The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040374	Lactobacillus plantarum subsp. plantarum strain BNH17 chromosome, complete genome	3198645	37663	50721	3198645	head,integrase,capsid,portal,tail,terminase	Staphylococcus_phage(42.86%)	17	37619:37638	42679:42698
37619:37638	attL	GTACAACGTGGTACACTTAG	NA	NA	NA	NA
WP_130851187.1|37663_38818_-|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	36.7	2.3e-59
WP_130851186.1|38925_39705_-	helix-turn-helix transcriptional regulator	NA	L0P7E1	Lactobacillus_phage	39.7	5.0e-05
WP_130851185.1|39797_39977_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021357487.1|40019_40127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130851184.1|40259_40478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130851183.1|40474_41275_+	DNA replication protein	NA	NA	NA	NA	NA
WP_130851182.1|41274_42669_+	virulence protein	NA	Q4ZD27	Staphylococcus_phage	35.7	6.0e-70
WP_130851181.1|42813_43233_+	hypothetical protein	NA	NA	NA	NA	NA
42679:42698	attR	CTAAGTGTACCACGTTGTAC	NA	NA	NA	NA
WP_057136939.1|43256_43568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107787068.1|43554_43896_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_063487667.1|43888_44269_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	45.2	2.9e-19
WP_138069442.1|45037_45511_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_138069443.1|45507_47211_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	41.1	5.8e-123
WP_072535853.1|47164_47365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138069444.1|47365_48472_+|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	33.9	3.2e-50
WP_138069445.1|48461_50042_+|capsid	phage major capsid protein	capsid	A0A1J0MFW8	Staphylococcus_phage	35.0	5.7e-40
WP_027823052.1|50451_50721_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
>prophage 2
NZ_CP040374	Lactobacillus plantarum subsp. plantarum strain BNH17 chromosome, complete genome	3198645	328568	413742	3198645	bacteriocin,protease,tRNA	Bacillus_virus(16.67%)	84	NA	NA
WP_003643762.1|328568_329132_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_011100974.1|329325_329994_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_114619561.1|330143_331649_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003643763.1|331913_332282_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|332394_332904_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_024521227.1|332934_334131_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003646440.1|334240_334711_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_011100976.1|334729_335185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641936.1|335288_335861_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_013355177.1|336026_336947_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_021356913.1|337083_337995_+	oxidoreductase	NA	NA	NA	NA	NA
WP_024521230.1|338846_339293_-	ribonuclease H	NA	NA	NA	NA	NA
WP_003643770.1|339530_341057_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_015825109.1|341057_342029_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_021356773.1|342106_343438_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003643773.1|343903_345421_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003643774.1|345435_347265_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_003641945.1|347279_348002_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
WP_021356774.1|348588_352284_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_047672638.1|354156_354465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021356072.1|354881_355160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074161480.1|355223_355340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138069456.1|355463_356381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016511577.1|357105_357648_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_076640901.1|357662_357926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643788.1|358042_358246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072535411.1|358334_358610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646453.1|358627_359014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646454.1|359239_359395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101495079.1|359735_359927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047672648.1|360079_360487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011100991.1|361757_362036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015379760.1|362362_362980_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_021356659.1|362983_364138_-	MFS transporter	NA	NA	NA	NA	NA
WP_047672651.1|364141_364933_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003641965.1|365003_365876_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641966.1|366035_366851_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_114619563.1|367376_368753_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_011100995.1|368797_369982_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003641969.1|370366_370570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643803.1|370804_370957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641971.1|370981_371650_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003641972.1|371646_371820_-|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnK	bacteriocin	NA	NA	NA	NA
