The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040458	Salmonella enterica subsp. enterica serovar Typhimurium strain TJWQ005 chromosome, complete genome	4982919	647498	704166	4982919	terminase,holin,plate,capsid,head,integrase,tRNA,portal,tail	Cronobacter_phage(63.41%)	61	662787:662802	695637:695652
WP_000785626.1|647498_647897_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_033567197.1|647899_648205_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000877297.1|648246_648615_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000917516.1|648759_649143_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000422143.1|649146_649809_-	DedA family protein	NA	NA	NA	NA	NA
WP_000235363.1|650258_651503_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_001098833.1|651757_652726_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
WP_000617687.1|652999_653998_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000951049.1|654086_654779_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000202966.1|654930_655428_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000019989.1|655513_656650_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_000121523.1|656730_658749_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_001520281.1|658919_660299_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
WP_000094651.1|660728_662249_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	48.5	6.4e-33
WP_000478472.1|662636_664202_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
662787:662802	attL	ACCACGGTGAAAGCCA	NA	NA	NA	NA
WP_000983441.1|664198_664846_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213760.1|665077_665845_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000627044.1|666102_667884_-	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_001145219.1|667873_668911_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000568372.1|668914_669481_-	PH domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_000514631.1|669497_670079_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_001247711.1|670222_670444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|670474_670978_+	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|670987_671215_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000996837.1|671204_671630_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000022786.1|671629_672031_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000551169.1|672098_672332_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000279404.1|672322_673183_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000170874.1|673179_675201_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_000353141.1|675320_675527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|675500_675824_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038213.1|675820_676882_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001151939.1|676878_678654_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000018800.1|678814_679618_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_000550495.1|679679_680702_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_001218537.1|680705_681407_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_001680743.1|681503_681956_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.6e-64
WP_000084218.1|681952_682459_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000560080.1|682455_683163_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000220203.1|683159_684287_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000166743.1|684283_684739_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|684748_685042_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|685038_685380_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376373.1|685379_685712_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_001670161.1|685683_685872_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	77.4	1.5e-21
WP_000411339.1|685858_686116_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811094.1|686303_688274_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_001002797.1|688270_688600_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136921.1|688596_689781_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001001828.1|689773_690361_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000084307.1|690370_692605_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_000861353.1|692617_693172_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000267957.1|693161_693887_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_000200789.1|693858_694404_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000977530.1|694403_696107_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
695637:695652	attR	ACCACGGTGAAAGCCA	NA	NA	NA	NA
WP_000340945.1|697475_697778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|698101_698608_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|698731_700579_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|700728_702474_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|702709_702925_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264394.1|703152_704166_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
>prophage 2
NZ_CP040458	Salmonella enterica subsp. enterica serovar Typhimurium strain TJWQ005 chromosome, complete genome	4982919	1331240	1406632	4982919	terminase,holin,head,capsid,tRNA,integrase,portal,protease,tail,lysis,transposase	Salmonella_phage(43.1%)	87	1323321:1323337	1412479:1412495
1323321:1323337	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1331240_1332278_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1332393_1333083_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1333401_1333785_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1333846_1334434_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1334536_1335436_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1335453_1336788_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1336918_1337656_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1337640_1339263_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1339526_1339691_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1339687_1340263_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1340294_1340945_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1340944_1341901_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1341897_1342377_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1342874_1344104_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1344081_1344366_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1344406_1344646_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1344688_1345846_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017125.1|1345808_1348736_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001539619.1|1348862_1349213_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1349234_1349393_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001009037.1|1349791_1350196_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000869364.1|1350325_1350562_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001574095.1|1350527_1350902_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1350986_1351970_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1351972_1352722_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|1352732_1353080_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|1353076_1353601_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|1353600_1354074_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_001217666.1|1354938_1355178_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_001804676.1|1355233_1355473_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	5.9e-42
