The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040321	Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014879 chromosome, complete genome	4923481	361373	406321	4923481	lysis,protease,coat,terminase,integrase,portal	Enterobacteria_phage(78.46%)	66	352143:352159	414912:414928
352143:352159	attL	GATATTGAAATTCGCGT	NA	NA	NA	NA
WP_001043675.1|361373_362426_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|362708_363812_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|363823_365074_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_000051897.1|365279_366443_-|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_000002104.1|366881_367166_-	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_000371199.1|367158_367443_-	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_025617570.1|367442_368087_-	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_071533029.1|368073_368307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000812203.1|368303_368813_-	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_001214777.1|368809_368980_-	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_001111291.1|368990_369284_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001253476.1|369330_369615_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001046968.1|369614_370322_-	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_000902092.1|370318_370462_-	hypothetical protein	NA	A0A2H5BFM6	Salmonella_phage	100.0	6.4e-20
WP_000156731.1|370451_370640_-	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000141641.1|370620_370779_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000776963.1|370863_371178_-	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000713613.1|371453_371741_-	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_015974224.1|371774_372419_-	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	100.0	6.5e-51
WP_000213982.1|372502_372697_-	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_001066179.1|372910_373498_+	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000216178.1|373510_373813_-	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_000834175.1|374176_374380_+	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_001532928.1|374418_375498_-	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000712403.1|375662_376352_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_000182204.1|376462_376678_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_001103492.1|376788_377070_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000539342.1|377252_378074_+	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_001248410.1|378070_379447_+	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_001036030.1|379443_379713_+	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_000736891.1|379786_380224_+	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_000679703.1|380220_380394_+	hypothetical protein	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
WP_000113770.1|380360_380537_+	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_001532927.1|380539_380881_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000950963.1|380873_381050_+	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001108073.1|381042_381654_+	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000036320.1|381650_381875_+	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_000149882.1|381871_382075_+	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000219133.1|382055_382235_+	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_001047566.1|382231_383005_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000286100.1|383435_383639_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_024136257.1|383616_384114_+	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_001687043.1|384110_384578_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_000877028.1|384790_385321_+	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_000808099.1|385543_385786_+	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_001140562.1|385789_386179_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_001687044.1|386178_386583_+	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_000729923.1|386586_387075_+	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_000417860.1|387052_388552_+|terminase	terminase	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
WP_000774652.1|388551_390729_+|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
WP_000433855.1|390742_391654_+	scaffold protein	NA	Q76H22	Enterobacteria_phage	100.0	1.5e-162
WP_001196937.1|391653_392946_+|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_000538670.1|392986_393547_+	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001166103.1|393530_394031_+	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_001122420.1|393990_395409_+	Packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_000774917.1|395412_396114_+	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_000627593.1|396113_396569_+	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000964904.1|396571_397261_+	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000246977.1|397271_398708_+	phage DNA ejection protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_001029860.1|398707_400684_+	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_071533035.1|400822_401116_+	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_000532177.1|401136_401385_-	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_000129933.1|401520_403524_+	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000671496.1|403582_405040_-	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000703639.1|405029_405962_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|405958_406321_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
414912:414928	attR	GATATTGAAATTCGCGT	NA	NA	NA	NA
>prophage 2
NZ_CP040321	Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014879 chromosome, complete genome	4923481	999259	1007991	4923481	protease,transposase	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|999259_1000378_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1000374_1002321_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1002450_1002672_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1002995_1003316_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1003346_1005623_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1005814_1006273_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_085983316.1|1006735_1007991_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 3
NZ_CP040321	Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014879 chromosome, complete genome	4923481	1058054	1156863	4923481	lysis,protease,terminase,integrase,tail,portal,tRNA,holin	Salmonella_phage(42.59%)	98	1060963:1060982	1132751:1132770
WP_001154025.1|1058054_1058858_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1058850_1060173_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1060153_1060858_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_022742649.1|1060857_1065324_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1060963:1060982	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1065668_1067510_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1067769_1068318_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1068345_1068993_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1069054_1070245_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1070429_1071521_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1072127_1073528_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1073728_1074190_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1074506_1075721_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000191399.1|1077478_1078681_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1078875_1080168_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1080212_1080461_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1080501_1080741_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1080783_1081941_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_138020357.1|1081903_1084789_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	97.7	0.0e+00