WP_003641973.1|371850_372018_-|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnJ	bacteriocin	NA	NA	NA	NA
WP_003641974.1|372879_373080_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003641975.1|373207_373375_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_061871501.1|373492_374692_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003641977.1|374722_375469_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641978.1|375822_376011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641979.1|376346_376493_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_021356664.1|376683_378012_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_021356665.1|378012_378756_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_021356666.1|379911_380685_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_021356667.1|380783_380942_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_003641985.1|380966_381137_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_015825125.1|381403_383554_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	6.1e-45
WP_015825126.1|383569_384946_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_024272501.1|385035_385725_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_021356668.1|385792_386461_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_076636381.1|386547_387228_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_021356144.1|387321_388008_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_076633895.1|388158_388446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646479.1|388457_388751_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	48.3	9.9e-07
WP_053566442.1|389040_391350_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021356643.1|391608_392385_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_003643815.1|392824_393841_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003641997.1|394248_394959_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641998.1|395031_396393_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641999.1|396399_396588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642000.1|396577_397000_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003643816.1|397222_398578_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642002.1|398595_400032_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	9.7e-31
WP_003642003.1|400152_401049_+	ROK family protein	NA	NA	NA	NA	NA
WP_021356645.1|401198_401945_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_138069457.1|402057_403071_+|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_003642006.1|403524_404658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643820.1|404662_405457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642008.1|405625_406543_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_033608308.1|406588_407863_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642010.1|407855_408815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646490.1|408836_409541_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003642012.1|409540_410383_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_021356646.1|410979_411369_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003643823.1|411690_413742_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
>prophage 3
NZ_CP040374	Lactobacillus plantarum subsp. plantarum strain BNH17 chromosome, complete genome	3198645	575699	584323	3198645		Streptococcus_phage(66.67%)	11	NA	NA
WP_003644909.1|575699_577397_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
WP_003640956.1|577418_577727_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003637790.1|577742_578342_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640957.1|578356_578608_+	YaaL family protein	NA	NA	NA	NA	NA
WP_011101140.1|579005_579671_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640965.1|579667_579997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003640966.1|580013_581033_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640967.1|581057_581405_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_003643942.1|581503_582400_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	9.9e-82
WP_003640969.1|582403_583189_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_013355240.1|583327_584323_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.5	2.0e-51
>prophage 4
NZ_CP040374	Lactobacillus plantarum subsp. plantarum strain BNH17 chromosome, complete genome	3198645	1204991	1217769	3198645		Lactobacillus_phage(70.0%)	13	NA	NA
WP_138069480.1|1204991_1206230_+	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	95.9	9.7e-213
WP_015825455.1|1206320_1207292_-	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	99.4	1.8e-182
WP_003643099.1|1207477_1208425_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_131026895.1|1208385_1208571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643097.1|1208767_1209382_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_021356348.1|1209384_1211823_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.4	0.0e+00
WP_076641070.1|1211910_1212471_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	98.9	8.5e-100
