The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040379	Salmonella enterica subsp. enterica serovar Montevideo strain FCC0123 chromosome, complete genome	4619529	63156	94191	4619529	head,tail,transposase,protease,plate	Escherichia_phage(60.47%)	45	NA	NA
WP_079849187.1|63156_63681_-	DNA-binding protein	NA	A0A0C4UQZ2	Shigella_phage	89.7	3.1e-83
WP_000551058.1|63866_64088_+	transcriptional regulator	NA	A0A0C4UQU0	Shigella_phage	98.6	1.4e-34
WP_079849188.1|64095_66084_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	99.8	0.0e+00
WP_001026707.1|66122_67061_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	97.8	3.8e-169
WP_000968312.1|67076_67304_+	hypothetical protein	NA	C9DGL3	Escherichia_phage	100.0	3.2e-37
WP_021537265.1|67306_67537_+	hypothetical protein	NA	A0A0C4UQZ4	Shigella_phage	98.7	5.3e-40
WP_021526002.1|67548_67818_+	hypothetical protein	NA	C9DGL5	Escherichia_phage	32.6	5.0e-05
WP_001101153.1|67838_68258_+	hypothetical protein	NA	C9DGL6	Escherichia_phage	100.0	1.5e-77
WP_000225079.1|68258_68558_+	hypothetical protein	NA	C9DGL7	Escherichia_phage	100.0	9.6e-50
WP_001107930.1|68577_69102_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	100.0	1.5e-90
WP_001621839.1|69200_69731_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	94.9	1.4e-96
WP_079849189.1|69730_70255_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	92.2	1.6e-87
WP_001621843.1|70251_70920_+	hypothetical protein	NA	Q71T76	Escherichia_phage	64.6	2.6e-79
WP_079849190.1|70922_71264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024193941.1|71337_71889_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	98.9	2.6e-101
WP_000133852.1|71885_72275_+	Middle operon regulator	NA	A0A0C4UR27	Shigella_phage	100.0	3.5e-68
WP_000515809.1|72352_72583_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	98.7	6.3e-41
WP_001163385.1|72695_73118_+	positive regulator of late transcription	NA	C9DGM8	Escherichia_phage	100.0	1.3e-76
WP_000907404.1|73212_73728_+	lysozyme	NA	C9DGM9	Escherichia_phage	100.0	6.4e-94
WP_001438579.1|73711_74098_+	hypothetical protein	NA	C9DGN0	Escherichia_phage	98.4	4.4e-63
WP_032148942.1|73994_74300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079849191.1|74256_74451_+	hypothetical protein	NA	C9DGN1	Escherichia_phage	98.4	5.3e-33
WP_000364295.1|74450_74750_+	DUF2730 family protein	NA	C9DGN2	Escherichia_phage	100.0	5.8e-47
WP_000606409.1|74746_75037_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	100.0	7.4e-47
WP_000375394.1|75048_75624_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	100.0	9.1e-97
WP_021526013.1|75631_77287_+	hypothetical protein	NA	C9DGN5	Escherichia_phage	99.8	0.0e+00
WP_079849192.1|77286_78825_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	99.6	4.2e-298
WP_079849193.1|78805_80125_+|head	phage head morphogenesis protein	head	C9DGN7	Escherichia_phage	98.4	4.0e-249
WP_079849194.1|80121_80592_+	phage virion morphogenesis protein	NA	C9DGN8	Escherichia_phage	98.7	3.2e-84
WP_079849195.1|80788_81874_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	98.3	1.5e-193
WP_047660771.1|81870_82788_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	97.7	2.4e-176
WP_021537253.1|82854_83265_+	hypothetical protein	NA	A0A0C4UQZ0	Shigella_phage	97.1	5.2e-62
WP_001104972.1|83261_83687_+	DUF1320 family protein	NA	C9DGP4	Escherichia_phage	100.0	4.2e-75
WP_000888927.1|83686_84235_+	DUF1834 family protein	NA	C9DGP5	Escherichia_phage	100.0	1.1e-104
WP_001409561.1|84221_84425_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	98.5	6.3e-29
WP_079849196.1|84421_85909_+|tail	phage tail protein	tail	C9DGP7	Escherichia_phage	99.4	5.0e-280
WP_000918404.1|85918_86275_+|tail	tail protein	tail	C9DGP8	Escherichia_phage	100.0	2.4e-63
WP_000344073.1|86284_86719_+	hypothetical protein	NA	C9DGP9	Escherichia_phage	97.9	3.8e-71
WP_079849197.1|86863_88936_+	tape measure protein	NA	C9DGQ1	Escherichia_phage	97.4	0.0e+00
WP_079849198.1|88940_90428_+	multidrug DMT transporter permease	NA	A0A0C4UR32	Shigella_phage	99.4	1.4e-242
WP_042023636.1|90420_91560_+|plate	baseplate protein	plate	C9DGQ3	Escherichia_phage	99.5	1.5e-212
WP_000442748.1|91547_92141_+|plate	phage baseplate assembly protein	plate	A0A0C4UQZ3	Shigella_phage	99.0	1.2e-107
WP_000130548.1|92137_92575_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	100.0	1.0e-79
WP_021555077.1|92575_93658_+|plate	baseplate J/gp47 family protein	plate	C9DGQ6	Escherichia_phage	99.7	4.1e-207
WP_079849199.1|93648_94191_+	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	99.4	8.3e-100
>prophage 2
NZ_CP040379	Salmonella enterica subsp. enterica serovar Montevideo strain FCC0123 chromosome, complete genome	4619529	1149983	1214614	4619529	head,tail,integrase,lysis,terminase,tRNA,portal,capsid,plate	Salmonella_phage(88.89%)	65	1151428:1151474	1185627:1185673
WP_000113811.1|1149983_1151225_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.1	8.5e-100
1151428:1151474	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_006493480.1|1151589_1152816_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	65.4	3.6e-151
WP_006493482.1|1152822_1153839_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.0	5.0e-191
