The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040425	Acinetobacter baumannii strain PB364 chromosome, complete genome	4014051	1154136	1223341	4014051	integrase,terminase,capsid	Acinetobacter_phage(97.37%)	86	1168926:1168942	1219688:1219704
WP_001187844.1|1154136_1154685_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
WP_000893683.1|1154947_1156447_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	100.0	6.1e-286
WP_001076817.1|1156448_1158824_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	100.0	0.0e+00
WP_001164226.1|1158830_1159814_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	100.0	2.0e-189
WP_000066126.1|1159824_1160520_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_000608304.1|1160529_1161336_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	100.0	7.9e-147
WP_001982145.1|1161345_1162395_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000281127.1|1162750_1165483_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	99.9	0.0e+00
WP_000960548.1|1165562_1168262_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	100.0	0.0e+00
WP_000566784.1|1168357_1168933_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	3.2e-110
1168926:1168942	attL	TCGATCATTAGAAGCAT	NA	NA	NA	NA
WP_000529848.1|1169056_1169326_-	hypothetical protein	NA	A0A0P0J067	Acinetobacter_phage	100.0	8.7e-42
WP_000993703.1|1169326_1169809_-	methyltransferase domain-containing protein	NA	A0A0N7IRF6	Acinetobacter_phage	72.3	1.5e-68
WP_001290365.1|1169805_1170018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000028959.1|1170014_1170224_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	92.8	4.1e-31
WP_000566262.1|1170220_1170670_-	DUF551 domain-containing protein	NA	A0A0P0HSE1	Acinetobacter_phage	93.1	6.0e-80
WP_000654847.1|1170673_1170919_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	1.5e-40
WP_000789909.1|1170920_1171997_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	75.4	4.6e-142
WP_004793763.1|1171993_1173115_-	ATP-binding protein	NA	A0A0D4DBX7	Acinetobacter_phage	99.7	1.3e-211
WP_000064463.1|1173126_1173450_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	95.3	4.8e-55
WP_000656405.1|1173442_1173733_-	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	95.8	5.1e-48
WP_001101442.1|1173732_1174173_-	hypothetical protein	NA	A0A0D4DBH9	Acinetobacter_phage	95.9	6.3e-74
WP_000051960.1|1174362_1174605_+	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	100.0	5.2e-38
WP_000845537.1|1174611_1174815_-	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
WP_001129676.1|1174953_1175457_-	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
WP_000048052.1|1175458_1176466_-	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
WP_000370481.1|1176517_1176733_-	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	100.0	8.5e-32
WP_001093654.1|1176747_1177512_-	LexA family transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	100.0	2.8e-146
WP_000996063.1|1177620_1177872_+	hypothetical protein	NA	A0A0N7IRE1	Acinetobacter_phage	100.0	8.9e-41
WP_000049334.1|1177882_1178203_+	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	100.0	4.6e-50
WP_001095598.1|1178258_1178534_+	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	100.0	8.9e-42
WP_002037796.1|1178605_1178830_+	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	98.6	6.5e-35
WP_000064623.1|1178822_1179704_+	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	100.0	9.8e-143
WP_138067717.1|1179706_1180507_+	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	99.6	2.9e-149
WP_001031749.1|1180503_1180638_+	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	100.0	1.1e-18
WP_000648413.1|1180624_1181047_+	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
WP_095357150.1|1181096_1181459_+	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	99.2	3.3e-68
WP_001288422.1|1181451_1181676_+	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
WP_000100164.1|1181675_1182071_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	1.5e-66
WP_000605710.1|1182067_1182589_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	77.6	2.8e-73
WP_000834228.1|1182730_1183033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001017695.1|1183118_1183337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000215490.1|1183457_1183892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000787533.1|1183936_1184584_+	hypothetical protein	NA	A0A0N7IRF1	Acinetobacter_phage	96.7	4.0e-125
WP_000113273.1|1184631_1185111_+	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	95.8	7.1e-71
WP_000102072.1|1185100_1186528_+|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	90.5	7.9e-259
WP_135048341.1|1186524_1187976_+	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	98.3	8.8e-282
WP_000179751.1|1187977_1189081_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	99.7	7.8e-206
WP_000965231.1|1189089_1189518_+	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	100.0	5.2e-73
WP_000004363.1|1189616_1189859_+	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	100.0	3.6e-39
WP_001139861.1|1190076_1190268_+	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
WP_000770049.1|1190381_1191149_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
WP_000214198.1|1191176_1192133_+	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	97.5	4.8e-175
WP_000692540.1|1192198_1192864_+	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	96.8	2.6e-111
WP_000008496.1|1192868_1193258_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	7.3e-66
WP_000524213.1|1193259_1193628_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	95.1	1.2e-62
WP_000247952.1|1193636_1194041_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	91.7	2.2e-65
WP_000539748.1|1194012_1194381_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	80.3	2.6e-52
WP_002016455.1|1194337_1194781_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	87.8	3.1e-68
WP_001277696.1|1194782_1195001_+	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
WP_000749909.1|1195109_1195631_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000064593.1|1195727_1196081_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
WP_000002415.1|1196080_1197436_+	hypothetical protein	NA	A0A0N7IRE5	Acinetobacter_phage	99.3	6.5e-202
