The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040443	Escherichia sp. E4742 chromosome, complete genome	5120753	6032	13766	5120753		Enterobacteria_phage(33.33%)	8	NA	NA
WP_135522030.1|6032_7139_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.6	1.8e-45
WP_135522028.1|7131_7599_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_135522026.1|7585_7996_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_135522024.1|8013_8889_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.6e-107
WP_135522022.1|8947_9847_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	2.6e-29
WP_138158824.1|9846_10932_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	1.7e-99
WP_135522020.1|11303_12197_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	5.1e-46
WP_135522018.1|12371_13766_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.5	6.3e-19
>prophage 2
NZ_CP040443	Escherichia sp. E4742 chromosome, complete genome	5120753	51795	93521	5120753	integrase,head,holin,lysis,tail,protease,terminase	Salmonella_phage(32.35%)	72	86329:86344	98352:98367
WP_135522218.1|51795_52215_-|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	65.8	5.3e-22
WP_135522219.1|52214_53267_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	52.1	9.6e-28
WP_138158826.1|53266_53947_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.3	4.5e-103
WP_033553711.1|53943_55143_-	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	83.6	2.9e-185
WP_001270634.1|55142_55496_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	90.6	3.1e-55
WP_135522220.1|55495_56248_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	65.5	2.9e-87
WP_000466689.1|56307_56547_-	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	47.5	5.6e-08
WP_001214054.1|56600_56942_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	85.7	1.4e-33
WP_135522221.1|56945_58007_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	82.5	2.0e-158
WP_034169225.1|58009_58312_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	92.0	1.7e-49
WP_001349561.1|58311_58899_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	89.1	3.1e-84
WP_135522222.1|58898_60887_-	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	74.5	1.9e-271
WP_042047522.1|61064_61517_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	73.1	2.6e-54
WP_000109249.1|61520_61961_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_032284066.1|61971_63117_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	2.3e-160
WP_000503647.1|63120_63684_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.3e-79
WP_001142480.1|63658_64048_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	2.5e-66
WP_135522223.1|64034_64589_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	72.8	5.0e-68
WP_001125665.1|64585_64993_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	8.7e-70
WP_001107515.1|64958_65180_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	7.7e-12
WP_000627482.1|65221_66163_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	6.3e-156
WP_001066733.1|66174_66681_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.5	9.8e-71
WP_135522224.1|66684_67905_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	89.0	2.0e-202
WP_138159237.1|67919_68654_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	85.6	1.2e-96
WP_044190124.1|68544_70011_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	92.0	7.9e-262
WP_000204763.1|70010_71414_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	3.2e-188
WP_001118115.1|71379_72129_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	75.6	2.6e-11
WP_000113283.1|72186_72372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135522225.1|72515_73163_-	DNA-binding protein	NA	A0A220NRM9	Escherichia_phage	100.0	2.5e-87
WP_135522226.1|73381_73819_-|lysis	lysis protein	lysis	Q9MCN3	Enterobacteria_phage	97.2	1.1e-70
WP_135522227.1|73815_74313_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.4e-90
WP_000839574.1|74312_74528_-|holin	holin	holin	M1FN85	Enterobacteria_phage	100.0	2.4e-34
WP_001235461.1|75076_75700_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_001271134.1|75696_76362_-	serine/threonine protein phosphatase	NA	K7P7K6	Enterobacteria_phage	100.0	5.9e-132
WP_000144614.1|76339_76546_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_089079317.1|76542_77154_-	recombination protein NinG	NA	A0A088CQ20	Enterobacteria_phage	98.0	3.0e-98
WP_000950975.1|77146_77323_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	9.7e-26
WP_094304619.1|77315_77741_-	DUF2591 family protein	NA	A0A088CQ65	Enterobacteria_phage	75.0	4.5e-53
WP_063278236.1|77737_77914_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	98.3	1.9e-26
WP_000814611.1|77910_78321_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_000344554.1|78292_78655_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	67.9	4.4e-33
WP_016042226.1|78672_78879_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	100.0	9.3e-28
WP_135522228.1|78953_80330_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	2.2e-253
WP_135522229.1|80326_81274_-	replication protein	NA	A5VW95	Enterobacteria_phage	98.7	2.1e-154
WP_001244621.1|81276_81549_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_138158828.1|81571_81868_-	hypothetical protein	NA	G9L678	Escherichia_phage	95.9	3.7e-46
WP_001180318.1|81974_82202_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_097310436.1|82280_82988_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	98.7	9.7e-133
WP_138158830.1|83094_83472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135522232.1|83452_83932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045903726.1|84392_84728_+	hypothetical protein	NA	F1C5C1	Cronobacter_phage	68.5	9.2e-33
WP_135522233.1|84738_84981_+	hypothetical protein	NA	U5PUY0	Salmonella_phage	54.5	7.8e-18
WP_135522234.1|85012_85210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135522283.1|85353_85770_+	hypothetical protein	NA	A0A0U2DAF7	Escherichia_phage	65.7	9.9e-53