WP_023136550.1|1153840_1154473_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	96.7	5.8e-113
WP_000102106.1|1154592_1154835_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_006493486.1|1154867_1155377_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	3.5e-84
WP_000794278.1|1155463_1155739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001528723.1|1155823_1156018_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	84.1	5.3e-25
WP_000963476.1|1155981_1156323_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	84.1	6.0e-48
WP_001178763.1|1156390_1156618_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	64.0	8.1e-17
WP_000785514.1|1156617_1156845_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	66.7	5.4e-21
WP_006493488.1|1156841_1157699_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	69.8	4.6e-113
WP_006493489.1|1157695_1160089_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	88.8	0.0e+00
WP_001749759.1|1160108_1160336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749760.1|1160473_1160662_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	91.7	5.7e-24
WP_006493490.1|1160992_1162195_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	37.1	5.6e-64
WP_006493491.1|1162157_1163075_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_006493493.1|1163121_1164156_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	94.8	4.1e-188
WP_006493495.1|1164155_1165922_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.6	0.0e+00
WP_006493498.1|1166064_1166898_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	97.1	1.1e-127
WP_000730754.1|1166914_1167982_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.0	2.8e-192
WP_000059169.1|1167985_1168636_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	98.6	1.6e-113
WP_000673541.1|1168729_1169194_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	96.8	7.9e-83
WP_000868184.1|1169193_1169397_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1169400_1169616_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_006493502.1|1169596_1170106_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	3.2e-93
WP_000871620.1|1170110_1170485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001648763.1|1170481_1170910_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
WP_001039964.1|1171005_1171437_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	95.1	4.0e-73
WP_000343939.1|1171429_1171876_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.7	3.8e-66
WP_000993750.1|1171944_1172523_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	1.5e-107
WP_006493507.1|1172519_1172879_+|plate	baseplate assembly protein W	plate	E5G6N7	Salmonella_phage	92.4	6.3e-56
WP_006493508.1|1172865_1173774_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.7	7.2e-157
WP_001086802.1|1173766_1174372_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	1.1e-116
WP_045791118.1|1174368_1175943_+|tail	tail protein	tail	A0A1S6KZZ8	Salmonella_phage	60.9	3.3e-157
WP_006501158.1|1175912_1176530_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	84.1	1.6e-94
WP_001287104.1|1176533_1176941_-|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	85.2	6.7e-62
WP_077918804.1|1176947_1178027_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	91.8	1.2e-182
WP_006501163.1|1177996_1178554_+	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	98.9	9.4e-99
WP_006501164.1|1178656_1179829_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	3.7e-222
WP_001207653.1|1179838_1180354_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_001280962.1|1180408_1180711_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_000763316.1|1180725_1180845_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_006501165.1|1180837_1183645_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	98.3	0.0e+00
WP_000980409.1|1183641_1184127_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
WP_006501166.1|1184123_1185224_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	95.6	9.0e-194
WP_000980498.1|1185292_1185511_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_072101562.1|1186062_1187226_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1185627:1185673	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000196152.1|1187233_1189414_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