WP_001668146.1|1084915_1085215_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1085236_1085395_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_010989002.1|1085387_1085648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1085697_1086108_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1086227_1086467_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1086432_1086807_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1086891_1087875_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1087877_1088627_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1088637_1088985_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1088981_1089293_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1089370_1089661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1089952_1090186_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1090297_1090519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001096552.1|1091412_1092024_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1092020_1092167_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_022742653.1|1092156_1092954_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	5.2e-151
WP_010989004.1|1093020_1093338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1093511_1093637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1093772_1094222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1094582_1095269_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1095544_1095874_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1095857_1096310_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1096327_1096807_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1097014_1097548_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1097504_1099643_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1099639_1099846_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_077679777.1|1099872_1101390_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_010989008.1|1101313_1103395_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1103485_1103809_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1103801_1104101_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1104081_1104648_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1104644_1105046_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1105057_1105807_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1105852_1106251_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1106247_1106577_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_077942427.1|1106656_1109644_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	6.3e-266
WP_000978296.1|1109640_1109973_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1110071_1110569_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1110685_1111219_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_022742655.1|1111308_1112004_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.2	6.5e-89
WP_000246065.1|1112648_1113353_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_126834981.1|1115207_1116776_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	63.9	1.2e-127
WP_000178849.1|1116814_1117057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050956299.1|1117110_1119549_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	3.7e-91
WP_022742661.1|1119548_1120130_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.5	3.3e-94
WP_001533476.1|1120605_1121574_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|1122221_1122848_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1122916_1123216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1123200_1123887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1124157_1124349_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1124775_1127388_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_022742665.1|1127595_1128606_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1128771_1129314_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1129310_1130420_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1130518_1132627_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1132639_1134547_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1132751:1132770	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1134561_1135815_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1135819_1137460_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1137456_1138020_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1138275_1138443_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1138542_1139061_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1139129_1140890_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1141075_1141528_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1141599_1142652_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1143008_1143518_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1143734_1144340_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1144326_1146480_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1146498_1146945_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1147068_1149123_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1149158_1149617_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1149711_1150374_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1150547_1150961_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1151005_1151323_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1151380_1152592_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1152806_1153355_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1153380_1154160_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1154208_1154490_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1154486_1154816_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1154902_1155562_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1156182_1156863_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP040321	Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014879 chromosome, complete genome	4923481	1898260	1997445	4923481	lysis,protease,transposase,terminase,integrase,tail,head,tRNA	Edwardsiella_phage(15.25%)	120	1953347:1953361	1995285:1995299
WP_001221014.1|1898260_1898956_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128807.1|1899013_1900924_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
WP_000029550.1|1901054_1901399_+	RidA family protein	NA	NA	NA	NA	NA
WP_000457328.1|1901404_1901584_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000978464.1|1901664_1903029_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	35.0	1.9e-44
WP_000381544.1|1903032_1903611_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624277.1|1903874_1905239_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_050195143.1|1905376_1906978_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000421815.1|1906999_1908559_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
WP_000150521.1|1909031_1910000_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406918.1|1910052_1910853_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_001518647.1|1910865_1911717_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156280.1|1911774_1912233_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001518359.1|1912642_1913209_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_022742705.1|1913205_1914015_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_000730322.1|1914080_1915826_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_001062678.1|1916045_1916255_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001537930.1|1916267_1916411_-	YobF family protein	NA	NA	NA	NA	NA
WP_001000660.1|1917059_1917347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714547.1|1917417_1917561_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001236777.1|1917718_1917958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262195.1|1918169_1918961_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_000416128.1|1919136_1920510_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984498.1|1920557_1921439_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|1921632_1923681_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|1923700_1924387_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_000145727.1|1924484_1925069_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|1925110_1926394_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001535256.1|1926362_1928996_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001542138.1|1929073_1930513_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_024131108.1|1930630_1930867_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457836.1|1930977_1931169_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986176.1|1931187_1931838_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