WP_135522235.1|85853_85994_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	97.8	9.7e-21
WP_000361831.1|85986_86100_+	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	100.0	2.7e-13
WP_000613346.1|86096_86285_+	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_000536247.1|86293_86974_+	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	100.0	4.5e-127
86329:86344	attL	CACCGGAAAATCAACC	NA	NA	NA	NA
WP_001535902.1|86970_87558_+	hypothetical protein	NA	G9L666	Escherichia_phage	99.5	8.4e-106
WP_135522236.1|87581_87878_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	95.9	8.1e-49
WP_001614322.1|87888_88065_+	DUF2737 family protein	NA	K7PL43	Enterobacteria_phage	100.0	3.7e-25
WP_077150696.1|88051_88630_+	HNH endonuclease	NA	K7PHS8	Enterobacteria_phage	99.5	2.5e-110
WP_135522284.1|88673_89153_+	hypothetical protein	NA	G8C7U8	Escherichia_phage	76.9	2.0e-44
WP_135522237.1|89149_89635_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	76.5	5.7e-68
WP_135522238.1|89631_89832_+	hypothetical protein	NA	K7P729	Enterobacteria_phage	71.2	9.3e-17
WP_135522239.1|90163_90361_+	hypothetical protein	NA	A0A0F6R8N3	Escherichia_coli_O157_typing_phage	50.8	1.5e-06
WP_135522240.1|90362_90581_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.3	1.5e-28
WP_138158832.1|90582_91089_+	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	55.0	2.8e-33
WP_135522006.1|91186_91987_+	hypothetical protein	NA	K7P7Q8	Enterobacteria_phage	98.9	5.8e-158
WP_000545725.1|92044_92212_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	4.9e-27
WP_001303849.1|92251_92470_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_135522004.1|92447_93521_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	96.1	1.5e-193
98352:98367	attR	GGTTGATTTTCCGGTG	NA	NA	NA	NA
>prophage 3
NZ_CP040443	Escherichia sp. E4742 chromosome, complete genome	5120753	154219	163667	5120753		Enterobacteria_phage(85.71%)	10	NA	NA
WP_135521942.1|154219_155356_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	5.0e-163
WP_135521940.1|155352_157371_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	91.5	0.0e+00
WP_130207020.1|157477_157939_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	88.9	5.4e-68
WP_130207022.1|157981_158452_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	98.7	3.3e-81
WP_130207024.1|158498_159218_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_135521939.1|159214_160900_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	98.4	2.0e-301
WP_135521937.1|161121_161856_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	96.5	8.6e-108
WP_135521978.1|161931_162024_+	protein YohO	NA	NA	NA	NA	NA
WP_135521935.1|162004_162736_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_135521934.1|162740_163667_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.2e-23
>prophage 4
NZ_CP040443	Escherichia sp. E4742 chromosome, complete genome	5120753	662259	671497	5120753	transposase	Escherichia_phage(14.29%)	9	NA	NA
WP_135521396.1|662259_663468_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	1.2e-207
WP_135521410.1|663475_663907_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	2.8e-42
WP_135521394.1|664009_665344_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_130208077.1|665431_665863_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_135521392.1|666070_666316_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	2.4e-06
WP_135521389.1|666312_666723_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_135521386.1|666695_668840_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	4.9e-196
WP_135521383.1|668978_669938_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	4.1e-134
WP_130221558.1|670294_671497_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 5
NZ_CP040443	Escherichia sp. E4742 chromosome, complete genome	5120753	729548	736687	5120753		Escherichia_phage(66.67%)	6	NA	NA
WP_130221540.1|729548_732110_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_135521297.1|732215_732872_+	protein-serine/threonine phosphatase	NA	Q8HA16	Enterobacteria_phage	44.1	2.8e-49
WP_135521295.1|732921_733689_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	58.8	2.2e-69
WP_135521293.1|733884_734793_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_135521291.1|734789_736052_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.9	8.9e-137
WP_130214473.1|736048_736687_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.5	3.7e-83
>prophage 6
NZ_CP040443	Escherichia sp. E4742 chromosome, complete genome	5120753	1112407	1190317	5120753	plate	Escherichia_phage(33.33%)	59	NA	NA
WP_135523292.1|1112407_1112863_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_135523294.1|1114895_1116179_-	VRR-NUC domain-containing protein	NA	NA	NA	NA	NA
WP_135523295.1|1116178_1118701_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_135523296.1|1118705_1119230_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_135523297.1|1119265_1120354_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_135523298.1|1120317_1122087_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_138158924.1|1122269_1123382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138158926.1|1123410_1125024_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_135523300.1|1125020_1125290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135523301.1|1125292_1128661_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_135523367.1|1128653_1129862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135523302.1|1129864_1130128_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_135523303.1|1130676_1131255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028131558.1|1134055_1134526_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_135523368.1|1134599_1135142_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_135523369.1|1135151_1137497_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_138158929.1|1137571_1138408_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_135523305.1|1138436_1141085_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.7	5.1e-94