WP_000094278.1|1197488_1198406_+	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	100.0	2.0e-170
WP_001185585.1|1198475_1198991_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
WP_000274931.1|1199800_1200259_+	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
WP_002012864.1|1200364_1200541_+	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	59.6	8.2e-09
WP_000725052.1|1200907_1201291_+	hypothetical protein	NA	A0A0D4DBP2	Acinetobacter_phage	67.7	2.2e-46
WP_000599538.1|1201352_1202096_+	hypothetical protein	NA	A0A0N7IRG5	Acinetobacter_phage	91.5	5.6e-123
WP_000041780.1|1202109_1202421_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000538615.1|1202536_1202707_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835375.1|1202703_1203705_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	42.2	6.4e-21
WP_000130334.1|1204035_1204383_+	hypothetical protein	NA	A0A0N7IRG4	Acinetobacter_phage	97.4	1.6e-59
WP_000046169.1|1204443_1209243_+	tape measure protein	NA	J7I4Q7	Acinetobacter_phage	83.8	0.0e+00
WP_000134295.1|1209711_1210443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000959543.1|1210432_1211077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991941.1|1211103_1211811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277446.1|1211947_1212346_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	3.1e-72
WP_000368381.1|1212345_1212852_+	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	98.2	2.9e-91
WP_000835156.1|1212848_1213211_+	hypothetical protein	NA	A0A0D4DCJ1	Acinetobacter_phage	98.3	2.6e-65
WP_000590484.1|1213203_1216650_+	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	98.9	0.0e+00
WP_000433918.1|1216717_1217107_+	hypothetical protein	NA	J7I481	Acinetobacter_phage	100.0	2.5e-66
WP_001019395.1|1217149_1217692_+	N-acetylmuramidase	NA	A0A0B5KTG8	Acinetobacter_phage	100.0	2.0e-101
WP_000098296.1|1218125_1218320_+	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	100.0	3.8e-31
WP_000947611.1|1218316_1219513_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0D4DBR3	Acinetobacter_phage	100.0	2.5e-226
WP_138067718.1|1220000_1221803_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	99.8	0.0e+00
1219688:1219704	attR	TCGATCATTAGAAGCAT	NA	NA	NA	NA
WP_000872622.1|1221799_1223341_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	100.0	3.9e-288
>prophage 2
NZ_CP040425	Acinetobacter baumannii strain PB364 chromosome, complete genome	4014051	1563516	1605373	4014051	transposase,integrase,plate,capsid	Acinetobacter_phage(100.0%)	59	1563339:1563356	1605881:1605898
1563339:1563356	attL	GGATTCTACTTCTTTTAT	NA	NA	NA	NA
WP_000773619.1|1563516_1564779_+|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	100.0	3.8e-249
WP_000910238.1|1564784_1565054_-	hypothetical protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
WP_002003198.1|1565054_1565408_-	hypothetical protein	NA	J7I0Y4	Acinetobacter_phage	100.0	2.6e-62
WP_138067757.1|1565404_1565794_-	hypothetical protein	NA	J7HXR6	Acinetobacter_phage	95.3	4.6e-68
WP_000654852.1|1565796_1566042_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.8	5.7e-40
WP_000789905.1|1566043_1567003_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	89.7	1.1e-158
WP_001207480.1|1566999_1568121_-	ATP-binding protein	NA	A0A0P0IDZ3	Acinetobacter_phage	100.0	3.0e-213
WP_000181037.1|1568131_1568455_-	hypothetical protein	NA	A0A0P0IRC4	Acinetobacter_phage	93.5	1.1e-51
WP_001101456.1|1568457_1568898_-	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	100.0	4.0e-76
WP_000129518.1|1569095_1569851_-	helix-turn-helix transcriptional regulator	NA	A0A0P0I8E0	Acinetobacter_phage	100.0	1.5e-144
WP_001050157.1|1569951_1570167_+	helix-turn-helix domain-containing protein	NA	A0A0P0IY81	Acinetobacter_phage	100.0	1.3e-35
WP_000092157.1|1570177_1570534_+	hypothetical protein	NA	A0A0P0IKQ0	Acinetobacter_phage	100.0	2.2e-61
WP_001095598.1|1570589_1570865_+	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	100.0	8.9e-42
WP_002037796.1|1570936_1571161_+	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	98.6	6.5e-35
WP_000064623.1|1571153_1572035_+	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	100.0	9.8e-143
WP_138067717.1|1572037_1572838_+	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	99.6	2.9e-149
WP_001031749.1|1572834_1572969_+	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	100.0	1.1e-18
WP_000648413.1|1572955_1573378_+	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
WP_114220156.1|1573427_1573790_+	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	98.3	2.1e-67
WP_138067719.1|1574069_1574339_+	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	94.9	9.0e-23
WP_000100164.1|1574338_1574734_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	1.5e-66
WP_000783470.1|1574730_1575231_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	100.0	3.1e-93
WP_002001437.1|1575426_1576077_+	hypothetical protein	NA	A0A0P0IKQ5	Acinetobacter_phage	99.5	2.1e-94
WP_000715269.1|1576338_1577097_+	hypothetical protein	NA	A0A0P0J0C5	Acinetobacter_phage	100.0	2.9e-143
WP_000787534.1|1577191_1577839_+	hypothetical protein	NA	A0A0N7IRF1	Acinetobacter_phage	100.0	5.0e-128
WP_000113271.1|1577886_1578396_+	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	100.0	1.2e-89
WP_000220360.1|1578392_1580051_+	hypothetical protein	NA	A0A0P0IVT4	Acinetobacter_phage	100.0	0.0e+00
WP_000522918.1|1580061_1581474_+	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	100.0	4.6e-259
WP_000635838.1|1581496_1582132_+|capsid	minor capsid protein	capsid	A0A0P0IKX5	Acinetobacter_phage	100.0	7.1e-119
WP_000473611.1|1582420_1583737_+	DUF2213 domain-containing protein	NA	A0A0P0IRE1	Acinetobacter_phage	100.0	3.5e-213
WP_000525986.1|1583740_1584217_+	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	100.0	3.0e-85
WP_000040568.1|1584281_1585307_+	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	100.0	1.7e-194
WP_000041170.1|1585316_1585748_+	hypothetical protein	NA	A0A0P0IYA6	Acinetobacter_phage	100.0	8.1e-58
WP_000622625.1|1585751_1586138_+	DUF4054 domain-containing protein	NA	A0A0P0IKR4	Acinetobacter_phage	100.0	2.3e-67
WP_000094499.1|1586134_1586695_+	hypothetical protein	NA	A0A0P0J0D1	Acinetobacter_phage	100.0	5.2e-97