WP_021356350.1|1212541_1212982_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	95.9	4.4e-75
WP_022638020.1|1213077_1213215_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_080475280.1|1213372_1214749_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.4	2.0e-25
WP_021356352.1|1214732_1215425_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	5.3e-35
WP_013355473.1|1216134_1216800_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_021356804.1|1216824_1217769_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	45.8	6.7e-73
>prophage 5
NZ_CP040374	Lactobacillus plantarum subsp. plantarum strain BNH17 chromosome, complete genome	3198645	1246154	1288632	3198645	tRNA,holin,head,integrase,capsid,portal,protease,tail,terminase	Lactobacillus_phage(82.35%)	50	1238580:1238593	1261435:1261448
1238580:1238593	attL	AGCACGACTTTGCG	NA	NA	NA	NA
WP_003644279.1|1246154_1246799_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_003640256.1|1246942_1247266_-	membrane protein	NA	NA	NA	NA	NA
WP_138069481.1|1247486_1248629_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	30.1	1.8e-32
WP_138069482.1|1248862_1249474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138069483.1|1249908_1250109_-	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	98.5	4.2e-25
WP_138069484.1|1250114_1250690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138069485.1|1250746_1251025_-	hypothetical protein	NA	D2KRD5	Lactobacillus_phage	59.3	2.3e-21
WP_138069486.1|1251034_1251373_-	helix-turn-helix transcriptional regulator	NA	A0A059T6G1	Listeria_phage	45.1	9.3e-17
WP_044431044.1|1251635_1251824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138069487.1|1251849_1252557_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	61.4	2.3e-70
WP_138069488.1|1252570_1252759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138069489.1|1252755_1253280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076636550.1|1253338_1253611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118232119.1|1253781_1253970_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_022638745.1|1254004_1254244_+	hypothetical protein	NA	E9LUT6	Lactobacillus_phage	82.4	5.9e-34
WP_118232118.1|1254697_1255003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118232117.1|1255100_1255898_+	replication protein	NA	Q9AZA0	Lactobacillus_prophage	69.7	1.9e-52
WP_138069490.1|1255897_1256683_+	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	90.0	1.3e-130
WP_096587664.1|1256818_1257127_+	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	89.2	1.1e-45
WP_138069491.1|1257119_1257287_+	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	83.6	2.5e-15
WP_138069492.1|1257486_1257813_+	hypothetical protein	NA	O03921	Lactobacillus_phage	59.0	1.6e-29
WP_138069493.1|1257809_1258199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138069494.1|1258195_1258366_+	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	92.9	2.0e-20
WP_021732015.1|1258346_1258772_+	RinA family transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	87.2	7.2e-67
WP_138069495.1|1259448_1259757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138069496.1|1259740_1260394_+	HNH endonuclease	NA	E9LUP6	Lactobacillus_phage	95.7	2.1e-17
WP_138069497.1|1260390_1260633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138069498.1|1260638_1260872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107787494.1|1261091_1261526_+|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	38.5	6.3e-18
1261435:1261448	attR	CGCAAAGTCGTGCT	NA	NA	NA	NA
WP_138069571.1|1261512_1263429_+|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	41.7	3.3e-135
WP_138069499.1|1263650_1264775_+|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	41.2	3.5e-68
WP_027821274.1|1264740_1265346_+|head,protease	HK97 family phage prohead protease	head,protease	B8R651	Lactobacillus_phage	48.5	3.1e-39
WP_138069500.1|1265352_1266735_+|capsid	phage major capsid protein	capsid	A0A0M7RF71	Lactobacillus_phage	62.3	5.2e-98
WP_053566532.1|1266823_1267102_+	hypothetical protein	NA	A0A2P0ZLF2	Lactobacillus_phage	70.3	5.4e-31
WP_138069501.1|1267102_1267450_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	93.9	4.7e-56
WP_138069502.1|1267452_1267860_+	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	93.1	2.2e-65
WP_138069503.1|1267859_1268240_+	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	89.7	8.5e-59
WP_138069504.1|1268256_1268910_+|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	94.5	7.9e-113
WP_138069505.1|1268982_1269357_+	hypothetical protein	NA	A0A2P0ZLH4	Lactobacillus_phage	93.5	4.6e-57
WP_138069506.1|1269353_1269587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138069507.1|1269630_1274088_+	transglycosylase SLT domain-containing protein	NA	A0A2P0ZLG0	Lactobacillus_phage	76.0	0.0e+00
WP_138069508.1|1274164_1275940_+|tail	phage tail protein	tail	A0A2P0ZLH2	Lactobacillus_phage	90.4	1.7e-306
WP_138069509.1|1276006_1278418_+	hypothetical protein	NA	A0A2P0ZLF8	Lactobacillus_phage	93.8	0.0e+00
WP_138069510.1|1278435_1280976_+|tail	phage tail protein	tail	A0A2K9VDD0	Lactobacillus_phage	68.3	6.9e-205
WP_138069511.1|1280968_1281232_+	hypothetical protein	NA	A0A2P0ZLG3	Lactobacillus_phage	88.2	2.7e-24