WP_001007315.1|1141253_1141745_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_135523306.1|1141750_1143430_-	OmpA family protein	NA	NA	NA	NA	NA
WP_135523307.1|1143429_1144119_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_135523308.1|1144115_1145465_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_135523309.1|1145480_1147025_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_138158931.1|1147046_1147544_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_050583811.1|1147655_1147856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001424022.1|1148049_1148241_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_135523310.1|1148261_1148489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000896657.1|1148836_1149322_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_053289064.1|1149628_1150159_-	OmpH family outer membrane protein	NA	A0A2L1IV11	Escherichia_phage	96.6	1.4e-83
WP_138158933.1|1150206_1158132_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	81.3	0.0e+00
WP_135523370.1|1158162_1158795_-	helix-turn-helix transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	53.8	1.5e-60
WP_135523312.1|1162377_1162749_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_135523313.1|1167058_1167268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000958492.1|1167239_1167473_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_135523314.1|1167541_1168114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135523315.1|1168498_1169230_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_135523371.1|1169538_1169775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135523316.1|1171321_1172125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001601178.1|1172181_1173141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135523317.1|1173254_1174139_+	GTPase	NA	NA	NA	NA	NA
WP_135523318.1|1174257_1174935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278282.1|1174940_1175174_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_135523319.1|1175263_1176082_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	5.7e-44
WP_135523320.1|1176173_1176659_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	7.6e-12
WP_001186745.1|1176674_1177151_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692303.1|1177219_1177441_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_135524060.1|1177459_1178107_+	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	34.6	5.5e-26
WP_135524059.1|1178122_1178491_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001094446.1|1178580_1178958_+	toxin	NA	NA	NA	NA	NA
WP_087891818.1|1179179_1179377_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_135524058.1|1179461_1180307_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000492893.1|1180377_1181913_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_135524057.1|1182174_1183578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135524056.1|1183701_1184151_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_135524055.1|1184143_1184389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135524054.1|1184619_1186215_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_135524053.1|1186574_1189214_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.6	9.3e-96
WP_024558534.1|1189388_1189880_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_135524052.1|1190089_1190317_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 7
NZ_CP040443	Escherichia sp. E4742 chromosome, complete genome	5120753	2450433	2465894	5120753	tail,plate	Burkholderia_phage(43.75%)	21	NA	NA
WP_135523504.1|2450433_2450889_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.0	1.1e-25
WP_135523505.1|2450885_2451491_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_135523506.1|2451495_2453049_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	43.1	4.0e-54
WP_135523507.1|2453051_2453684_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	52.1	8.9e-21
WP_135523508.1|2453676_2454792_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.4	5.9e-100
WP_135523509.1|2454782_2455142_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	4.7e-35
WP_135523510.1|2455240_2455942_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	6.4e-12
WP_135523511.1|2455951_2456992_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.7	2.3e-74
WP_135523512.1|2456979_2457189_-	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	58.8	2.4e-15
WP_135523513.1|2457188_2458142_-	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	3.3e-35
WP_135523514.1|2458141_2460502_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	25.0	1.2e-57
WP_086722008.1|2460603_2460732_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001402753.1|2460691_2461009_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907502.1|2461058_2461583_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
WP_135523515.1|2461582_2463007_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.6	2.2e-192
WP_135523516.1|2462996_2463194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135523517.1|2463190_2463646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777272.1|2463792_2464107_-	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_135523518.1|2464119_2464725_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.7	4.3e-57
WP_001402757.1|2464727_2465015_-	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.6	1.8e-16
WP_135523519.1|2465552_2465894_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	48.1	6.3e-21
>prophage 8
NZ_CP040443	Escherichia sp. E4742 chromosome, complete genome	5120753	3163697	3235167	5120753	protease,tRNA,transposase,plate	Emiliania_huxleyi_virus(10.0%)	57	NA	NA
