The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040397	Escherichia coli strain BA22372 chromosome, complete genome	4759293	857574	876092	4759293	lysis,integrase,tail	Escherichia_virus(28.57%)	23	860317:860359	876204:876246
WP_000580417.1|857574_858948_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|858944_859643_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|859792_860293_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
860317:860359	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTT	NA	NA	NA	NA
WP_000023386.1|860477_861458_-|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	99.7	2.3e-185
WP_001192857.1|861527_861821_-	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000453534.1|861973_862246_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_000217670.1|862415_862916_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001600138.1|863512_863965_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	1.4e-79
WP_000554771.1|863964_864171_+	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	97.0	2.4e-31
WP_001143634.1|864413_865352_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
WP_000570053.1|865348_866386_-	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	100.0	4.6e-200
WP_000368931.1|866378_867452_-	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
WP_123891639.1|867643_867829_+	hypothetical protein	NA	M1TAP7	Escherichia_phage	88.7	2.5e-16
WP_060621267.1|868741_869167_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	3.4e-56
WP_000040662.1|869154_869580_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	5.5e-67
WP_001440152.1|869551_869725_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000917174.1|869687_870155_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	1.9e-81
WP_001695629.1|870147_870600_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	5.3e-76
WP_060621266.1|870671_871457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060621264.1|871980_872982_+	hypothetical protein	NA	A0A0C4UQV0	Shigella_phage	91.7	1.2e-176
WP_000972099.1|872983_873511_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	88.6	5.1e-86
WP_000014361.1|873726_874626_+	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	99.7	4.0e-168
WP_000468308.1|875873_876092_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
876204:876246	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTT	NA	NA	NA	NA
>prophage 2
NZ_CP040397	Escherichia coli strain BA22372 chromosome, complete genome	4759293	1251700	1301347	4759293	integrase,tRNA,protease	Vibrio_phage(16.67%)	43	1255808:1255824	1307657:1307673
WP_001162184.1|1251700_1253053_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232255.1|1253107_1253494_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106226.1|1253538_1254003_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
WP_000187791.1|1254162_1256301_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
1255808:1255824	attL	TCGAGATCGTGATAGTG	NA	NA	NA	NA
WP_001375992.1|1256694_1258350_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001299664.1|1258399_1259821_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181324.1|1259939_1260887_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|1261071_1261125_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|1261265_1263962_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|1264167_1264554_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|1264626_1265088_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|1265100_1266036_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|1266039_1266174_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230281.1|1266454_1266850_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500727.1|1266980_1267694_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001375985.1|1267764_1268358_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001336307.1|1268502_1268955_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_086711623.1|1269077_1270673_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000012904.1|1270729_1271734_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|1271895_1272312_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059398.1|1272357_1272861_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000416392.1|1274301_1277157_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_000786399.1|1277156_1277600_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|1277857_1279369_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|1279635_1280736_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|1280735_1281818_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001376011.1|1281978_1283481_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_000061768.1|1283610_1284630_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_023148066.1|1285000_1286911_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001261095.1|1287043_1287376_-	NIPSNAP family protein	NA	NA	NA	NA	NA
WP_000085626.1|1288381_1288711_-	DUF1643 domain-containing protein	NA	A0A1V0EBT6	Caulobacter_phage	35.4	2.0e-11
WP_000190110.1|1289040_1289601_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	39.9	4.2e-22
WP_000331917.1|1289614_1290460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000145203.1|1290520_1291015_-	membrane protein	NA	NA	NA	NA	NA
WP_000749342.1|1291255_1291720_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060570892.1|1292413_1293661_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	38.8	1.5e-83
WP_016190492.1|1293771_1294641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106464560.1|1294886_1295312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000401166.1|1295735_1295939_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_106464561.1|1295954_1296263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106464562.1|1296600_1297815_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_106464563.1|1297811_1299353_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_106464564.1|1299349_1301347_+|integrase	integrase	integrase	NA	NA	NA	NA
1307657:1307673	attR	TCGAGATCGTGATAGTG	NA	NA	NA	NA
>prophage 3
NZ_CP040397	Escherichia coli strain BA22372 chromosome, complete genome	4759293	2169754	2196958	4759293	lysis,integrase,capsid,tail	Enterobacteria_phage(47.06%)	47	2162989:2163003	2192637:2192651
2162989:2163003	attL	AAATTAATGAAAAAA	NA	NA	NA	NA
WP_000533646.1|2169754_2170825_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