WP_138069512.1|1282320_1283493_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	94.4	1.1e-202
WP_003644510.1|1283492_1283756_+|holin	holin	holin	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
WP_118232104.1|1283768_1284302_+|holin	holin	holin	E9LUS0	Lactobacillus_phage	95.7	8.0e-39
WP_013355484.1|1284964_1285606_+|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_138069513.1|1285638_1288632_+	cell division protein FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.7	2.4e-87
>prophage 6
NZ_CP040374	Lactobacillus plantarum subsp. plantarum strain BNH17 chromosome, complete genome	3198645	2109482	2148114	3198645	holin,head,portal,protease,tail,terminase	Lactobacillus_phage(44.74%)	51	NA	NA
WP_101495005.1|2109482_2109653_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0P0HRN9	Lactobacillus_phage	64.6	2.9e-11
WP_076672572.1|2109875_2110250_-|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	65.4	8.4e-19
WP_076672571.1|2110236_2110533_-	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	76.5	7.6e-39
WP_094339220.1|2110533_2111649_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	64.7	7.5e-47
WP_021732622.1|2111827_2112262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076631606.1|2112264_2112714_-	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	39.2	4.0e-23
WP_138069527.1|2112720_2117925_-	hypothetical protein	NA	Q6SE68	Lactobacillus_prophage	59.1	3.1e-143
WP_138069528.1|2117939_2118302_-	hypothetical protein	NA	V9QIZ3	Oenococcus_phage	71.2	8.6e-45
WP_138069529.1|2118315_2124147_-|tail	phage tail protein	tail	V5URV5	Oenococcus_phage	41.7	7.0e-237
WP_031275283.1|2124162_2124426_-	hypothetical protein	NA	V9QKH3	Oenococcus_phage	65.4	2.3e-23
WP_003642826.1|2124533_2124932_-	hypothetical protein	NA	V9QJA0	Oenococcus_phage	74.8	3.0e-46
WP_099447638.1|2125031_2125415_-|tail	phage tail protein	tail	V5USQ9	Oenococcus_phage	58.4	1.8e-37
WP_003642824.1|2125516_2125882_-	hypothetical protein	NA	V5UQS4	Oenococcus_phage	53.4	3.0e-29
WP_003642823.1|2125881_2126433_-	HK97 gp10 family phage protein	NA	V5URV0	Oenococcus_phage	61.7	3.3e-64
WP_003642822.1|2126434_2126782_-	hypothetical protein	NA	V5US85	Oenococcus_phage	62.3	3.2e-36
WP_024971556.1|2126781_2127114_-	hypothetical protein	NA	V9QJ97	Oenococcus_phage	45.3	1.8e-12
WP_003642820.1|2127125_2127302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642819.1|2127314_2128337_-	hypothetical protein	NA	V5US24	Oenococcus_phage	62.5	3.7e-117
WP_003642818.1|2128356_2128707_-	hypothetical protein	NA	V5UTH9	Oenococcus_phage	62.9	5.8e-30
WP_138069530.1|2128721_2129399_-	DUF4355 domain-containing protein	NA	Q6SE80	Lactobacillus_prophage	33.9	4.9e-17
WP_003642816.1|2129571_2129778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642815.1|2129829_2130108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138069531.1|2130082_2131768_-|head	phage head morphogenesis protein	head	V5US81	Oenococcus_phage	58.3	1.7e-119
WP_003642812.1|2131914_2132211_-|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	40.2	6.7e-11
WP_138069532.1|2132140_2133649_-|portal	phage portal protein	portal	V9QKI8	Oenococcus_phage	51.3	6.9e-136
WP_076670076.1|2133660_2134902_-|terminase	PBSX family phage terminase large subunit	terminase	X2CYF4	Lactobacillus_phage	58.1	4.6e-138
WP_033608832.1|2134888_2135758_-|terminase	terminase	terminase	V5URT8	Oenococcus_phage	48.9	3.2e-53
WP_138069533.1|2135798_2136044_-	DUF2829 domain-containing protein	NA	S5VZM6	Pseudomonas_phage	50.6	1.3e-15
WP_138069534.1|2136256_2136463_+	CsbD family protein	NA	NA	NA	NA	NA
WP_104880268.1|2136419_2136626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102124400.1|2136995_2137265_+	DUF3892 domain-containing protein	NA	A0A059NT53	Lactococcus_phage	62.7	7.2e-12
WP_003642805.1|2137795_2138257_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
WP_072534390.1|2138384_2138552_-	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	84.8	4.4e-12
WP_103420662.1|2138669_2139092_-	DUF1642 domain-containing protein	NA	A0A2P0ZLB8	Lactobacillus_phage	65.8	1.9e-51
WP_138069535.1|2139156_2139582_-	hypothetical protein	NA	O03921	Lactobacillus_phage	88.5	3.1e-33
WP_138069536.1|2139574_2140030_-	adenine methyltransferase	NA	A0A2P0ZL79	Lactobacillus_phage	82.2	1.7e-69
WP_138069537.1|2140032_2140191_-	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	90.4	1.9e-17
WP_138069538.1|2140183_2140564_-	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_138069539.1|2140560_2141079_-	hypothetical protein	NA	O03915	Lactobacillus_phage	54.6	1.7e-41
WP_050339755.1|2141083_2141806_-	oxidoreductase	NA	Q8SDM9	Staphylococcus_phage	45.6	2.8e-50
WP_134902185.1|2141962_2142805_-	ATP-binding protein	NA	O03914	Lactobacillus_phage	95.7	5.5e-151
WP_134902188.1|2142785_2143661_-	DUF4373 domain-containing protein	NA	NA	NA	NA	NA
WP_138069540.1|2143705_2144578_-	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	49.2	1.1e-72
WP_138069541.1|2144489_2145389_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	47.7	4.6e-63
WP_076670013.1|2145385_2145772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076670016.1|2145904_2146075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024971536.1|2146142_2146655_-	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	43.5	2.1e-28
