|48127_49603_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|49658_50543_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_015060246.1|50732_51344_-	recombinase family protein	NA	NA	NA	NA	NA
WP_138019554.1|51725_52793_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_138019555.1|52885_53800_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_138019556.1|53879_54428_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_138019557.1|54534_55515_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_068406856.1|55629_57783_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.8	1.8e-121
WP_068406859.1|57934_58345_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_138019558.1|58537_58732_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_138019559.1|58883_61361_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.5	1.2e-100
WP_036600606.1|61426_61819_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_138019560.1|61913_62174_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138019561.1|62326_62827_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_128681841.1|62967_63600_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	30.1	1.5e-07
WP_011954794.1|63614_63917_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_110817442.1|63918_64266_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_128681839.1|64394_64961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115304630.1|65474_66226_-|transposase	IS5-like element IS1301 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.7	1.3e-15