WP_001303849.1|2170802_2171021_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|2171060_2171228_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_071525073.1|2171160_2171346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000120065.1|2171470_2172073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763365.1|2172283_2172505_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_001395510.1|2172603_2172885_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_023148020.1|2172895_2173087_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_072126246.1|2173059_2173242_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_001372450.1|2173238_2173919_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_000100847.1|2173915_2174701_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|2174706_2175003_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000233576.1|2175078_2175285_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000210934.1|2175793_2176621_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000389051.1|2176617_2177367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000858975.1|2177489_2178179_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|2178283_2178514_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182899.1|2178583_2179123_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001415152.1|2179209_2180139_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.2e-109
WP_001372464.1|2180135_2180837_+	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_000145917.1|2180833_2181127_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001403556.1|2181163_2181355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720581.1|2181611_2182172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|2182168_2182621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072157016.1|2182713_2182815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372486.1|2182811_2183267_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224914.1|2183266_2183437_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001372487.1|2183429_2183720_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
WP_001372483.1|2183716_2184079_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
WP_000971068.1|2184075_2184216_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204777.1|2184301_2184679_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000780581.1|2184834_2185359_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_000592543.1|2185551_2186511_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_124039027.1|2186646_2186844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839582.1|2187780_2187996_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001372488.1|2187995_2188493_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
WP_001228702.1|2188709_2188916_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001139678.1|2188944_2189097_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079508.1|2189448_2189859_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|2189915_2190149_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_001372490.1|2190537_2191098_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
WP_072035100.1|2191906_2192044_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
WP_000239881.1|2191988_2192657_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
2192637:2192651	attR	TTTTTTCATTAATTT	NA	NA	NA	NA
WP_072163407.1|2192806_2192983_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.5	9.4e-21
WP_001753290.1|2193056_2194388_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_000767389.1|2195133_2195610_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001356070.1|2195668_2196958_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
>prophage 4
NZ_CP040397	Escherichia coli strain BA22372 chromosome, complete genome	4759293	2485105	2526653	4759293	integrase,transposase	Stx2-converting_phage(37.5%)	34	2481478:2481492	2487667:2487681
2481478:2481492	attL	CAGAAATTATTTTTT	NA	NA	NA	NA
WP_000279872.1|2485105_2486308_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_042002566.1|2486494_2488312_-	hypothetical protein	NA	NA	NA	NA	NA
2487667:2487681	attR	CAGAAATTATTTTTT	NA	NA	NA	NA
WP_001303889.1|2489423_2489720_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_032141622.1|2489964_2490162_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335695.1|2490380_2491814_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_032180014.1|2492634_2493198_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001333439.1|2493872_2498831_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000622487.1|2498827_2500264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024167628.1|2500368_2500575_+	methyltransferase	NA	NA	NA	NA	NA
WP_000757210.1|2500743_2502633_-	enterotoxin	NA	NA	NA	NA	NA
WP_032180015.1|2502646_2503822_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_138223033.1|2503833_2505408_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_000195940.1|2505521_2505926_-	aldolase	NA	NA	NA	NA	NA
WP_000072197.1|2506108_2506933_+	aga operon transcriptional regulator AgaR	NA	NA	NA	NA	NA
WP_001335688.1|2506995_2507433_-	galactarate dehydratase	NA	NA	NA	NA	NA
WP_032180018.1|2507514_2508150_-	galactarate dehydratase	NA	NA	NA	NA	NA
WP_001333328.1|2508336_2508576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104976704.1|2508752_2509980_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	2.7e-170
WP_077249141.1|2510265_2510466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001387298.1|2510593_2510692_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_001295538.1|2510693_2511476_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|2511781_2512702_+	ribokinase	NA	NA	NA	NA	NA
WP_000998346.1|2512729_2514046_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107485.1|2514057_2515071_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_021566758.1|2515525_2515906_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.2e-65
WP_000612601.1|2515902_2516250_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	1.1e-60
WP_032180022.1|2516299_2517838_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	7.1e-298
WP_072129716.1|2519567_2520350_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.7e-138
WP_000179884.1|2520593_2520770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071586880.1|2520732_2520912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000547185.1|2521140_2522469_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000608644.1|2522734_2523997_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000976514.1|2524320_2525466_+	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_021513032.1|2526194_2526653_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
>prophage 5
NZ_CP040397	Escherichia coli strain BA22372 chromosome, complete genome	4759293	2655458	2666236	4759293	integrase	Enterobacteria_phage(40.0%)	11	2656733:2656756	2668241:2668264
WP_000444487.1|2655458_2656709_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2656733:2656756	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
WP_000741339.1|2656822_2657965_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	99.7	8.1e-206
WP_000088653.1|2657954_2658191_-	excisionase	NA	NA	NA	NA	NA