WP_076670019.1|2146722_2147028_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_044431424.1|2147234_2147531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044431430.1|2147530_2147731_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101085.1|2147877_2148114_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	30.7	8.5e-09
>prophage 7
NZ_CP040374	Lactobacillus plantarum subsp. plantarum strain BNH17 chromosome, complete genome	3198645	2356624	2365138	3198645		Synechococcus_phage(33.33%)	9	NA	NA
WP_003642593.1|2356624_2357203_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.0	1.9e-22
WP_021356101.1|2357195_2358221_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	42.4	1.4e-60
WP_003642591.1|2358217_2359672_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_021356102.1|2359656_2361876_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.1	3.5e-144
WP_021356103.1|2361868_2362549_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642588.1|2362548_2362803_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_021356104.1|2362804_2363536_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	2.1e-37
WP_076636481.1|2363538_2364669_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003642585.1|2364652_2365138_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
>prophage 8
NZ_CP040374	Lactobacillus plantarum subsp. plantarum strain BNH17 chromosome, complete genome	3198645	2835361	2890636	3198645	holin,head,bacteriocin,integrase,capsid,portal,protease,tail,terminase	Lactobacillus_phage(85.0%)	65	2842539:2842561	2886341:2886363
WP_003642473.1|2835361_2835718_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003643468.1|2835912_2836140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011102094.1|2836194_2837049_-	3',5'-cyclic-nucleotide phosphodiesterase	NA	NA	NA	NA	NA
WP_011102095.1|2837490_2838042_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003642477.1|2838453_2838873_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_003642478.1|2838892_2839621_-|holin	antiholin	holin	NA	NA	NA	NA
WP_011102096.1|2839795_2840635_-	DegV family protein	NA	NA	NA	NA	NA
WP_003642481.1|2841159_2841327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642482.1|2841494_2842193_+	zinc metallopeptidase	NA	NA	NA	NA	NA
2842539:2842561	attL	TTTTTCATTTACTCCTCCAAAGT	NA	NA	NA	NA
WP_063485689.1|2843591_2844122_-	hypothetical protein	NA	E9LUS0	Lactobacillus_phage	98.9	8.5e-41
WP_003644510.1|2844134_2844398_-|holin	holin	holin	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
WP_114619677.1|2845428_2845995_-	hypothetical protein	NA	A0A059NTA1	Lactococcus_phage	68.0	1.3e-47
WP_114619678.1|2846658_2846898_-	hypothetical protein	NA	A0A2P0ZLG3	Lactobacillus_phage	98.6	3.7e-28
WP_114619679.1|2846890_2849530_-|tail	phage tail protein	tail	A0A2P0ZLG5	Lactobacillus_phage	64.3	2.9e-129
WP_022638395.1|2849546_2851961_-	phage minor structural protein	NA	A0A2P0ZLF8	Lactobacillus_phage	92.4	0.0e+00
WP_022638396.1|2852027_2853803_-	hypothetical protein	NA	A0A2P0ZLH2	Lactobacillus_phage	90.3	1.4e-300
WP_022638397.1|2853875_2858783_-	tape measure protein	NA	E9LUR1	Lactobacillus_phage	62.9	0.0e+00
WP_016058335.1|2858795_2858987_-	hypothetical protein	NA	E9LUR0	Lactobacillus_phage	100.0	1.5e-27
WP_016058334.1|2858983_2859367_-	hypothetical protein	NA	E9LUQ9	Lactobacillus_phage	100.0	3.9e-64
WP_021732001.1|2859568_2860207_-|tail	major tail protein	tail	E9LUQ8	Lactobacillus_phage	92.9	3.7e-107
WP_022638398.1|2860207_2860591_-	DUF806 family protein	NA	E9LUQ7	Lactobacillus_phage	96.9	1.0e-64
WP_021732003.1|2860587_2861028_-	hypothetical protein	NA	E9LUQ6	Lactobacillus_phage	97.9	3.2e-78
WP_021732004.1|2861017_2861380_-|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	99.2	1.5e-65
WP_016058329.1|2861363_2861702_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	100.0	7.0e-57
WP_114619779.1|2861774_2863007_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	87.7	1.9e-200
WP_114619780.1|2863006_2863762_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	93.6	2.3e-124
WP_022638401.1|2863739_2864933_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	98.7	6.9e-224
WP_022638402.1|2864935_2865130_-	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	93.8	5.3e-25
WP_063491136.1|2865119_2867018_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	92.6	0.0e+00
WP_016511011.1|2867027_2867483_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	96.7	3.0e-79
WP_013355635.1|2867672_2867924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063486123.1|2867941_2868211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080469394.1|2868216_2868687_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	92.9	8.8e-82
WP_063486121.1|2868791_2869406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063486120.1|2869923_2870361_-	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	45.8	2.1e-29
WP_080469393.1|2870425_2870593_-	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	85.1	3.1e-13
WP_063486126.1|2870589_2870913_-	hypothetical protein	NA	Q9T1G9	Lactobacillus_phage	48.5	1.3e-15
WP_101494309.1|2871781_2871940_-	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	94.2	1.3e-18