WP_000057776.1|1586681_1587050_+	hypothetical protein	NA	A0A0P0HSK8	Acinetobacter_phage	100.0	5.9e-65
WP_000502801.1|1587052_1587592_+	hypothetical protein	NA	A0A0P0IVT9	Acinetobacter_phage	100.0	3.3e-101
WP_000174797.1|1587595_1589071_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	100.0	3.7e-275
WP_000109248.1|1589085_1589529_+	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	100.0	3.3e-78
WP_001165484.1|1589528_1589990_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	100.0	1.2e-78
WP_001285933.1|1590185_1592210_+	hypothetical protein	NA	A0A0P0IE11	Acinetobacter_phage	100.0	0.0e+00
WP_000821707.1|1592206_1592563_-	DUF1311 domain-containing protein	NA	A0A0P0IRF2	Acinetobacter_phage	100.0	4.5e-62
WP_001051325.1|1592562_1592790_-	hypothetical protein	NA	A0A0P0I8G2	Acinetobacter_phage	100.0	1.5e-31
WP_001018608.1|1593149_1593746_+	hypothetical protein	NA	A0A0P0IKS1	Acinetobacter_phage	100.0	7.9e-104
WP_001240304.1|1593748_1594045_+	hypothetical protein	NA	A0A0P0J0D9	Acinetobacter_phage	100.0	7.3e-50
WP_000003732.1|1594041_1595001_+	hypothetical protein	NA	A0A0P0HSL6	Acinetobacter_phage	100.0	3.1e-182
WP_001218525.1|1595003_1595666_+	hypothetical protein	NA	A0A0N7IRF4	Acinetobacter_phage	100.0	5.1e-128
WP_001270576.1|1595700_1596054_+	hypothetical protein	NA	A0A0P0IVU6	Acinetobacter_phage	100.0	1.4e-63
WP_001229408.1|1596056_1597241_+|plate	baseplate J/gp47 family protein	plate	A0A0P0I499	Acinetobacter_phage	100.0	7.1e-221
WP_001192561.1|1597240_1597831_+	DUF2612 domain-containing protein	NA	A0A0P0IKZ0	Acinetobacter_phage	100.0	8.7e-111
WP_000359223.1|1597823_1598432_+	hypothetical protein	NA	A0A0P0IE19	Acinetobacter_phage	100.0	6.2e-112
WP_000224779.1|1598495_1600550_+	hypothetical protein	NA	A0A0P0IRG3	Acinetobacter_phage	100.0	0.0e+00
WP_001104857.1|1600551_1600779_+	hypothetical protein	NA	A0A0P0I8G9	Acinetobacter_phage	100.0	3.0e-35
WP_138067720.1|1600856_1601246_+	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	98.4	5.6e-66
WP_001019736.1|1601288_1601834_+	N-acetylmuramidase	NA	A0A0N7IRF5	Acinetobacter_phage	100.0	1.8e-102
WP_000999701.1|1602023_1602704_+	hypothetical protein	NA	A0A0P0IKS6	Acinetobacter_phage	100.0	4.6e-116
WP_001109862.1|1602714_1603362_+	hypothetical protein	NA	J7I4R4	Acinetobacter_phage	100.0	3.6e-118
WP_000151893.1|1603368_1603962_+	hypothetical protein	NA	A0A0P0HSM0	Acinetobacter_phage	100.0	5.1e-103
WP_085942227.1|1604207_1605373_-|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	100.0	7.1e-165
1605881:1605898	attR	GGATTCTACTTCTTTTAT	NA	NA	NA	NA
>prophage 3
NZ_CP040425	Acinetobacter baumannii strain PB364 chromosome, complete genome	4014051	2153525	2183056	4014051	tail,terminase,portal,capsid,protease,head	Acinetobacter_phage(46.43%)	44	NA	NA
WP_001186628.1|2153525_2153723_-	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	57.1	6.2e-13
WP_002018743.1|2153817_2153988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000265243.1|2153956_2154325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000095892.1|2154324_2154834_-	lysozyme	NA	A0A0B5L5F7	Acinetobacter_phage	57.4	3.8e-46
WP_000774828.1|2154817_2155084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001104854.1|2155158_2155383_-	hypothetical protein	NA	A0A0P0I8G9	Acinetobacter_phage	95.9	1.6e-33
WP_002018761.1|2155384_2157421_-	hypothetical protein	NA	A0A0P0IRG3	Acinetobacter_phage	95.0	0.0e+00
WP_000078482.1|2157474_2160309_-	hypothetical protein	NA	A0A1B1P9G8	Acinetobacter_phage	36.1	4.9e-167
WP_001026372.1|2160259_2160655_-	hypothetical protein	NA	A0A1B1P9H4	Acinetobacter_phage	52.8	1.6e-28
WP_000587324.1|2160651_2161161_-	DUF1833 family protein	NA	NA	NA	NA	NA
WP_000882463.1|2161163_2161625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246490.1|2161640_2165234_-	transglycosylase SLT domain-containing protein	NA	A0A0U4JEA4	Pseudomonas_phage	39.9	3.0e-44
WP_001031955.1|2165296_2165629_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	43.1	1.1e-14
WP_000498808.1|2165705_2165921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001074127.1|2165956_2166472_-|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_001062223.1|2166473_2166950_-	hypothetical protein	NA	A0A2H4JBZ0	uncultured_Caudovirales_phage	66.2	6.4e-56
WP_000598741.1|2167021_2167396_-	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	44.5	1.7e-19
WP_000235306.1|2167395_2167881_-	HK97 gp10 family phage protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	45.3	6.4e-27
WP_001139340.1|2167884_2168241_-|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	50.0	1.9e-20
WP_000631202.1|2168242_2168530_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	46.5	2.5e-18
WP_000666092.1|2168526_2168703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137059.1|2168750_2169923_-|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	47.2	9.2e-88
WP_000375469.1|2169915_2170578_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	62.3	6.2e-73
WP_000108393.1|2170570_2171797_-|portal	phage portal protein	portal	A0A2H4J6S3	uncultured_Caudovirales_phage	75.6	1.1e-181
WP_000097334.1|2171793_2173485_-|terminase	terminase large subunit	terminase	A0A2H4J559	uncultured_Caudovirales_phage	82.1	4.8e-271
WP_001219088.1|2173488_2173971_-|terminase	terminase small subunit	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	46.6	5.0e-24
WP_000202128.1|2174117_2174342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776297.1|2174386_2174686_-	HNH endonuclease	NA	A0A0R6PH58	Moraxella_phage	61.2	1.1e-21
WP_001079329.1|2174615_2174909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063945.1|2174914_2175097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433065.1|2175086_2175617_-	hypothetical protein	NA	A0A2H4JB76	uncultured_Caudovirales_phage	44.0	4.4e-37
WP_000693736.1|2175654_2176041_-	hypothetical protein	NA	A0A172Q0N8	Acinetobacter_phage	65.6	3.1e-40
WP_002019135.1|2176143_2176419_-	hypothetical protein	NA	A0A0D4DC07	Acinetobacter_phage	64.0	1.1e-23
WP_000774599.1|2176411_2176585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000572117.1|2176875_2177772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086184.1|2177837_2178332_-	hypothetical protein	NA	A0A0P0I4C3	Acinetobacter_phage	35.5	2.9e-19