WP_000929803.1|1355512_1356115_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001096550.1|1356323_1356935_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1356931_1357072_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1357068_1357746_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|1358018_1358582_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1359088_1359277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1359491_1360178_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1360453_1360783_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_015701345.1|1360766_1361219_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001533543.1|1361236_1361689_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1361924_1362326_-	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001102153.1|1362612_1363158_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1363129_1365061_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1365044_1365248_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1365244_1366825_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1366814_1368311_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1368323_1368671_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1368725_1369754_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1369811_1370171_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000083294.1|1370181_1370565_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1370592_1371171_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1371219_1372350_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1372458_1372860_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_077248250.1|1372867_1373614_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_000479607.1|1373664_1374060_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1374056_1374395_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372065.1|1374366_1377462_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_000447369.1|1377464_1377794_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1377803_1378502_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1378508_1379246_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1379143_1379791_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1379852_1383215_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1383253_1383496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1383549_1385922_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1385918_1386743_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1386732_1387311_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1387407_1387635_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1387741_1387954_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_001526383.1|1388706_1388826_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1389538_1389676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1390154_1391648_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1392052_1393852_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1393868_1394843_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1395116_1395797_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1395793_1396699_+	GTPase Era	NA	NA	NA	NA	NA
WP_033567169.1|1396710_1397439_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1397450_1398182_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1398181_1398562_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1398673_1398934_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1398971_1399898_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276365.1|1400013_1401210_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684027.1|1401231_1402149_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1402187_1403036_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1403151_1404045_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1404055_1405417_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1405420_1406056_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1406080_1406632_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1412479:1412495	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 3
NZ_CP040458	Salmonella enterica subsp. enterica serovar Typhimurium strain TJWQ005 chromosome, complete genome	4982919	1760783	1790376	4982919	holin,tail,protease	Salmonella_phage(38.46%)	32	NA	NA
WP_000781589.1|1760783_1761278_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1761691_1762183_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1762172_1762436_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1762432_1764919_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1764925_1765621_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1765607_1766477_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1766592_1767042_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1767051_1767654_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1767674_1768292_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	2.2e-11
WP_000990028.1|1768288_1768948_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1768999_1769737_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1769733_1769946_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1769942_1770422_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1770418_1772350_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1772346_1772904_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_033572444.1|1772900_1773944_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1773987_1774635_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1775364_1775928_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1776119_1776323_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1776625_1777417_+|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1777713_1777917_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1778085_1780452_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1780780_1781770_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1781784_1782153_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1782181_1783513_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1783809_1784139_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1784731_1785973_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1785975_1786503_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1786880_1787324_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1787377_1789207_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1789554_1789845_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1789872_1790376_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 4
NZ_CP040458	Salmonella enterica subsp. enterica serovar Typhimurium strain TJWQ005 chromosome, complete genome	4982919	1862428	1871599	4982919	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1862428_1863376_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1863359_1864091_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1864071_1864179_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1864238_1864970_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1865192_1866878_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1866874_1867594_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1867640_1868108_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1868164_1868695_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1868866_1869325_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1869565_1871599_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
NZ_CP040458	Salmonella enterica subsp. enterica serovar Typhimurium strain TJWQ005 chromosome, complete genome	4982919	1939907	1950413	4982919		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1939907_1941311_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1941488_1942382_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1942758_1943844_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1943843_1944743_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1944790_1945669_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1945669_1946221_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1946226_1947219_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1947215_1947989_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1947993_1949073_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1949099_1950413_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP040458	Salmonella enterica subsp. enterica serovar Typhimurium strain TJWQ005 chromosome, complete genome	4982919	2036407	2087094	4982919	terminase,holin,plate,head,capsid,integrase,portal,protease,tail	Salmonella_phage(81.54%)	70	2030985:2030999	2047115:2047129
2030985:2030999	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|2036407_2036881_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_000598920.1|2038190_2038988_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|2039279_2040269_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_001527041.1|2040270_2040498_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_001061334.1|2040537_2041107_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_020899398.1|2041110_2041692_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_000224241.1|2041702_2041960_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_000215886.1|2041961_2042495_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000008351.1|2042565_2043105_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080416.1|2043241_2044069_-	DUF2303 family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000997191.1|2044126_2044498_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_023891434.1|2045037_2045262_+	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_001067432.1|2045224_2045563_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_001020636.1|2045768_2046464_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|2046561_2046786_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|2046814_2047369_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