WP_135523814.1|3163697_3165050_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_130217324.1|3165079_3167512_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758958.1|3167633_3168119_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_064524990.1|3168122_3169148_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3169252_3169708_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565979.1|3169711_3170500_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_130221597.1|3170499_3171648_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_130221596.1|3171644_3172241_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.8	6.0e-27
WP_138159068.1|3172277_3175760_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	8.2e-209
WP_000055741.1|3175772_3176732_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_000644312.1|3176954_3177209_+	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	39.2	1.2e-05
WP_135523815.1|3177373_3177763_+	VOC family protein	NA	NA	NA	NA	NA
WP_135523816.1|3177827_3179123_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|3179175_3179436_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|3179422_3179623_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185282.1|3179788_3180334_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635553.1|3180330_3180753_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_135523817.1|3180766_3181477_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_135523818.1|3181632_3182457_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260707.1|3182509_3184228_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_130205048.1|3184338_3185046_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|3185042_3185447_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|3185564_3186380_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|3186419_3187073_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593990.1|3187065_3188097_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.1	5.5e-36
WP_130260765.1|3188283_3188856_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_135523281.1|3194615_3195419_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	37.0	9.9e-41
WP_135523280.1|3195415_3196330_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_135523279.1|3196570_3197371_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_135523278.1|3197447_3198218_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_032320646.1|3198265_3199624_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_135523277.1|3199695_3200451_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_135409494.1|3200484_3201207_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3201203_3201671_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_138159071.1|3201735_3202470_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.0	1.4e-38
WP_138159073.1|3203004_3203790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135523275.1|3203945_3204413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135523274.1|3204422_3205334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135523273.1|3205377_3205860_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_135523272.1|3205883_3207236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135523283.1|3207246_3210681_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_135523271.1|3210789_3212202_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_135523270.1|3212206_3212950_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_135523269.1|3212946_3215706_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.1	1.4e-81
WP_135523268.1|3215714_3216476_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_135523267.1|3216480_3217812_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_059321172.1|3217814_3218339_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_135523282.1|3218335_3219616_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_135523266.1|3219640_3220723_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_135523265.1|3220686_3222537_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_135486884.1|3222540_3222954_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_135523264.1|3222960_3224427_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_130260453.1|3224736_3225237_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142955.1|3225929_3226448_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_135523263.1|3226657_3228799_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	8.2e-26
WP_138159075.1|3232688_3233381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138159077.1|3234030_3235167_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP040443	Escherichia sp. E4742 chromosome, complete genome	5120753	3934371	3944790	5120753	protease	Vibrio_phage(33.33%)	6	NA	NA
WP_135522928.1|3934371_3936318_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	6.5e-38
WP_064530179.1|3936390_3936615_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	6.8e-16
WP_000520781.1|3936937_3937258_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_135522927.1|3937288_3939565_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.7	1.5e-166
WP_135524103.1|3940576_3941560_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	34.9	1.3e-42
WP_138159138.1|3941556_3944790_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.9	2.6e-63
>prophage 10
NZ_CP040443	Escherichia sp. E4742 chromosome, complete genome	5120753	4044196	4110508	5120753	integrase,capsid,head,holin,tail,protease,portal,terminase	Escherichia_phage(34.69%)	77	4059280:4059339	4105790:4105854
WP_135522886.1|4044196_4045957_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_064528401.1|4046142_4046595_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_064528817.1|4046669_4047722_-	porin OmpA	NA	NA	NA	NA	NA
WP_064528402.1|4048077_4048587_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_135522885.1|4048804_4049434_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_135522884.1|4049396_4051559_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_064528407.1|4051568_4052015_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_135522925.1|4052137_4054192_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	28.6	1.5e-21