WP_000064051.1|2178328_2178610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000801886.1|2178602_2179208_-	hypothetical protein	NA	A0A068CBJ8	Acinetobacter_phage	58.2	5.2e-18
WP_000846972.1|2179204_2179483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000507046.1|2179479_2180811_-	AAA family ATPase	NA	A0A0P0IVX0	Acinetobacter_phage	54.4	1.1e-126
WP_002006015.1|2180810_2181695_-	YdaU family protein	NA	A0A2I7RGZ2	Vibrio_phage	63.4	4.6e-31
WP_001005281.1|2181694_2181991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000576486.1|2182049_2182292_-	hypothetical protein	NA	A0A2H4JCB6	uncultured_Caudovirales_phage	52.6	8.7e-09
WP_002028118.1|2182363_2183056_+	LexA family transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	47.0	1.3e-52
>prophage 4
NZ_CP040425	Acinetobacter baumannii strain PB364 chromosome, complete genome	4014051	2501133	2531992	4014051	transposase,plate	Pandoravirus(25.0%)	28	NA	NA
WP_085940413.1|2501133_2502223_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000342966.1|2502398_2502686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001007559.1|2503112_2503772_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_085916980.1|2504089_2504545_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000204295.1|2504624_2505782_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138067725.1|2505915_2507094_-	cyanate transporter	NA	NA	NA	NA	NA
WP_000646729.1|2507093_2507576_-	nucleoside deaminase	NA	S4VYT2	Pandoravirus	40.6	8.3e-19
WP_085916981.1|2507591_2508239_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000460184.1|2508411_2509263_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000972583.1|2509265_2510219_-	M15 family metallopeptidase	NA	A0A0H4TGB9	Bacillus_phage	33.3	2.8e-10
WP_000046451.1|2510226_2510829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000083625.1|2510841_2511648_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000471445.1|2511665_2513030_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000020713.1|2513046_2514141_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_002001416.1|2514164_2516846_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.8	1.3e-81
WP_000168112.1|2517065_2517329_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_001072410.1|2517345_2518113_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000557241.1|2518115_2519075_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_000556914.1|2519112_2522937_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000591882.1|2522967_2524380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001190395.1|2524376_2525375_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000568832.1|2525338_2527150_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001047031.1|2527166_2527643_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000653195.1|2527722_2528226_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_001066523.1|2528275_2529757_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001119042.1|2529749_2530253_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_138067726.1|2530269_2530917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001988464.1|2530966_2531992_+|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.1	5.7e-25
>prophage 5
NZ_CP040425	Acinetobacter baumannii strain PB364 chromosome, complete genome	4014051	2583992	2646067	4014051	transposase,integrase,tail,terminase,tRNA,head	Bordetella_phage(22.22%)	62	2604988:2605043	2646851:2646906
WP_001988464.1|2583992_2585018_+|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.1	5.7e-25
WP_000972446.1|2585113_2585974_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001290075.1|2586092_2586560_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001083258.1|2586834_2589480_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.9	1.5e-32
WP_049081181.1|2589544_2590075_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000144889.1|2590419_2590743_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_000232555.1|2590923_2591595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001186835.1|2591734_2592403_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	42.5	7.5e-26
WP_001082436.1|2592519_2593362_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	2.6e-36
WP_000132359.1|2593517_2594129_-	chloramphenicol acetyltransferase CAT	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	55.6	1.6e-11
WP_000885988.1|2594121_2594721_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	36.6	5.0e-21
WP_000003555.1|2594813_2596004_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000988402.1|2596000_2598142_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	24.7	2.7e-29
WP_015451474.1|2598138_2599362_-	TolC family protein	NA	NA	NA	NA	NA
WP_001183458.1|2599879_2600626_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	3.1e-20
WP_000554244.1|2600625_2601174_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_000381220.1|2601157_2601706_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000179338.1|2601743_2602283_-	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_001133555.1|2602286_2603264_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	9.5e-38
WP_001182287.1|2603477_2604899_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.6	3.3e-55
2604988:2605043	attL	ATAACCTTGCCAAGGTTGGGGTCGCGAGTTCGAGTCTCGTTTCCCGCTCCAAAATT	NA	NA	NA	NA
WP_001171606.1|2605252_2606266_+|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	40.0	5.0e-66
WP_000807024.1|2606296_2606491_-	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	69.4	2.5e-19
WP_000109879.1|2606627_2607170_-	hypothetical protein	NA	A0A0B5L5G7	Acinetobacter_phage	79.9	1.7e-84
WP_000999573.1|2607180_2607552_-	hypothetical protein	NA	A0A2H4JFC0	uncultured_Caudovirales_phage	65.0	3.3e-39
WP_002056176.1|2607657_2607882_-	hypothetical protein	NA	A0A0P0I8G9	Acinetobacter_phage	93.2	1.5e-31
WP_138067728.1|2607883_2610169_-|tail	phage tail protein	tail	A0A0P0IRG3	Acinetobacter_phage	91.9	0.0e+00
WP_071708556.1|2610417_2611293_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	51.7	2.3e-22