2047115:2047129	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087404.1|2047365_2048508_+	Rha family phage regulatory protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000620702.1|2048504_2048729_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_033567233.1|2048725_2049700_+	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	100.0	2.3e-169
WP_000054228.1|2049696_2050170_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_033567232.1|2050166_2051042_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	2.7e-169
WP_000779148.1|2051050_2051440_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_001061452.1|2051456_2052317_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	100.0	1.1e-162
WP_070793644.1|2052324_2053314_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	100.0	2.1e-194
WP_020899401.1|2053327_2054080_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_001624505.1|2054230_2054488_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|2054633_2055020_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|2055006_2055288_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|2055287_2055902_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|2055898_2056291_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001379492.1|2056753_2057086_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001135098.1|2057136_2057487_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_000929191.1|2057612_2058107_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_033567282.1|2058103_2059837_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.5	0.0e+00
WP_000605609.1|2059848_2060031_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466255.1|2060030_2061272_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_033567207.1|2061249_2061900_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	97.7	3.1e-117
WP_033572441.1|2061914_2063120_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.0	9.4e-221
WP_033572442.1|2063169_2063370_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	5.8e-27
WP_000927721.1|2063372_2063696_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_033567256.1|2063692_2064097_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.6	3.7e-52
WP_033567257.1|2064068_2064581_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.6	1.6e-81
WP_000779213.1|2064577_2065135_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	93.4	1.1e-96
WP_065305283.1|2065156_2065321_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	94.4	7.1e-23
WP_033567258.1|2065310_2066807_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000515953.1|2066806_2067163_+|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_000588852.1|2067159_2067486_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785381.1|2067570_2069496_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_001033736.1|2069512_2069962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033567259.1|2070021_2071362_+	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.3	9.7e-251
WP_001066632.1|2071358_2072417_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_001273649.1|2072416_2072950_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605055.1|2072954_2073368_+	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_000785581.1|2073360_2074440_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_001207832.1|2074442_2075030_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554735.1|2075016_2076579_+	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
WP_022742744.1|2076548_2077154_+|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000836773.1|2077267_2077501_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_122815478.1|2077575_2077689_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000842532.1|2077736_2078150_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_001093793.1|2078146_2078359_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000500831.1|2079552_2079714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|2079840_2080260_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|2080262_2081531_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|2081985_2082198_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2082208_2082397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|2082657_2083854_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|2084503_2084803_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|2084894_2085590_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|2085663_2087094_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP040458	Salmonella enterica subsp. enterica serovar Typhimurium strain TJWQ005 chromosome, complete genome	4982919	2191138	2197947	4982919	integrase,tail	Salmonella_phage(33.33%)	11	2193348:2193370	2203063:2203085
WP_000856224.1|2191138_2191369_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2191506_2191881_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2191881_2192757_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2192773_2193127_+	YebY family protein	NA	NA	NA	NA	NA
2193348:2193370	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|2193500_2194355_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2194414_2194909_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2195098_2195329_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2195382_2195916_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2196172_2196340_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2196404_2196593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2197065_2197947_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2203063:2203085	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 8
NZ_CP040458	Salmonella enterica subsp. enterica serovar Typhimurium strain TJWQ005 chromosome, complete genome	4982919	2985029	3075946	4982919	terminase,holin,tRNA,protease,tail,lysis	Salmonella_phage(58.7%)	91	NA	NA
WP_000938191.1|2985029_2985710_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2986330_2986990_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2987076_2987406_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2987402_2987684_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2987732_2988512_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000859419.1|2988537_2989086_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2989300_2990512_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2990569_2990887_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2990931_2991345_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2991518_2992181_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2992275_2992734_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2992769_2994824_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2994947_2995394_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2995412_2997566_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2997552_2998158_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2998374_2998884_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2999240_3000293_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|3000364_3000817_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|3001002_3002763_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|3002831_3003350_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|3003449_3003617_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_033567177.1|3003872_3004436_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|3004432_3006073_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|3006077_3007331_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|3007345_3009253_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|3009265_3011374_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|3011472_3012582_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|3012578_3013121_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|3013286_3014297_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|3014504_3017117_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|3017543_3017735_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|3018005_3018692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603423.1|3018676_3018976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|3019044_3019671_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|3020318_3021287_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000143167.1|3021762_3022344_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_031247858.1|3022343_3024782