WP_064528411.1|4054223_4054682_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_130205387.1|4054777_4055440_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_064528416.1|4055612_4056026_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|4056070_4056388_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_064528417.1|4056445_4057636_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_135522883.1|4057730_4058009_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904443.1|4058005_4058335_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|4058426_4059086_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
4059280:4059339	attL	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAA	NA	NA	NA	NA
WP_001346425.1|4059484_4060504_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	9.8e-86
WP_135522268.1|4060472_4060724_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_135522269.1|4060790_4063268_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	8.5e-59
WP_129541791.1|4063361_4063553_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_135522270.1|4063549_4063738_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_033813301.1|4064192_4064402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135522271.1|4064402_4065041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379554.1|4065182_4065338_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_000444613.1|4065611_4066256_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	25.9	8.8e-08
WP_135522272.1|4066355_4066583_+	cell division protein	NA	NA	NA	NA	NA
WP_135522273.1|4066579_4067005_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_135522274.1|4067028_4067976_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	54.0	1.9e-75
WP_135522275.1|4068016_4068433_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	87.8	2.2e-60
WP_135522276.1|4068429_4069008_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	39.1	1.2e-24
WP_135522277.1|4069105_4069636_+	hypothetical protein	NA	A0A1B0V865	Salmonella_phage	85.4	5.3e-35
WP_135522239.1|4069790_4069988_+	hypothetical protein	NA	A0A0F6R8N3	Escherichia_coli_O157_typing_phage	50.8	1.5e-06
WP_135522240.1|4069989_4070208_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.3	1.5e-28
WP_000813254.1|4071915_4072071_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_135522241.1|4072240_4072519_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_138159152.1|4072520_4073510_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	93.6	4.7e-186
WP_135522242.1|4073522_4073882_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	1.8e-39
WP_135522243.1|4073878_4074568_+	antiterminator	NA	I6PDF8	Cronobacter_phage	47.6	4.2e-56
WP_135522244.1|4075670_4076096_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	87.9	4.5e-61
WP_097292789.1|4076092_4076245_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	70.5	3.6e-05
WP_138159154.1|4076334_4076730_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	49.2	6.4e-25
WP_135522246.1|4076719_4076995_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	50.5	7.6e-17
WP_135522247.1|4076997_4077375_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.8	3.9e-64
WP_135522248.1|4077445_4077727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135522249.1|4077901_4078597_+	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	94.8	1.9e-120
WP_135522250.1|4078829_4079012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000122987.1|4079936_4080182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135522251.1|4080447_4080993_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	3.1e-94
WP_135522252.1|4080967_4082893_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198148.1|4082889_4083096_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	3.8e-29
WP_135522253.1|4083092_4084694_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.2e-310
WP_135522254.1|4084674_4085994_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	5.3e-233
WP_001345004.1|4086003_4086336_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_135522255.1|4086391_4087417_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	3.4e-187
WP_135522256.1|4087458_4087854_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	2.2e-57
WP_135522257.1|4087865_4088219_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	96.6	1.9e-60
WP_135522258.1|4088230_4088809_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	2.1e-77
WP_000683145.1|4088805_4089201_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_001467857.1|4089208_4089949_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	99.2	3.8e-132
WP_021533779.1|4089964_4090387_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	82.1	2.3e-57
WP_001605279.1|4090368_4090803_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	3.8e-63
WP_138159156.1|4090795_4093357_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.6	0.0e+00
WP_061091766.1|4093353_4093683_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	1.4e-57
WP_001152538.1|4093682_4094381_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.1e-131
WP_135522259.1|4094386_4095130_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	1.3e-148
WP_135522260.1|4095066_4095699_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	1.1e-95
WP_135522261.1|4095759_4099173_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.9	0.0e+00
WP_135522262.1|4099242_4099842_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	90.5	4.1e-100
WP_135522263.1|4099906_4102306_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	57.7	2.9e-136
WP_135522264.1|4102302_4102584_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	4.5e-17
WP_135522265.1|4102593_4103634_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.6	4.9e-125
WP_135522266.1|4103678_4105076_+|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	69.7	1.8e-37