WP_063486118.1|2871932_2872241_-	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	94.1	2.4e-48
WP_063486117.1|2872406_2873273_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	40.9	1.4e-48
WP_063486116.1|2873266_2874061_-	hypothetical protein	NA	Q9AZA0	Lactobacillus_prophage	69.7	1.9e-52
WP_114619727.1|2874183_2874423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641371.1|2874876_2875077_-	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	89.4	1.0e-26
WP_063486115.1|2875079_2875328_-	hypothetical protein	NA	E9LUT6	Lactobacillus_phage	73.9	8.6e-28
WP_057137267.1|2875493_2875766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025015699.1|2876392_2876614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063486114.1|2876608_2876857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641364.1|2876869_2877079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114619726.1|2877090_2877834_-	hypothetical protein	NA	A0A1P8BM06	Lactococcus_phage	44.9	9.7e-51
WP_080382821.1|2878307_2878535_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003644552.1|2878620_2878836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641361.1|2879091_2879418_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	44.1	6.9e-17
WP_003641360.1|2879448_2879838_+	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	54.3	4.6e-36
WP_003641358.1|2879902_2880103_+	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	100.0	4.9e-26
WP_057137257.1|2880432_2880663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016510999.1|2880832_2881021_+	hypothetical protein	NA	E9LUS5	Lactobacillus_phage	91.9	8.2e-23
WP_057137256.1|2881453_2881711_+	hypothetical protein	NA	A0A2P0ZL96	Lactobacillus_phage	75.0	5.0e-31
WP_003644558.1|2881893_2882208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063486111.1|2882383_2883523_+|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	29.0	4.0e-35
WP_003643471.1|2883802_2885299_+	phytoene desaturase	NA	NA	NA	NA	NA
WP_003642485.1|2885279_2886161_+	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
WP_003642486.1|2886522_2887464_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
2886341:2886363	attR	TTTTTCATTTACTCCTCCAAAGT	NA	NA	NA	NA
WP_003642487.1|2887529_2888642_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.0	1.1e-34
WP_003642488.1|2888777_2890112_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	7.9e-27
WP_003642489.1|2890306_2890636_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 1
NZ_CP040376	Lactobacillus plantarum subsp. plantarum strain BNH17 plasmid unnamed2, complete sequence	77627	11582	53675	77627	holin,transposase,protease	uncultured_marine_virus(20.0%)	32	NA	NA
WP_072540179.1|11582_12218_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_138069583.1|13164_15318_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	47.1	1.2e-104
WP_138069584.1|15456_16422_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_138069585.1|16418_16613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138069586.1|17223_19008_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	34.0	6.1e-83
WP_016526775.1|19074_19389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138069587.1|19484_21587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138069588.1|21596_22376_+	sortase	NA	NA	NA	NA	NA
WP_138069589.1|22404_25344_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_046041437.1|25420_25717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138069590.1|26471_27455_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_138069591.1|27466_28258_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_138069592.1|28273_29032_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_138069593.1|29031_29805_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_138069594.1|29829_30480_+	sugar transferase	NA	NA	NA	NA	NA
WP_138069595.1|30495_31572_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_138069596.1|31571_32687_+	glycosyltransferase	NA	A0A1V0SL50	Klosneuvirus	23.7	2.9e-06
WP_102197015.1|32688_33774_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_057717442.1|33905_34826_+|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.6	1.1e-51
WP_138069597.1|35353_36838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138069598.1|36861_37854_+	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	36.9	3.6e-08
WP_138069599.1|38700_39684_+	capsule biosynthesis protein CapC	NA	NA	NA	NA	NA
WP_138069597.1|40630_42115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138069598.1|42138_43131_+	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	36.9	3.6e-08
WP_138069599.1|43977_44961_+	capsule biosynthesis protein CapC	NA	NA	NA	NA	NA
WP_138069600.1|45462_47013_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_138069601.1|47095_48130_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	34.4	1.4e-42
WP_138069615.1|48569_49364_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	97.7	4.4e-142
WP_138069602.1|49877_51596_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	2.1e-48
WP_022638723.1|51625_52342_+	response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	23.5	1.0e-09
WP_057704853.1|52477_52948_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_138069603.1|52949_53675_+|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