WP_001134856.1|1932061_1932226_-	membrane protein	NA	NA	NA	NA	NA
WP_000182072.1|1932510_1933233_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_022742706.1|1933916_1934312_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.0	6.0e-15
WP_000030934.1|1934641_1935118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354408.1|1935505_1935925_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001752421.1|1936294_1936564_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
WP_001617922.1|1936729_1936870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000684835.1|1938333_1938702_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
WP_001233446.1|1940005_1940920_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|1941052_1941211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848069.1|1941220_1941835_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000457876.1|1942982_1943108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989029.1|1943677_1943878_+	PhoPQ-activated virulence protein PagK	NA	NA	NA	NA	NA
WP_000275418.1|1943974_1944856_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1945328_1945517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1945581_1945749_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1946005_1946539_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1946592_1946823_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1947012_1947507_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1947566_1948421_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_022742707.1|1949328_1950471_+	lipopolysaccharide N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_022742708.1|1950733_1951633_+	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_022742709.1|1952121_1952778_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024150649.1|1952778_1953474_-	hypothetical protein	NA	NA	NA	NA	NA
1953347:1953361	attL	GCATTAATGCCAACT	NA	NA	NA	NA
WP_022742711.1|1953856_1954432_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	2.9e-95
WP_022742712.1|1954431_1955883_-|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	71.2	2.9e-43
WP_022742713.1|1955872_1956475_-	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	5.9e-30
WP_022742714.1|1956476_1957718_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.6	4.5e-101
WP_001191865.1|1957714_1958071_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_022742715.1|1958083_1958761_-	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	35.5	4.6e-31
WP_000122818.1|1958741_1959611_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_000890115.1|1959607_1959910_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_022742716.1|1959909_1960620_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	6.5e-28
WP_022742717.1|1960616_1962788_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_000228831.1|1962771_1962954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000101348.1|1962995_1963400_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000016414.1|1963399_1963846_-	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_138020361.1|1963846_1965331_-	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	40.8	1.5e-95
WP_000094504.1|1965311_1965857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001748490.1|1965841_1966207_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	8.8e-21
WP_022742718.1|1966203_1966788_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	3.2e-17
WP_023139348.1|1966781_1967237_-	DUF4054 domain-containing protein	NA	Q2NPC6	Xanthomonas_phage	46.0	1.2e-19
WP_001748493.1|1967243_1967591_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.0e-10
WP_001031915.1|1967594_1968623_-	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_001525451.1|1968622_1969105_-	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	1.1e-26
WP_023139349.1|1969106_1970453_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.4	3.2e-68
WP_000552017.1|1970449_1971139_-|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
WP_023139350.1|1971179_1972700_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.4	7.5e-106
WP_022742723.1|1972699_1974121_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.0	1.8e-186
WP_022742724.1|1974086_1974839_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	75.6	5.3e-12
WP_001113128.1|1974909_1975092_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_085983312.1|1975317_1975758_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	84.3	3.5e-56
WP_001208103.1|1975778_1976267_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.1	2.1e-57
WP_001526513.1|1976244_1976547_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000502119.1|1976713_1977172_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_022742726.1|1977449_1977995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023139352.1|1977985_1978192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023139353.1|1978669_1979599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023139354.1|1980147_1980489_-	antitermination protein from phage origin	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	1.1e-54
WP_023139355.1|1980828_1981140_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	84.8	6.1e-39
WP_021000145.1|1981136_1981331_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
WP_022742730.1|1981327_1981927_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.9	5.0e-98
WP_024150651.1|1981990_1982296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024150652.1|1982488_1982641_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_023139357.1|1982847_1983120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022742732.1|1983116_1983512_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	37.0	6.4e-17
WP_157872077.1|1983524_1984067_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.1e-67
WP_022742734.1|1983978_1984986_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.5	1.8e-124
WP_001534383.1|1985029_1985524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033911.1|1985510_1985765_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_001574209.1|1985863_1986262_+	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
WP_024135672.1|1986692_1986872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103933.1|1987132_1987408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|1987411_1987618_+	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_000799627.1|1987693_1988029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742735.1|1988169_1990860_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.6	2.2e-116
WP_001534364.1|1990852_1991683_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_001033921.1|1991718_1992039_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
WP_023139358.1|1992031_1992364_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	72.7	8.5e-15
WP_023139359.1|1992974_1993154_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	60.3	7.3e-13
WP_077907869.1|1993444_1993681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001575998.1|1993741_1994020_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_022742740.1|1993994_1995074_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.8	1.3e-101
WP_000722368.1|1995456_1995810_-	YebY family protein	NA	NA	NA	NA	NA
1995285:1995299	attR	AGTTGGCATTAATGC	NA	NA	NA	NA
WP_000979702.1|1995826_1996702_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1996702_1997077_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1997214_1997445_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 5
NZ_CP040321	Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014879 chromosome, complete genome	4923481	2072895	2151555	4923481	protease,head,transposase,terminase,integrase,tail,portal,capsid,holin,plate	Salmonella_phage(81.16%)	104	2079433:2079448	2153178:2153193
WP_000502119.1|2072895_2073354_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_000659236.1|2073534_2074740_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|2074818_2076306_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|2076562_2077966_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2077980_2078388_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2078387_2078756_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2078827_2080312_+	alpha-amylase	NA	NA	NA	NA	NA