WP_135522267.1|4105072_4105678_+|tail	phage tail protein	tail	A0A0M4RTP2	Salmonella_phage	50.0	5.7e-49
WP_135522881.1|4106286_4107405_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
4105790:4105854	attR	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
WP_135522880.1|4107401_4109195_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186409.1|4109213_4109924_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_135522879.1|4109920_4110508_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 11
NZ_CP040443	Escherichia sp. E4742 chromosome, complete genome	5120753	4241265	4296413	5120753	integrase,capsid,head,tRNA,plate,holin,tail,portal,terminase	Enterobacteria_phage(29.17%)	70	4239010:4239025	4261049:4261064
4239010:4239025	attL	ATCCACCGCATCACCG	NA	NA	NA	NA
WP_135522809.1|4241265_4242384_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.7	9.1e-85
WP_000003742.1|4242352_4242622_-	excisionase	NA	NA	NA	NA	NA
WP_135522808.1|4242683_4245155_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	3.0e-56
WP_129541791.1|4245248_4245440_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_135486285.1|4245436_4245625_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_089616200.1|4246182_4246392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135522807.1|4246392_4247031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040090506.1|4247042_4247195_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_135522806.1|4247361_4247769_-	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	53.1	9.8e-13
WP_135522805.1|4247851_4248082_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_135486281.1|4248065_4248587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135522804.1|4248567_4249533_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	1.0e-55
WP_135522803.1|4249573_4249996_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	3.3e-64
WP_135522669.1|4249992_4250256_+	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	48.3	1.6e-16
WP_135522757.1|4250302_4250713_+	hypothetical protein	NA	A0A0H4ISY5	Shigella_phage	91.3	6.3e-68
WP_135522668.1|4250648_4251047_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	1.3e-57
WP_135522667.1|4251097_4251310_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	88.4	2.4e-31
WP_135522666.1|4251588_4251777_+	hypothetical protein	NA	Q286W7	Escherichia_phage	86.7	5.7e-24
WP_135486157.1|4251778_4251997_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.3	3.1e-29
WP_135522665.1|4251998_4252487_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	39.0	7.4e-15
WP_000813255.1|4252778_4252934_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.6e-16
WP_135486275.1|4253271_4253532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135522664.1|4253598_4253877_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	2.5e-12
WP_135522663.1|4253878_4254928_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	9.4e-108
WP_135522662.1|4254940_4255315_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.4e-37
WP_135522661.1|4255311_4256133_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	8.2e-83
WP_135522660.1|4256525_4257110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135522659.1|4257231_4257429_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	98.5	4.7e-29
WP_135522658.1|4257579_4258626_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	92.2	8.0e-192
WP_135486269.1|4259520_4259946_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	85.8	5.0e-60
WP_135522657.1|4259942_4260095_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_135522656.1|4260187_4260577_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	89.0	1.8e-48
WP_135486267.1|4260570_4260846_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	93.4	5.2e-42
WP_135486266.1|4260848_4261226_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.8	3.0e-64
4261049:4261064	attR	CGGTGATGCGGTGGAT	NA	NA	NA	NA
WP_135486342.1|4261392_4261506_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	89.2	4.3e-11
WP_135522655.1|4262463_4263012_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	97.8	3.4e-69
WP_135522654.1|4262983_4264900_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.8	2.3e-253
WP_135522653.1|4264903_4265113_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	47.6	8.9e-10
WP_135522755.1|4265157_4266681_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.4	3.4e-183
WP_135522756.1|4266670_4268287_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.7	3.7e-103
WP_064578930.1|4268326_4268662_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	53.3	3.6e-21
WP_135522652.1|4268731_4269760_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	59.0	9.8e-110
WP_129541813.1|4269810_4270176_+	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_135522754.1|4270178_4270580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135522651.1|4270560_4271283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135522753.1|4271294_4271846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135522650.1|4271829_4272453_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	31.0	2.8e-11
WP_135522649.1|4272486_4272843_+|plate	baseplate assembly protein	plate	V5YTB2	Pseudomonas_phage	47.7	7.2e-20
WP_135486259.1|4272817_4273732_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	43.9	4.0e-62
WP_138159174.1|4273724_4276136_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.2	6.6e-24
WP_129541819.1|4276148_4277537_+|tail	phage tail protein	tail	Q8W613	Enterobacteria_phage	73.3	5.6e-116
WP_135522647.1|4277539_4278085_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	87.7	1.1e-88
WP_135522646.1|4278140_4279616_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	38.5	1.6e-76
WP_000627737.1|4279612_4280131_+|tail	tail protein	tail	NA	NA	NA	NA
WP_135522645.1|4280192_4280495_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_135522644.1|4280612_4282265_+	hypothetical protein	NA	R9TRP8	Vibrio_phage	34.2	5.3e-49