WP_000533851.1|1189410_1190820_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001128838.1|1190884_1202359_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1202973_1203456_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242604.1|1203605_1204082_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1204071_1204362_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1204523_1204862_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1205010_1206672_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1206757_1207636_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1207758_1208349_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287933.1|1208383_1208989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1209109_1210396_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1210415_1211207_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1211372_1212734_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1212986_1213235_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1213253_1213802_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|1213846_1214614_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP040379	Salmonella enterica subsp. enterica serovar Montevideo strain FCC0123 chromosome, complete genome	4619529	1704601	1713772	4619529	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1704601_1705549_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1705532_1706264_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1706244_1706352_-	protein YohO	NA	NA	NA	NA	NA
WP_001240416.1|1706411_1707143_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1707365_1709051_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1709047_1709767_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1709813_1710281_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001221799.1|1710337_1710868_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703136.1|1711039_1711498_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
WP_000195336.1|1711738_1713772_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP040379	Salmonella enterica subsp. enterica serovar Montevideo strain FCC0123 chromosome, complete genome	4619529	1870946	1878213	4619529		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1870946_1871366_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457654.1|1871368_1872637_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.9e-227
WP_000208509.1|1873091_1873304_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1873314_1873503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080686.1|1873761_1874973_-	porin	NA	Q1MVN1	Enterobacteria_phage	56.2	2.6e-109
WP_000107430.1|1875622_1875922_+	membrane protein	NA	NA	NA	NA	NA
WP_000377052.1|1876013_1876709_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	1.6e-07
WP_001157316.1|1876782_1878213_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
>prophage 5
NZ_CP040379	Salmonella enterica subsp. enterica serovar Montevideo strain FCC0123 chromosome, complete genome	4619529	2164437	2171338	4619529		Salmonella_phage(28.57%)	10	NA	NA
WP_000230462.1|2164437_2165244_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2165245_2166238_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146139.1|2166237_2167128_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_001543117.1|2167251_2167653_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	8.4e-33
WP_001551817.1|2168032_2168920_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	37.7	2.1e-36
WP_001557003.1|2169225_2169399_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	80.6	4.9e-22
WP_001605117.1|2169814_2169955_+	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	77.1	6.5e-09
WP_001640522.1|2169993_2170293_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	55.7	8.5e-14
WP_000727929.1|2170219_2170645_+	peptidase	NA	NA	NA	NA	NA
WP_077905325.1|2171023_2171338_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	86.1	4.3e-40
>prophage 6
NZ_CP040379	Salmonella enterica subsp. enterica serovar Montevideo strain FCC0123 chromosome, complete genome	4619529	2622208	2636490	4619529	tail	Escherichia_phage(50.0%)	17	NA	NA
WP_000497452.1|2622208_2622448_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	87.3	2.5e-32
WP_001529135.1|2623327_2624137_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001277616.1|2624209_2624587_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158844.1|2624734_2625277_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	66.5	8.1e-71
WP_000733298.1|2625469_2626198_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.2e-61
WP_000275698.1|2626214_2626628_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	5.5e-19
WP_000917275.1|2627677_2628802_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_072102280.1|2629248_2629413_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	9.6e-20
WP_000557907.1|2629646_2630480_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000905000.1|2630586_2631141_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.9	4.4e-88
WP_001115580.1|2631170_2631689_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	60.9	2.9e-54
WP_001008237.1|2632262_2632706_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	99.3	1.8e-81
WP_071585783.1|2632726_2633131_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	96.0	2.4e-64
WP_001130332.1|2633079_2633541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001180571.1|2633515_2633980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000340437.1|2634501_2635116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000444505.1|2635239_2636490_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 7
NZ_CP040379	Salmonella enterica subsp. enterica serovar Montevideo strain FCC0123 chromosome, complete genome	4619529	3016667	3056283	4619529	coat,integrase,lysis,terminase,protease,portal,holin	Salmonella_phage(62.5%)	57	3016316:3016337	3056349:3056370