2079433:2079448	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2080351_2080777_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2080962_2082168_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2082164_2082398_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2082662_2083049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2083168_2083483_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2083699_2085382_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2085374_2086370_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2086362_2087070_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2087069_2088440_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2088461_2088905_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2088901_2090119_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2090223_2090691_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2090695_2091700_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2091696_2092110_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2092109_2092487_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2092486_2093224_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2093233_2093503_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2093511_2094306_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2094587_2095211_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2095249_2095498_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2095572_2095800_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2096109_2096925_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2096903_2098616_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2098780_2099026_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2099042_2099954_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2100129_2101050_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2101038_2101509_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2101489_2102920_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2102993_2103689_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2103780_2104080_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2104729_2105926_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2106186_2106375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2106385_2106598_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2107052_2108321_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2108323_2108743_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2108869_2109031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093793.1|2110224_2110437_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000842532.1|2110433_2110847_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_122815478.1|2110894_2111008_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000836773.1|2111082_2111316_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_022742744.1|2111429_2112035_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_020899405.1|2112004_2113567_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	100.0	1.0e-288
WP_001207832.1|2113553_2114141_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785578.1|2114143_2115223_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_000605051.1|2115215_2115629_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|2115633_2116167_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066630.1|2116166_2117225_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_000863827.1|2117221_2118562_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	100.0	5.2e-252
WP_000785390.1|2118595_2120524_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	100.0	0.0e+00
WP_022742746.1|2120608_2120902_-	hypothetical protein	NA	A0A192Y6C5	Salmonella_phage	100.0	2.6e-47
WP_000515952.1|2120931_2121288_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007996.1|2121287_2122784_-|tail	tail sheath protein	tail	A0A192Y7L1	Salmonella_phage	100.0	2.1e-278
WP_000497740.1|2122773_2122938_-	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	100.0	1.3e-24
WP_000779216.1|2122941_2123502_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	100.0	8.0e-106
WP_001135699.1|2123498_2124011_-	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	100.0	3.5e-92
WP_000702410.1|2123982_2124387_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
WP_000927378.1|2124383_2124707_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601352.1|2124709_2124910_-	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
WP_000257526.1|2124960_2126166_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	100.0	7.0e-224
WP_001193639.1|2126180_2126831_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_020899404.1|2126808_2128050_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.3	2.9e-241
WP_000605609.1|2128049_2128232_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088175.1|2128243_2129977_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
WP_000929171.1|2129973_2130468_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	100.0	1.7e-88
WP_001135098.1|2130593_2130944_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|2130994_2131327_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001530346.1|2131789_2132182_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|2132178_2132793_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|2132792_2133074_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|2133060_2133447_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|2133592_2133850_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_020899401.1|2134000_2134753_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_020899400.1|2134766_2135756_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	99.1	4.0e-193
WP_020899399.1|2135763_2136624_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	8.4e-163
WP_001241579.1|2136640_2137030_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2137026_2137920_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2137919_2138402_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2138403_2139222_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2139218_2139443_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2139439_2140597_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2140593_2141148_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2141176_2141401_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2141498_2142194_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001067432.1|2142399_2142738_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_023891434.1|2142700_2142925_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_000997191.1|2143464_2143836_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_000080416.1|2143893_2144721_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000008351.1|2144857_2145397_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000215886.1|2145467_2146001_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000224241.1|2146002_2146260_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_020899398.1|2146270_2146852_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_001061334.1|2146855_2147425_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2147449_2147692_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2147693_2148683_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2148974_2149772_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2150143_2150434_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2151081_2151555_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2153178:2153193	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 6
NZ_CP040321	Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014879 chromosome, complete genome	4923481	2238260	2248766	4923481		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2238260_2239574_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2239600_2240680_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2240684_2241458_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2241454_2242447_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2242452_2243004_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2243004_2243883_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2243930_2244830_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2244829_2245915_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2246291_2247185_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2247362_2248766_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 7