WP_000228001.1|4282267_4282756_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	34.1	1.4e-13
WP_129541824.1|4282730_4282949_+|tail	phage tail protein	tail	R9TR63	Vibrio_phage	53.5	7.6e-12
WP_135522642.1|4282939_4284040_+	late control protein	NA	R9TNM7	Vibrio_phage	30.9	4.2e-34
WP_135522641.1|4284064_4285462_+|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	77.1	9.4e-39
WP_135522640.1|4285458_4286061_+|tail	phage tail protein	tail	A0A0M4RTP2	Salmonella_phage	50.8	3.3e-49
WP_135522639.1|4286256_4287120_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	26.2	2.6e-10
WP_130205581.1|4287103_4288240_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_130205583.1|4288489_4289716_+	peptidase T	NA	NA	NA	NA	NA
WP_130215935.1|4289764_4290886_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_135522638.1|4290961_4292422_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_130205589.1|4292421_4293093_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_135522637.1|4293255_4294626_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|4294629_4295271_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_135522636.1|4295306_4296413_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP040443	Escherichia sp. E4742 chromosome, complete genome	5120753	4478361	4535429	5120753	integrase,tRNA,plate,holin,tail,terminase	Escherichia_phage(76.27%)	70	4473523:4473539	4504077:4504093
4473523:4473539	attL	TTTTTTAATCTGCTGTT	NA	NA	NA	NA
WP_130216110.1|4478361_4479594_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	34.3	1.8e-17
WP_135522678.1|4479850_4480834_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_130216112.1|4481311_4482685_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.7	7.3e-52
WP_135486172.1|4482811_4483747_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.2	1.1e-147
WP_135522677.1|4483798_4485034_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.0	1.2e-239
WP_000079604.1|4485035_4485251_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|4485350_4485539_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001317028.1|4485531_4485726_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_032317649.1|4485782_4486592_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_135522676.1|4486584_4489266_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	70.8	9.6e-282
WP_138159182.1|4489367_4489643_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	93.4	2.2e-40
WP_135522675.1|4489717_4489918_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	90.6	7.4e-22
WP_135522674.1|4489847_4490084_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000440741.1|4490004_4490214_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_001156287.1|4490232_4490505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169149.1|4490928_4491081_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	57.4	2.1e-08
WP_135410071.1|4491091_4491226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003377.1|4491414_4491822_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476989.1|4491899_4492127_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_135522673.1|4492110_4492533_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	96.4	1.4e-70
WP_135522672.1|4492545_4493610_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	91.9	7.9e-187
WP_001602387.1|4493641_4494064_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	94.3	1.0e-73
WP_135522671.1|4494095_4494857_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	83.4	2.3e-108
WP_135522670.1|4494872_4495295_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.5	7.9e-66
WP_135522802.1|4495291_4495549_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	51.8	1.4e-17
WP_135522858.1|4495541_4495853_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	94.1	1.1e-56
WP_138159255.1|4496114_4496507_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	56.5	1.2e-31
WP_135522801.1|4497135_4497564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135522800.1|4497560_4498652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135522799.1|4499002_4499155_+	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_001585645.1|4499508_4499769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138159184.1|4499835_4500435_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	94.5	1.1e-108
WP_000774471.1|4500434_4500725_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	6.3e-46
WP_001602397.1|4500721_4501273_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.5	3.6e-66
WP_135409916.1|4503496_4503886_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	96.9	1.7e-54
WP_089603069.1|4503878_4504157_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	86.8	2.1e-35
4504077:4504093	attR	TTTTTTAATCTGCTGTT	NA	NA	NA	NA
WP_000836756.1|4504158_4504713_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	88.9	1.6e-95
WP_135522798.1|4504901_4505687_+	Heat-labile enterotoxin IIA, A chain	NA	A0A0U2JGJ6	Escherichia_phage	77.2	7.5e-118
WP_001009468.1|4505676_4506045_+	hypothetical protein	NA	A0A0U2QQQ5	Escherichia_phage	63.9	6.7e-37
WP_135522797.1|4506313_4507105_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	41.9	3.0e-50
WP_105290252.1|4507097_4508030_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	53.8	6.0e-82
WP_000126790.1|4508007_4508217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135522796.1|4508220_4509303_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	88.3	2.9e-136
WP_135522795.1|4509292_4510621_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	98.0	3.5e-261
WP_135489339.1|4510637_4512074_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	97.9	2.6e-270
WP_135409939.1|4512132_4512852_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	96.7	9.8e-133
WP_135522794.1|4512832_4514155_+	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	95.9	2.1e-189
WP_135522793.1|4514147_4514765_+	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	96.1	6.7e-114