WP_057692734.1|2611583_2611964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057692733.1|2612024_2612552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138067729.1|2612747_2615258_-	hypothetical protein	NA	A0A0F7L5T6	uncultured_marine_virus	24.8	4.0e-56
WP_138067730.1|2615254_2617831_-	transglycosylase family protein	NA	NA	NA	NA	NA
WP_138067731.1|2617837_2620033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138067732.1|2620032_2620662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254054.1|2620658_2621129_-	DUF2833 domain-containing protein	NA	NA	NA	NA	NA
WP_002056120.1|2621125_2623162_-	hypothetical protein	NA	Q775D1	Bordetella_phage	38.2	1.2e-127
WP_002056139.1|2623162_2623717_-	hypothetical protein	NA	W6MVD9	Pseudomonas_phage	26.7	1.7e-07
WP_001283618.1|2623722_2623908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002056150.1|2623922_2624327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142379.1|2624340_2625363_-	hypothetical protein	NA	Q775C7	Bordetella_phage	50.6	1.5e-89
WP_000005810.1|2625374_2626037_-	hypothetical protein	NA	A0A2I7RHR0	Vibrio_phage	39.6	9.4e-13
WP_001281314.1|2626002_2626335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002056130.1|2626331_2628023_-|head,tail	head-tail connector protein	head,tail	G9L6C2	Escherichia_phage	32.6	6.6e-71
WP_000337838.1|2628024_2628279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138067733.1|2628356_2629979_-|terminase	terminase	terminase	Q775B9	Bordetella_phage	61.4	3.4e-189
WP_138067734.1|2629975_2630236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138067735.1|2630605_2631331_-|terminase	terminase small subunit	terminase	I6NV32	Burkholderia_virus	47.1	6.8e-49
WP_138067758.1|2631330_2631540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138067736.1|2631759_2634375_-	PriCT-2 domain-containing protein	NA	Q775B5	Bordetella_phage	55.0	1.0e-280
WP_138067737.1|2634371_2634638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138067738.1|2634639_2635038_-	hypothetical protein	NA	A0A0H3YI19	Pectobacterium_phage	53.8	8.1e-20
WP_138067739.1|2635034_2635286_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	46.3	4.0e-09
WP_138067740.1|2635436_2636102_+	LexA family transcriptional regulator	NA	A0A2H4JAJ5	uncultured_Caudovirales_phage	67.6	2.7e-52
WP_138067741.1|2636245_2636722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138067742.1|2636877_2637987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138067743.1|2637983_2639273_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	44.1	3.6e-93
WP_138067744.1|2639278_2639845_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	63.2	1.7e-63
WP_138067745.1|2640016_2640343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138067746.1|2640378_2641224_+	DUF2303 family protein	NA	A0A2I7RB77	Vibrio_phage	26.5	2.6e-15
WP_138067747.1|2641328_2643404_+	DNA polymerase I	NA	Q775A3	Bordetella_phage	65.7	1.8e-264
WP_138067748.1|2643408_2644233_+	hypothetical protein	NA	A0A2I7RWZ3	Vibrio_phage	51.0	8.8e-69
WP_017725349.1|2644232_2644496_+	VRR-NUC domain-containing protein	NA	Q775A2	Bordetella_phage	70.9	1.3e-26
WP_138067749.1|2644669_2646067_+	DEAD/DEAH box helicase	NA	Q774Z8	Bordetella_phage	69.5	1.9e-193
2646851:2646906	attR	ATAACCTTGCCAAGGTTGGGGTCGCGAGTTCGAGTCTCGTTTCCCGCTCCAAAATT	NA	NA	NA	NA
>prophage 6
NZ_CP040425	Acinetobacter baumannii strain PB364 chromosome, complete genome	4014051	2734532	2793161	4014051	transposase	Escherichia_phage(50.0%)	61	NA	NA
WP_001067855.1|2734532_2735237_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000575345.1|2735839_2736511_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001447719.1|2736507_2737773_-	conjugal transfer protein TraW	NA	NA	NA	NA	NA
WP_001010740.1|2737735_2738266_-	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_000351984.1|2738262_2738580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000637384.1|2738594_2741042_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_001259346.1|2741038_2741746_-	DsbC family protein	NA	NA	NA	NA	NA
WP_000606835.1|2741894_2747381_-	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_000479535.1|2747581_2747974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793435.1|2747977_2748556_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_024131605.1|2748552_2749866_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_000794249.1|2749865_2750783_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_001049717.1|2750766_2751393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000805625.1|2751389_2751671_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_001326174.1|2751815_2752193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001275801.1|2752192_2752336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001231464.1|2752516_2753179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000869297.1|2753178_2753556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169342285.1|2753797_2753974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743449.1|2754021_2754651_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_000332868.1|2754607_2755192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178857.1|2755202_2757068_-	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_001326173.1|2757064_2760037_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_001249395.1|2760204_2760822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001191890.1|2760803_2761037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000366823.1|2761036_2763229_+	DNA topoisomerase 3	NA	A0A1X9I6W8	Streptococcus_phage	29.4	9.9e-43
WP_000467110.1|2763243_2763732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326171.1|2763822_2764122_-	hypothetical protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	3.6e-20
WP_000464630.1|2764333_2764951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268552.1|2765006_2765663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000936897.1|2765662_2767090_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000647188.1|2767093_2767594_-	hypothetical protein	NA	I3UMJ0	Colwellia_phage	38.4	9.5e-18
WP_002210541.1|2767602_2767914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326170.1|2767919_2768351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344149.1|2768418_2769093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342216.1|2769079_2769199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001125904.1|2769341_2769719_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	1.7e-22