NZ_CP040321	Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014879 chromosome, complete genome	4923481	2317074	2326245	4923481	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2317074_2319108_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2319348_2319807_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2319978_2320509_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2320565_2321033_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2321079_2321799_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2321795_2323481_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2323703_2324435_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2324494_2324602_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2324582_2325314_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2325297_2326245_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
NZ_CP040321	Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014879 chromosome, complete genome	4923481	2345483	2411872	4923481	lysis,holin,tail	Salmonella_phage(25.0%)	59	NA	NA
WP_000989296.1|2345483_2346179_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2346332_2347217_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2347393_2348113_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2348109_2348355_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2348559_2349801_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|2349794_2351030_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2351104_2352115_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2352130_2353651_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2353784_2354783_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2355281_2356304_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2356453_2357596_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2357610_2358279_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2358608_2359466_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2359454_2359844_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2359848_2361216_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2361432_2362320_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2362352_2363675_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2363718_2365710_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2366055_2367525_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2367714_2368578_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2368698_2369748_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2369826_2370684_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2370748_2372437_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2372453_2373392_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2373391_2374522_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2374890_2376072_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2376136_2376802_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2376803_2376926_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2377313_2377568_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2377891_2378464_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2378676_2379663_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2379692_2380412_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2380825_2381398_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2381723_2383280_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2383386_2385192_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2385201_2386296_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2386295_2387321_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2387322_2388912_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2388915_2389260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2389650_2390841_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2390868_2391564_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2391715_2393476_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2393600_2393885_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2393993_2394614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2394641_2395649_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2395828_2396056_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2396087_2397848_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2398128_2398632_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2398659_2398950_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000022213.1|2401173_2401617_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2401994_2402522_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2402524_2403766_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2404358_2404688_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2404984_2406316_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2406344_2406713_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2406727_2407717_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2408045_2410412_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2410580_2410784_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2411080_2411872_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 9
NZ_CP040321	Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014879 chromosome, complete genome	4923481	2751268	2856811	4923481	lysis,transposase,terminase,integrase,tail,capsid,portal,head,tRNA,holin	Salmonella_phage(33.9%)	108	2775813:2775829	2864715:2864731
WP_000940032.1|2751268_2752000_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2752118_2752922_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2753066_2753945_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2754126_2755170_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2755173_2755992_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2756002_2757016_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2757016_2758003_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2757993_2758632_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2758757_2760035_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2760029_2761169_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2761364_2762618_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2762942_2764133_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2764314_2765859_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2766219_2767551_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2767633_2769778_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_050195141.1|2769833_2771294_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.3e-46
WP_000717694.1|2771342_2771681_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2771757_2773095_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2773091_2773856_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2773857_2775288_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
2775813:2775829	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|2775937_2779825_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|2779846_2780080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2780080_2781625_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2781675_2782227_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2782251_2782887_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2782890_2784252_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2784262_2785156_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2785271_2786120_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2786158_2787076_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276365.1|2787097_2788294_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2788409_2789336_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2789373_2789634_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2789745_2790126_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2790125_2790857_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2790868_2791597_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2791608_2792514_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2792510_2793191_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2793464_2794439_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2794455_2796255_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2796659_2798153_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2798613_2798751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2799463_2799628_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2800207_2800273_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2800335_2800548_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2800654_2800882_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2800978_2801557_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2801546_2802371_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_022742779.1|2802367_2804740_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	65.4	2.0e-89