WP_000488406.1|2658330_2658570_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_001678640.1|2658617_2658836_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
WP_001678641.1|2658989_2660054_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
WP_000149533.1|2660050_2660209_-	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_001372461.1|2660205_2660886_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
WP_072163463.1|2660882_2661194_-	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
WP_001753331.1|2661376_2661916_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_000379042.1|2664280_2666236_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
2668241:2668264	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 6
NZ_CP040397	Escherichia coli strain BA22372 chromosome, complete genome	4759293	3068848	3091415	4759293	tail,integrase,lysis	Escherichia_phage(26.67%)	27	3081334:3081347	3093699:3093712
WP_072163404.1|3068848_3068974_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	82.5	1.5e-12
WP_023147795.1|3070385_3070664_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_000980999.1|3070730_3070982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001013632.1|3071197_3071410_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
WP_122083109.1|3071454_3071562_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_032181055.1|3071568_3071877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023147794.1|3072081_3073062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023147793.1|3073421_3074024_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
WP_001678529.1|3074341_3075691_+	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
WP_001678528.1|3076238_3077183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001373616.1|3077312_3077735_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
WP_000054501.1|3077775_3078741_-	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_072163420.1|3078721_3078964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|3079047_3079236_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083281.1|3079232_3079424_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001372999.1|3079517_3081989_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
3081334:3081347	attL	GCGGCAATCAGCAT	NA	NA	NA	NA
WP_001296941.1|3082076_3082313_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000877001.1|3082347_3083628_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001360138.1|3083647_3083758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836058.1|3083815_3084835_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|3084846_3086061_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|3086266_3086593_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|3086727_3087069_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|3087103_3087664_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|3087666_3088377_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|3088484_3088790_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041556.1|3088988_3091415_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
3093699:3093712	attR	ATGCTGATTGCCGC	NA	NA	NA	NA
>prophage 7
NZ_CP040397	Escherichia coli strain BA22372 chromosome, complete genome	4759293	3644377	3653819	4759293		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292773.1|3644377_3645514_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001374182.1|3645510_3647511_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001295429.1|3647635_3648097_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|3648137_3648608_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3648654_3649374_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|3649370_3651056_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|3651277_3652009_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|3652068_3652176_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3652156_3652888_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569361.1|3652892_3653819_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
>prophage 8
NZ_CP040397	Escherichia coli strain BA22372 chromosome, complete genome	4759293	3908850	3938700	4759293	holin,lysis,terminase,protease	Enterobacteria_phage(45.24%)	45	NA	NA
WP_106464544.1|3908850_3910245_-	DNA transfer protein	NA	A0A220NR03	Salmonella_phage	64.2	3.2e-148
WP_106464545.1|3912752_3914165_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.6	4.9e-277
WP_000113732.1|3914161_3914602_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_000807785.1|3914604_3914847_-	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_000999679.1|3914950_3915322_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	90.2	2.0e-57
WP_096957088.1|3915547_3916066_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	99.4	1.2e-92
WP_106464546.1|3916057_3916255_+	hypothetical protein	NA	H6WRZ7	Salmonella_phage	94.2	2.6e-19
WP_106464547.1|3916270_3916423_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	98.0	4.0e-20
WP_106464548.1|3916410_3916848_-|lysis	lysis protein	lysis	K7P7F7	Enterobacteria_phage	97.9	6.5e-71
WP_138223039.1|3916844_3917321_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	4.9e-88
WP_000783734.1|3917304_3917628_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_138223040.1|3918349_3918928_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.5	5.3e-105
WP_000994516.1|3918968_3919157_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_138223041.1|3919153_3919516_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A220NRL7	Escherichia_phage	99.2	1.7e-61
WP_032181228.1|3919512_3919803_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	99.0	2.2e-51
WP_000950943.1|3920516_3920693_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	98.3	2.5e-26
WP_086711682.1|3921055_3921232_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	98.3	6.7e-27
WP_060504015.1|3921228_3921639_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.1	1.5e-69
WP_001515066.1|3921647_3921854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060504012.1|3921856_3922123_-	hypothetical protein	NA	Q716C8	Shigella_phage	63.1	4.3e-25
WP_000049638.1|3922134_3922335_-	hypothetical protein	NA	Q716C9	Shigella_phage	100.0	4.6e-32
WP_000796282.1|3922331_3922658_-	hypothetical protein	NA	Q716D0	Shigella_phage	100.0	3.3e-59
WP_000145931.1|3922730_3923021_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_138223042.1|3923017_3923698_-	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	99.1	8.4e-126
WP_038820284.1|3923714_3924614_-	replication protein	NA	M1FN81	Enterobacteria_phage	99.3	1.2e-172
WP_024203136.1|3924646_3924943_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	99.0	4.4e-47
WP_000437876.1|3925081_3925282_-	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	100.0	3.3e-30