WP_000939033.1|2770045_2770189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074431.1|2770280_2770916_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_000703827.1|2770968_2771241_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001207227.1|2771289_2772471_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_001151304.1|2772474_2773260_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_014342215.1|2773287_2773419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338945.1|2773433_2773745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|2774051_2774867_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|2774953_2775256_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|2775149_2775401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|2775431_2776925_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|2777036_2777342_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214119.1|2777369_2778584_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	4.2e-19
WP_064717956.1|2778800_2779538_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|2779562_2780267_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032488579.1|2781095_2781650_+	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_012695455.1|2781877_2782618_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	41.7	4.4e-43
WP_138067759.1|2782604_2784113_-|transposase	IS21-like element ISCfr8 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	32.7	9.9e-26
WP_001067855.1|2784272_2784977_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002904004.1|2785113_2785974_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2785994_2786756_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2787017_2787920_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_001067855.1|2789553_2790258_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_138067751.1|2790269_2793161_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	51.9	1.8e-278
>prophage 7
NZ_CP040425	Acinetobacter baumannii strain PB364 chromosome, complete genome	4014051	2842496	2871170	4014051	terminase,capsid	Acinetobacter_phage(93.55%)	38	NA	NA
WP_001019739.1|2842496_2843042_-	N-acetylmuramidase	NA	A0A0B5L5G7	Acinetobacter_phage	100.0	4.7e-103
WP_000433907.1|2843083_2843473_-	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	3.3e-66
WP_000598554.1|2843540_2846966_-	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	94.2	0.0e+00
WP_000835160.1|2846958_2847321_-	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	8.1e-51
WP_000368388.1|2847317_2847824_-	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	97.0	1.5e-90
WP_000277448.1|2847823_2848222_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	4.1e-72
WP_000721057.1|2848314_2848902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000046573.1|2848992_2853303_-	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	98.3	0.0e+00
WP_001275792.1|2853430_2853694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000721572.1|2853695_2854376_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
WP_000274931.1|2854480_2854939_-	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
WP_000335868.1|2854947_2855247_-	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
WP_001185585.1|2855749_2856265_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
WP_000094278.1|2856334_2857252_-	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	100.0	2.0e-170
WP_000002408.1|2857304_2858483_-	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	66.3	1.2e-103
WP_000064593.1|2858482_2858836_-	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
WP_000749909.1|2858932_2859454_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_001277696.1|2859562_2859781_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
WP_138067752.1|2859782_2860226_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	88.4	2.8e-69
WP_000539749.1|2860182_2860551_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.8	2.0e-52
WP_000248411.1|2860522_2860933_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.3	7.7e-50
WP_000235282.1|2860984_2861278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000540685.1|2861285_2861483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000524257.1|2861551_2861920_-	hypothetical protein	NA	J7I467	Acinetobacter_phage	92.6	8.7e-61
WP_000008459.1|2861920_2862301_-	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.9	6.9e-53
WP_000524488.1|2862304_2862640_-	hypothetical protein	NA	A0A0N7IRE4	Acinetobacter_phage	100.0	2.7e-53
WP_000852265.1|2862684_2863635_-	hypothetical protein	NA	A0A0P0HSG2	Acinetobacter_phage	94.9	3.7e-172
WP_000056390.1|2863648_2864440_-	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	74.2	2.3e-90
WP_000589038.1|2864526_2864841_-	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	50.5	5.2e-14
WP_001291451.1|2864892_2865045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004550.1|2865060_2865291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000146970.1|2865287_2866394_-|capsid	minor capsid protein	capsid	A0A0P0IR98	Acinetobacter_phage	90.2	2.1e-190
WP_000301495.1|2866403_2867744_-	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	92.2	3.4e-235
WP_001132930.1|2867783_2869076_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	86.0	6.4e-215
WP_000729387.1|2869035_2869551_-	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
WP_000435230.1|2869609_2870251_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	88.7	6.3e-115
WP_000378523.1|2870219_2870654_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	84.7	7.4e-67
WP_001136773.1|2870714_2871170_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.4	2.7e-80
>prophage 8
NZ_CP040425	Acinetobacter baumannii strain PB364 chromosome, complete genome	4014051	2875128	2887476	4014051		Acinetobacter_phage(95.65%)	24	NA	NA
WP_001277128.1|2875128_2875605_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
WP_000100162.1|2875601_2876003_-	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	2.6e-66
WP_000462878.1|2876002_2876395_-	hypothetical protein	NA	J7HXM5	Acinetobacter_phage	57.8	1.2e-07