WP_000178853.1|2804793_2805036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2805074_2808437_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2808498_2809146_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2809043_2809781_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2809787_2810486_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2810495_2810825_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_022742781.1|2810827_2813923_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.6	1.1e-276
WP_010989052.1|2813894_2814233_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2814229_2814625_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971953.1|2814675_2815422_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_022742782.1|2815429_2815831_-	hypothetical protein	NA	Q9G0F3	Phage_Gifsy-1	99.0	4.0e-51
WP_000677089.1|2815827_2816406_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083293.1|2816392_2816770_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
WP_000201485.1|2816780_2817146_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_022742784.1|2817203_2818232_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.3e-114
WP_000011260.1|2818286_2818634_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189498.1|2818646_2820143_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	1.1e-96
WP_000831821.1|2820132_2821713_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2821709_2821913_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623088.1|2821896_2823828_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
WP_001102153.1|2823799_2824345_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669689.1|2824630_2825032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603581.1|2825288_2825792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050955063.1|2826119_2826566_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	83.9	9.3e-57
WP_022742788.1|2826598_2827213_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.6	2.2e-109
WP_021000643.1|2827212_2827494_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001294873.1|2827480_2827870_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	72.5	4.8e-41
WP_023221874.1|2827959_2828148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024150660.1|2828674_2829100_-	subtilase	NA	NA	NA	NA	NA
WP_022742790.1|2829232_2829958_-	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	66.2	4.0e-81
WP_022742791.1|2830158_2830737_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	1.1e-49
WP_050196634.1|2830751_2831741_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	3.5e-189
WP_024150661.1|2831748_2832609_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.3	9.2e-162
WP_000767086.1|2832625_2833015_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	1.6e-68
WP_024150662.1|2833903_2834386_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	97.5	1.8e-85
WP_022742797.1|2834387_2835347_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.2e-117
WP_000620702.1|2835343_2835568_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_031609052.1|2835564_2836707_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	98.2	1.0e-208
WP_023139406.1|2836703_2837258_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	1.2e-101
WP_001191666.1|2837286_2837511_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|2837608_2838304_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000917563.1|2838657_2838816_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
WP_022742800.1|2838837_2839188_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	98.3	6.4e-61
WP_022742802.1|2842205_2843363_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	4.7e-217
WP_001237031.1|2843405_2843645_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2843685_2843970_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_022742803.1|2843947_2845177_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	93.9	5.4e-232
WP_000589087.1|2845674_2846154_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2846150_2847107_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2847106_2847757_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2847788_2848364_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2848360_2848525_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_022742804.1|2848788_2850411_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2850395_2851133_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2851263_2852598_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2852615_2853515_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2853617_2854205_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2854266_2854650_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2854968_2855658_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2855773_2856811_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2864715:2864731	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 10
NZ_CP040321	Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014879 chromosome, complete genome	4923481	4484349	4504768	4923481	tail,plate	Burkholderia_phage(47.37%)	25	NA	NA
WP_000587738.1|4484349_4485078_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4485274_4485565_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4485813_4486269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4486265_4486871_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4486875_4488621_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4488623_4489256_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4489248_4490364_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4490354_4490714_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4490877_4492425_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4492424_4493354_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4493350_4493713_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4494040_4494763_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4494772_4495816_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4495803_4496013_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_001262499.1|4496964_4499319_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4499415_4499544_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4499503_4499821_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4499872_4500397_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4500396_4501824_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4501813_4502011_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4502007_4502463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4502622_4502937_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4502949_4503555_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4503557_4503845_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4504420_4504768_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP040322	Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014879 plasmid p16-6397.1, complete sequence	93911	70930	80226	93911	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_001541564.1|70930_71347_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|71530_71866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541562.1|71922_72489_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728917.1|72520_73462_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_000427676.1|73876_75082_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000064274.1|75081_76056_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.1e-84
WP_022743179.1|76137_77412_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.9	3.9e-156
WP_000925627.1|77411_77834_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000490265.1|78344_78815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|78807_79164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088645.1|79545_80226_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