WP_106464549.1|3925382_3926096_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.6	1.8e-131
WP_001324502.1|3926953_3927424_+	hypothetical protein	NA	K7P6H4	Enterobacteria_phage	100.0	2.1e-75
WP_138223043.1|3927503_3927689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000198441.1|3927916_3928300_+	hypothetical protein	NA	G9L671	Escherichia_phage	99.2	8.8e-64
WP_053896643.1|3928940_3929309_+	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	98.4	1.7e-64
WP_001198861.1|3929381_3929546_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_116300240.1|3929731_3930028_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	6.2e-49
WP_000100847.1|3930033_3930819_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_106464550.1|3931491_3931674_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	95.0	1.4e-27
WP_000548531.1|3931646_3931838_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_077250124.1|3931848_3932130_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	7.9e-46
WP_138223044.1|3932227_3932449_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.9e-34
WP_106464551.1|3932445_3932856_+	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	53.1	1.0e-38
WP_106464552.1|3932852_3933680_+	DUF551 domain-containing protein	NA	A0A0N7C063	Escherichia_phage	90.4	9.2e-50
WP_001277766.1|3933776_3933956_+	Eag protein	NA	K7PL40	Enterobacteria_phage	96.6	2.8e-28
WP_001163428.1|3934087_3934288_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001274871.1|3936136_3937051_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194515.1|3937266_3938700_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 9
NZ_CP040397	Escherichia coli strain BA22372 chromosome, complete genome	4759293	4299758	4312941	4759293		Escherichia_phage(50.0%)	12	NA	NA
WP_001272924.1|4299758_4302320_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141340.1|4302425_4303082_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001297141.1|4303132_4303900_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|4304095_4305004_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|4305000_4306263_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|4306259_4306898_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136918.1|4306902_4307679_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104456.1|4307767_4309132_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|4309225_4310218_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|4310280_4311420_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|4311559_4312186_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001374723.1|4312179_4312941_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
>prophage 1
NZ_CP040398	Escherichia coli strain BA22372 plasmid pCTX-M-15_22372, complete sequence	98470	576	62560	98470	transposase,protease,integrase	Escherichia_phage(38.1%)	53	10041:10056	71480:71495
WP_000616807.1|576_1230_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|1322_1580_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000439434.1|1581_1914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063840321.1|5307_5862_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|5992_6823_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
10041:10056	attL	ATTCCAGTAAAGACAG	NA	NA	NA	NA
WP_001393253.1|10480_10813_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|10859_11735_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001067855.1|12116_12821_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|13405_14266_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000147567.1|16886_17447_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000134999.1|18019_18661_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_001043265.1|22240_23056_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_001082319.1|23116_23920_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|23919_24756_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001389365.1|25658_26423_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001336397.1|26613_26970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|26915_27500_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|27499_28738_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|28734_29640_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_014837927.1|30503_31631_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001330846.1|31681_31927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|31932_32124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|32605_33148_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|33160_34021_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_072199528.1|35235_36102_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	100.0	1.3e-163
WP_000027057.1|37276_38137_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001347546.1|38286_38712_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|38723_39428_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_074465661.1|39373_39583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845048.1|39829_40843_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|41000_41474_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|41605_42394_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|42599_42947_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|42940_43780_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|43709_43889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376616.1|43907_44111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|44685_45390_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000428546.1|45523_46117_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|46229_47435_-	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_001322387.1|47513_48140_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_086258557.1|48991_49186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106464572.1|49381_50551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042012863.1|50847_51042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032156742.1|51750_51876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066942.1|51996_52737_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_001485481.1|54310_54544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513660.1|55130_55490_-	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513661.1|55517_55697_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001216034.1|55701_56082_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|56081_56303_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001553856.1|56485_58042_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
WP_001617890.1|58038_59322_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.2e-10
WP_031311986.1|59443_62560_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	2.9e-27
71480:71495	attR	ATTCCAGTAAAGACAG	NA	NA	NA	NA