WP_000647826.1|2876387_2876726_-	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	56.3	1.1e-30
WP_001003671.1|2876722_2877523_-	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	95.5	2.8e-144
WP_000064627.1|2877525_2878407_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	95.2	3.3e-138
WP_000602535.1|2878399_2878624_-	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	97.3	3.2e-34
WP_001180660.1|2878695_2878968_-	hypothetical protein	NA	J7I0V3	Acinetobacter_phage	90.0	7.2e-36
WP_000048916.1|2879029_2879350_-	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	1.2e-42
WP_000703023.1|2879360_2879549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000052252.1|2879653_2880406_+	LexA family transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	74.3	5.5e-102
WP_000370485.1|2880420_2880636_+	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
WP_000048052.1|2880687_2881695_+	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
WP_001129676.1|2881696_2882200_+	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
WP_000845537.1|2882338_2882542_+	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
WP_000051960.1|2882548_2882791_-	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	100.0	5.2e-38
WP_001101038.1|2882984_2883428_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	1.7e-71
WP_000656405.1|2883427_2883718_+	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	95.8	5.1e-48
WP_000064463.1|2883710_2884034_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	95.3	4.8e-55
WP_001207474.1|2884045_2885167_+	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	99.5	2.8e-211
WP_000698529.1|2885163_2886096_+	hypothetical protein	NA	A0A0P0I438	Acinetobacter_phage	80.0	2.2e-137
WP_000654846.1|2886097_2886349_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	6.4e-39
WP_000147323.1|2886349_2886757_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
WP_000004579.1|2886753_2887476_+	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	88.2	1.7e-55
>prophage 1
NZ_CP040426	Acinetobacter baumannii strain PB364 plasmid pPB364_1, complete sequence	111449	0	99907	111449	transposase,integrase,portal,holin,tail,terminase	Pseudomonas_phage(32.76%)	110	25334:25355	58804:58825
WP_001017655.1|1023_1431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001054438.1|1642_1987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000126616.1|2035_2974_-	hypothetical protein	NA	A0A2H4P788	Pseudomonas_phage	34.1	4.0e-09
WP_001019943.1|3092_3803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000369228.1|3891_4143_-	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	40.9	3.5e-05
WP_000603289.1|4761_5295_-	3'-5' exonuclease	NA	A0A2H4P776	Pseudomonas_phage	52.3	7.5e-45
WP_000788964.1|5291_5567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000769759.1|5662_6484_-	hypothetical protein	NA	A0A0K2FLL1	Brevibacillus_phage	29.7	2.3e-05
WP_001137420.1|6664_6898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335567.1|6900_7617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557530.1|7769_8108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004716719.1|8113_8572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000128122.1|8561_9053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000736215.1|9135_9987_-	toprim domain-containing protein	NA	G3KB14	Pseudomonas_phage	57.6	3.1e-45
WP_001067855.1|10287_10992_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000052512.1|11441_12917_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|12972_13857_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|13940_14645_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001288662.1|15184_15607_-	hypothetical protein	NA	A0A2H4J8D3	uncultured_Caudovirales_phage	78.8	3.0e-41
WP_000959480.1|15599_15803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070970.1|15792_16029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000994733.1|16025_16334_-	hypothetical protein	NA	A0A068CDI0	Acinetobacter_phage	39.0	3.2e-08
WP_001051922.1|16330_16519_-	hypothetical protein	NA	A0A2I7R1N0	Vibrio_phage	52.5	8.0e-10
WP_000635463.1|16505_16901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001278128.1|17235_17439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000467293.1|17531_18215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000249385.1|18214_18673_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	51.7	4.2e-36
WP_000011675.1|18672_18966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001197364.1|18962_19823_-	FAD-dependent thymidylate synthase	NA	W6ASM9	Erwinia_phage	48.4	6.6e-75
WP_000819780.1|20053_20416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272207.1|20415_20835_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000220364.1|20861_21854_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P762	Pseudomonas_phage	37.7	4.8e-53
WP_000184985.1|21933_24324_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	49.1	1.1e-201
WP_000236061.1|24369_24690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063876.1|24683_25274_-	hypothetical protein	NA	NA	NA	NA	NA
25334:25355	attL	TAGTATAGTCAGTACTGACTGA	NA	NA	NA	NA
WP_000072821.1|25371_25965_-	hypothetical protein	NA	A0A2H4P7J7	Pseudomonas_phage	46.5	1.5e-33
WP_001028833.1|25968_26601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000395295.1|26701_28654_-	AAA family ATPase	NA	L7TNH6	Rhizobium_phage	39.7	1.3e-118
WP_000806093.1|28653_29748_-	metallophosphoesterase	NA	A0A2H4P756	Pseudomonas_phage	38.7	5.2e-69
WP_000604171.1|29809_30208_-	cell wall hydrolase	NA	A0A0U2UVF2	Pseudomonas_phage	33.6	4.2e-08
WP_000470758.1|30207_30456_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001231033.1|30490_30856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875209.1|30852_31371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888911.1|31367_31805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000152774.1|31804_32203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000683860.1|32199_32553_-	hypothetical protein	NA	A0A2H4P744	Pseudomonas_phage	37.9	1.3e-08
WP_000126617.1|32625_34122_-	recombinase	NA	A0A2H4P740	Pseudomonas_phage	29.4	3.0e-51