WP_000780863.1|4515865_4516336_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	99.4	5.5e-84
WP_000175376.1|4516335_4516776_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	99.3	1.2e-77
WP_000762307.1|4516772_4517213_+	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	95.9	5.9e-80
WP_135522792.1|4517199_4518144_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	98.7	1.6e-170
WP_135522791.1|4518143_4519481_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	97.1	1.2e-245
WP_000613368.1|4519504_4519936_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	100.0	3.3e-75
WP_135489333.1|4519932_4520550_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	97.6	4.7e-107
WP_135522790.1|4520613_4522602_+	transglycosylase SLT domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	92.6	0.0e+00
WP_096246994.1|4522605_4523274_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	99.5	1.0e-123
WP_000209262.1|4523270_4523537_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	100.0	9.8e-46
WP_138159186.1|4523536_4524544_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	90.4	4.4e-179
WP_135409929.1|4524543_4525257_+|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	97.0	3.0e-126
WP_135409930.1|4525507_4525855_+	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	98.3	7.5e-62
WP_089540192.1|4526337_4526886_-	hypothetical protein	NA	A0A0U2SH92	Escherichia_phage	98.4	5.8e-101
WP_135522789.1|4526907_4528134_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	98.8	3.4e-226
WP_089603081.1|4528117_4528744_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	98.1	1.4e-119
WP_135522788.1|4528740_4530192_+|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	59.2	1.0e-136
WP_138159188.1|4530194_4530740_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	70.9	4.0e-70
WP_135522787.1|4530762_4532160_+|tail	phage tail protein	tail	Q8W611	Enterobacteria_phage	89.9	1.6e-49
WP_135522786.1|4532156_4532762_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	50.0	9.7e-49
WP_135522785.1|4533736_4534171_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	1.8e-28
WP_130222724.1|4534310_4535429_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.8	2.2e-115
>prophage 13
NZ_CP040443	Escherichia sp. E4742 chromosome, complete genome	5120753	4625061	4658839	5120753	integrase,protease,transposase	Escherichia_phage(28.57%)	24	4627419:4627434	4662648:4662663
WP_135522428.1|4625061_4625985_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_130217559.1|4626052_4628458_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.5	7.1e-10
4627419:4627434	attL	AACGCGCTGGTTACCG	NA	NA	NA	NA
WP_130210475.1|4628482_4629865_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	9.1e-18
WP_135522427.1|4630214_4631534_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_130259039.1|4631664_4633200_-	acid resistance gamma-aminobutyrate antiporter GadC	NA	NA	NA	NA	NA
WP_135495292.1|4633354_4634755_-	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_138159194.1|4635347_4635899_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	50.0	3.7e-47
WP_138159196.1|4635895_4636738_-	helix-turn-helix transcriptional regulator	NA	D0R0F8	Streptococcus_phage	32.6	4.4e-07
WP_135522426.1|4636888_4637551_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	63.8	2.3e-72
WP_135522425.1|4637803_4638175_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_138159198.1|4640520_4641945_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_135522422.1|4643006_4644530_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.5	1.3e-86
WP_054250739.1|4644519_4645785_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_048971609.1|4645806_4649091_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.4	8.1e-65
WP_023285132.1|4649087_4649843_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001088752.1|4650151_4650712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001300511.1|4650808_4651141_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001301005.1|4651124_4651319_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_001214165.1|4651435_4651870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135522420.1|4651869_4654236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135522419.1|4654232_4655783_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001059075.1|4655766_4656642_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_096932232.1|4657158_4657296_+	helicase subunit	NA	NA	NA	NA	NA
WP_135522418.1|4657441_4658839_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
4662648:4662663	attR	CGGTAACCAGCGCGTT	NA	NA	NA	NA
>prophage 14
NZ_CP040443	Escherichia sp. E4742 chromosome, complete genome	5120753	5039748	5047045	5120753	integrase,tail	Escherichia_phage(25.0%)	11	5041139:5041167	5047055:5047083
WP_135522132.1|5039748_5040153_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	48.8	8.8e-30
WP_135522130.1|5040556_5041036_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
5041139:5041167	attL	TACAAAACCTACACCTGCATGGACATCAT	NA	NA	NA	NA
WP_135522128.1|5041572_5042346_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.1	9.2e-36
WP_135522126.1|5042555_5042849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096974178.1|5042859_5043090_-|tail	phage tail protein	tail	A0A1X7QGH6	Escherichia_phage	63.1	9.7e-18
WP_071990834.1|5043226_5043361_+	hypothetical protein	NA	Q71T70	Escherichia_phage	81.8	1.2e-12
WP_135522124.1|5043552_5044254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016248830.1|5044650_5044965_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	89.4	1.5e-45
WP_105224399.1|5045029_5045374_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	96.5	1.3e-58
WP_000005726.1|5045449_5045695_+	excisionase family protein	NA	S4TND0	Salmonella_phage	61.2	2.1e-26
WP_135522122.1|5045740_5047045_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	71.2	5.5e-182
5047055:5047083	attR	TACAAAACCTACACCTGCATGGACATCAT	NA	NA	NA	NA