3016316:3016337	attL	CGTTCAACTTAGTATAAAAAAG	NA	NA	NA	NA
WP_031624840.1|3016667_3017921_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	25.8	1.1e-19
WP_000129926.1|3017984_3019736_-	hypothetical protein	NA	I6S5Y0	Salmonella_phage	88.3	3.0e-58
WP_024134398.1|3019975_3020305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001029862.1|3020322_3022215_-	hypothetical protein	NA	E7C9U6	Salmonella_phage	78.3	5.1e-245
WP_000246970.1|3022214_3023615_-	DNA transfer protein	NA	A0A192Y834	Salmonella_phage	91.8	5.8e-222
WP_000964862.1|3023625_3024318_-	hypothetical protein	NA	A0A0M4RTU3	Salmonella_phage	95.7	2.9e-105
WP_000627696.1|3024320_3024776_-	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	99.3	6.7e-87
WP_000774918.1|3024775_3025414_-	hypothetical protein	NA	A0A088CPT1	Enterobacteria_phage	99.1	7.0e-90
WP_001122421.1|3025417_3026836_-	Packaged DNA stabilization protein gp10	NA	I1TEJ1	Salmonella_phage	97.7	6.2e-272
WP_001166104.1|3026795_3027296_-	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	98.2	3.6e-89
WP_000538678.1|3027279_3027840_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	98.4	4.1e-102
WP_001196934.1|3027880_3029173_-|coat	coat protein	coat	I1TEI8	Salmonella_phage	98.8	8.8e-241
WP_000433853.1|3029163_3030084_-	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	3.8e-161
WP_000774654.1|3030097_3032275_-|portal	portal protein	portal	I6R968	Salmonella_phage	98.5	0.0e+00
WP_000417856.1|3032274_3033774_-|terminase	terminase	terminase	A0A1R3Y5N2	Salmonella_virus	99.6	1.4e-306
WP_000729924.1|3033751_3034240_-	hypothetical protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
WP_000013071.1|3034243_3034648_-	hypothetical protein	NA	C6ZR73	Salmonella_phage	98.5	1.5e-66
WP_000807788.1|3034650_3034893_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000681556.1|3035196_3035886_-	hypothetical protein	NA	Q5G8R0	Enterobacteria_phage	99.6	4.2e-125
WP_000086778.1|3036103_3036541_-|lysis	lysis protein	lysis	A0A0N6WGE8	Salmonella_phage	97.2	2.9e-71
WP_001167373.1|3036537_3036975_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	99.3	2.5e-75
WP_000738703.1|3036958_3037285_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_001047574.1|3037990_3038755_-	antitermination protein	NA	Q5G8R6	Enterobacteria_phage	98.4	9.4e-142
WP_000286960.1|3038751_3038934_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	95.0	1.8e-22
WP_001185534.1|3038921_3039392_-	hypothetical protein	NA	C6ZR60	Salmonella_phage	93.6	7.7e-86
WP_001089627.1|3039372_3039609_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	94.9	4.3e-37
WP_000950998.1|3039601_3039778_-	protein ninF	NA	K7P6R5	Enterobacteria_phage	93.0	1.4e-24
WP_000924596.1|3039770_3040172_-	hypothetical protein	NA	G9L690	Escherichia_phage	86.5	7.1e-64
WP_001254236.1|3040174_3040351_-	NinE family protein	NA	A0A220NRK6	Escherichia_phage	94.8	1.9e-26
WP_001154848.1|3040358_3040781_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	100.0	3.7e-79
WP_001291853.1|3040783_3040984_-	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	100.0	4.8e-29
WP_086009405.1|3040986_3041193_-	hypothetical protein	NA	A0A220NQX3	Salmonella_phage	83.0	1.6e-19
WP_000248683.1|3041434_3041641_-	hypothetical protein	NA	A0A2H4FS13	Salmonella_phage	100.0	5.3e-31
WP_001556003.1|3041717_3043598_-	bifunctional DNA primase/helicase	NA	Q5G8S8	Enterobacteria_phage	98.4	0.0e+00
WP_070810831.1|3043705_3044383_-	helix-turn-helix domain-containing protein	NA	A0A0P0ZC04	Stx2-converting_phage	58.5	1.2e-58
WP_000424136.1|3044545_3044836_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	99.0	9.0e-45
WP_001180316.1|3044972_3045200_-	transcriptional regulator	NA	G9L677	Escherichia_phage	89.3	2.1e-33
WP_000250476.1|3045277_3045988_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	87.7	4.0e-118
WP_000434354.1|3046041_3046914_+	hypothetical protein	NA	I6NRL3	Burkholderia_virus	28.8	1.3e-22
WP_000834176.1|3047057_3047261_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	98.5	5.9e-27
WP_000198434.1|3047639_3048002_+	hypothetical protein	NA	C6ZR44	Salmonella_phage	93.3	7.5e-57
WP_001083251.1|3048080_3048581_+	HNH endonuclease	NA	A5H1L2	Xanthomonas_virus	41.9	6.4e-30
WP_000394581.1|3048614_3048923_+	hypothetical protein	NA	K7PH98	Enterobacteria_phage	72.9	2.2e-33
WP_001539176.1|3049226_3049400_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.6e-23
WP_000156731.1|3049380_3049569_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_001046984.1|3049698_3050406_+	recombinase	NA	I6R0N0	Salmonella_phage	98.3	4.2e-136
WP_001253476.1|3050405_3050690_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111292.1|3050736_3051030_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	97.9	8.8e-48
WP_001214770.1|3051040_3051211_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
WP_000665850.1|3051207_3051900_+	HNH endonuclease	NA	C6ZR31	Salmonella_phage	96.0	4.0e-123
WP_000022453.1|3051896_3052298_+	hypothetical protein	NA	S4TTI6	Salmonella_phage	94.7	6.8e-67
WP_000155887.1|3052294_3052717_+	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	53.2	2.0e-37