WP_001120333.1|34132_35197_-	5'-3' exonuclease	NA	J9Q7S6	Salmonella_phage	36.6	7.7e-49
WP_000191696.1|35253_36141_-	hypothetical protein	NA	A0A2H4P7I7	Pseudomonas_phage	40.5	1.1e-40
WP_000211837.1|36291_37398_-	hypothetical protein	NA	A0A2H4P749	Pseudomonas_phage	30.9	7.8e-12
WP_001024529.1|37482_40938_-	DNA polymerase III subunit alpha	NA	L7TNG6	Rhizobium_phage	42.3	2.4e-253
WP_000148616.1|40969_41659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043708.1|41734_42418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000217805.1|42447_43647_-	AAA family ATPase	NA	L7TKP0	Rhizobium_phage	40.5	3.7e-76
WP_001065206.1|43786_45844_-	hypothetical protein	NA	A0A2H4P735	Pseudomonas_phage	44.2	2.8e-71
WP_000219081.1|46003_46204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107553.1|46805_47270_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000124735.1|47634_48222_+|integrase	site-specific integrase	integrase	A0A0A8WF93	Clostridium_phage	29.7	2.3e-07
WP_000587832.1|48423_49101_+	ParA family protein	NA	J9Q7R7	Salmonella_phage	27.7	3.1e-11
WP_001262518.1|49087_49504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000912303.1|49689_50094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000924702.1|50108_50723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000600689.1|50802_51429_-	guanylate kinase	NA	A0A1W6JK60	Lactococcus_phage	44.4	5.7e-12
WP_001226839.1|51441_51831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000212229.1|51836_53240_-	DNA ligase	NA	A0A2H4P729	Pseudomonas_phage	42.1	1.2e-94
WP_000131204.1|53268_53526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065207.1|53546_54146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000620306.1|54228_54651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172785.1|54647_55163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000616020.1|55174_55531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000016624.1|55527_56640_-	toprim domain-containing protein	NA	A0A2H4P738	Pseudomonas_phage	41.7	2.4e-77
WP_000116142.1|56826_58224_-	DNA helicase	NA	A0A2H4P718	Pseudomonas_phage	42.0	1.8e-90
WP_000614153.1|58233_58773_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000553636.1|58841_59582_-	hypothetical protein	NA	L7TM14	Rhizobium_phage	26.7	3.8e-15
58804:58825	attR	TAGTATAGTCAGTACTGACTGA	NA	NA	NA	NA
WP_000095317.1|59697_60546_-	replication initiation protein	NA	A0A218MNI2	uncultured_virus	26.2	9.2e-13
WP_000550436.1|61232_61391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001275665.1|61394_61964_-	TIGR02594 family protein	NA	A0A0B5KZH1	Acinetobacter_phage	100.0	1.3e-111
WP_000131859.1|61963_62281_-|holin	phage holin family protein	holin	I3PUY0	Vibrio_phage	34.1	1.6e-07
WP_000849673.1|62488_62665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002023202.1|62715_62883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260481.1|62964_63522_-	DUF4376 domain-containing protein	NA	A0A172Q083	Acinetobacter_phage	40.4	5.1e-28
WP_000388587.1|63521_75200_-|tail	tail protein	tail	A0A0R6PH26	Moraxella_phage	36.2	1.2e-158
WP_000961493.1|75168_75789_-|tail	tail assembly protein	tail	C7BGD3	Burkholderia_phage	29.6	3.9e-13
WP_000201234.1|75778_76537_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	38.2	5.3e-44
WP_001025264.1|76523_77234_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	52.2	3.1e-70
WP_000911027.1|77242_77572_-|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	35.8	2.2e-15
WP_064891664.1|77608_83353_-	hypothetical protein	NA	G8C7Q6	Escherichia_phage	38.3	1.6e-07
WP_000545978.1|83369_83648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000771526.1|83704_84028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135556.1|84116_84644_-	hypothetical protein	NA	A0A2H4P707	Pseudomonas_phage	55.2	2.5e-48
WP_000473131.1|84713_85214_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_001050804.1|85214_85604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000489606.1|85581_85947_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	35.4	3.5e-09
WP_001032730.1|85933_86410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001028941.1|86409_87183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776798.1|87182_87680_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	27.0	2.9e-06
WP_001130337.1|87802_88705_-	hypothetical protein	NA	A0A2H4P701	Pseudomonas_phage	55.0	1.9e-88
WP_001131898.1|88875_89727_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	32.0	6.4e-30
WP_001049487.1|89776_91477_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	52.4	1.4e-153
WP_000511493.1|91516_92761_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	60.1	1.3e-148
WP_000184659.1|92763_93354_-	winged helix-turn-helix domain-containing protein	NA	J9Q6D4	Salmonella_phage	26.2	6.2e-08
WP_000171118.1|93473_93869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000217790.1|93971_94298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001156156.1|94287_95238_-	hypothetical protein	NA	A0A2H4P6X5	Pseudomonas_phage	44.1	3.5e-61
WP_001135229.1|95281_95635_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000219544.1|95645_96302_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	60.3	1.6e-65
WP_000420163.1|96298_96940_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	42.8	4.3e-31
WP_001005211.1|96947_97469_-	hypothetical protein	NA	A0A2I7QK91	Vibrio_phage	39.4	4.2e-24
WP_001151825.1|97480_98161_-	ParB/RepB/Spo0J family partition protein	NA	L7TL04	Rhizobium_phage	40.5	8.9e-43
WP_000005857.1|98191_99907_+	DEAD/DEAH box helicase	NA	L7TNS5	Rhizobium_phage	45.7	1.5e-123
>prophage 2
NZ_CP040426	Acinetobacter baumannii strain PB364 plasmid pPB364_1, complete sequence	111449	107135	110026	111449		Proteus_phage(50.0%)	6	NA	NA
WP_000128420.1|107135_107354_-	hypothetical protein	NA	A0A1X9Y878	Proteus_phage	64.3	6.0e-17
WP_000020379.1|107350_107692_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_001005259.1|107722_108355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002020805.1|108354_108732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001146604.1|108831_109458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961681.1|109534_110026_-	hypothetical protein	NA	A0A2H4J360	uncultured_Caudovirales_phage	62.0	4.3e-47