WP_000582224.1|3052716_3053472_+	hypothetical protein	NA	H6WRY1	Salmonella_phage	99.6	4.2e-150
WP_024133264.1|3054111_3054297_+	hypothetical protein	NA	A0A1V0E5M0	Salmonella_phage	100.0	2.6e-29
WP_000509169.1|3054427_3054694_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	97.7	3.7e-45
WP_001556007.1|3055016_3055235_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
WP_000533679.1|3055212_3056283_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E5M7	Salmonella_phage	100.0	1.0e-154
3056349:3056370	attR	CGTTCAACTTAGTATAAAAAAG	NA	NA	NA	NA
>prophage 8
NZ_CP040379	Salmonella enterica subsp. enterica serovar Montevideo strain FCC0123 chromosome, complete genome	4619529	3525757	3586627	4619529	protease,plate,tRNA,transposase	Saccharomonospora_phage(22.22%)	54	NA	NA
WP_000118730.1|3525757_3527101_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001045934.1|3527104_3527641_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000119439.1|3527707_3528193_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_079849240.1|3528335_3528719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001081549.1|3528703_3529189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000312803.1|3529482_3529968_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_077905981.1|3530221_3530554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013884.1|3530854_3532363_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000996815.1|3532386_3532929_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000175471.1|3532990_3533281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449780.1|3533366_3536030_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	34.5	1.2e-77
WP_000806697.1|3536397_3537300_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_000750536.1|3537286_3538111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000108008.1|3538107_3538602_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371485.1|3538617_3540501_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000145238.1|3540497_3541493_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000367618.1|3541503_3542553_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001562201.1|3543083_3543815_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	9.9e-40
WP_000917872.1|3543878_3544346_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_000801238.1|3544342_3545065_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052773.1|3545099_3545855_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644706.1|3545926_3547294_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_000207221.1|3547349_3548120_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230970.1|3548197_3548998_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001127559.1|3549129_3550305_-	MFS transporter	NA	NA	NA	NA	NA
WP_000648538.1|3550409_3551324_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000154880.1|3551344_3552148_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.0	3.0e-37
WP_000502119.1|3552385_3552844_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001140160.1|3558799_3559366_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594021.1|3559555_3560587_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
WP_001287486.1|3560579_3561233_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874215.1|3561271_3562087_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202315.1|3562205_3562610_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000093989.1|3562606_3563314_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260672.1|3563424_3565143_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000252581.1|3565216_3565918_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000560524.1|3565949_3566372_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185319.1|3566368_3566914_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000955207.1|3567093_3567312_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062330.1|3567298_3567559_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000210068.1|3567642_3568935_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901088.1|3568997_3569387_-	VOC family protein	NA	NA	NA	NA	NA
WP_001021042.1|3569442_3571584_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000524168.1|3571659_3573423_-	chitinase	NA	NA	NA	NA	NA
WP_000055753.1|3573601_3574561_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294832.1|3574573_3578056_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	3.7e-209
WP_000569411.1|3578079_3578676_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	4.3e-25
WP_000741216.1|3578672_3579821_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565950.1|3579820_3580609_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210741.1|3580612_3581068_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139265.1|3581173_3582199_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758966.1|3582202_3582688_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240931.1|3582810_3585243_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000949017.1|3585274_3586627_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