_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000178849.1|3024835_3025078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541993.1|3025116_3025992_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_001576012.1|3028538_3029243_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606351.1|3029140_3029878_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|3029887_3030583_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|3030672_3031206_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|3031322_3031820_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_020899435.1|3031919_3032252_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000867564.1|3033372_3033918_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_024143045.1|3034386_3034833_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000984584.1|3034850_3035303_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_077248428.1|3035286_3035616_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_001141973.1|3035891_3036578_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|3036938_3037388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|3037523_3037649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097242.1|3037843_3038533_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_000801757.1|3038529_3038670_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096542.1|3038666_3039278_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000929788.1|3039486_3040089_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_000763780.1|3040173_3040395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|3040504_3040738_-	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_022630855.1|3041329_3041926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|3041937_3042915_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001536080.1|3042969_3043227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208142.1|3043226_3043871_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_000850457.1|3043874_3044183_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000065109.1|3044186_3044645_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_020899441.1|3044641_3044989_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000800012.1|3044999_3045749_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_000062943.1|3045751_3046735_-	replication protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000426364.1|3046819_3047140_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_001555460.1|3047174_3047402_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000981510.1|3047507_3047942_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_000917559.1|3048238_3048370_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_023139985.1|3048418_3048769_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_020899444.1|3048895_3052096_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	78.8	0.0e+00
WP_014344386.1|3052058_3053216_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|3053258_3053498_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|3053538_3053787_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_020899445.1|3053831_3055124_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000191399.1|3055318_3056521_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|3056598_3058035_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|3058279_3059494_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|3059810_3060272_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|3060472_3061873_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|3062479_3063571_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|3063755_3064946_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|3065007_3065655_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|3065682_3066231_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|3066490_3068332_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572724.1|3068676_3073143_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000060025.1|3073142_3073847_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|3073827_3075150_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|3075142_3075946_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP040458	Salmonella enterica subsp. enterica serovar Typhimurium strain TJWQ005 chromosome, complete genome	4982919	3126009	3134741	4982919	protease,transposase	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3126009_3127264_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3127727_3128186_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3128377_3130654_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3130684_3131005_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3131328_3131550_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3131679_3133626_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3133622_3134741_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 10
NZ_CP040458	Salmonella enterica subsp. enterica serovar Typhimurium strain TJWQ005 chromosome, complete genome	4982919	3753310	3765312	4982919	integrase	Enterobacteria_phage(33.33%)	14	3743878:3743891	3762538:3762551
3743878:3743891	attL	TCTGGAGCGCCGCC	NA	NA	NA	NA
WP_001529722.1|3753310_3755662_-	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	48.5	6.8e-74
WP_001529721.1|3755674_3756277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|3756269_3756491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|3756487_3756751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|3756747_3756942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032150717.1|3756934_3757963_-	ash family protein	NA	Q8W643	Enterobacteria_phage	53.3	1.0e-13
WP_000476150.1|3757956_3758139_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_033567214.1|3758131_3758965_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	9.0e-21
WP_001529719.1|3758977_3759409_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
WP_000035054.1|3759408_3759612_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_001529718.1|3760040_3761255_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
WP_000893231.1|3761611_3762862_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
3762538:3762551	attR	GGCGGCGCTCCAGA	NA	NA	NA	NA
WP_001285275.1|3762873_3763977_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|3764259_3765312_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
>prophage 11
NZ_CP040458	Salmonella enterica subsp. enterica serovar Typhimurium strain TJWQ005 chromosome, complete genome	4982919	4519484	4563348	4982919	terminase,holin,plate,head,capsid,tRNA,integrase,portal,protease,tail	Shigella_phage(43.1%)	63	4521618:4521632	4525024:4525038
WP_000918353.1|4519484_4520900_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
WP_000235551.1|4520964_4521948_+	quinone oxidoreductase	NA	NA	NA	NA	NA
4521618:4521632	attL	GAAAGATACCTGGGA	NA	NA	NA	NA
WP_000891414.1|4522122_4522365_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_022630972.1|4522532_4523570_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332264.1|4523658_4524756_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_033567204.1|4524817_4525066_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	98.8	2.0e-37
4525024:4525038	attR	GAAAGATACCTGGGA	NA	NA	NA	NA
WP_000639149.1|4525209_4525773_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	3.4e-80
WP_006678262.1|4526098_4526827_+	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	100.0	2.8e-143
WP_001747940.1|4526828_4527236_+|tail	tail assembly chaperone	tail	A0A1B0V844	Salmonella_phage	100.0	4.9e-73
WP_006678265.1|4527239_4527857_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	100.0	5.7e-113
WP_023200332.1|4527826_4529359_-	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	97.9	1.6e-241
WP_000383548.1|4529362_4529947_-	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_022630974.1|4529937_4530996_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	5.2e-199
WP_000424732.1|4530982_4531408_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_022630975.1|4531407_4531956_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	1.9e-96
WP_000999499.1|4531955_4533035_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.7	5.3e-207
WP_000219913.1|4533031_4534360_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_001439754.1|4534450_4534963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023200330.1|4535044_4536877_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.2	4.7e-304
WP_000661047.1|4537018_4537288_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|4537287_4537644_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_022630977.1|4537643_4539140_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	99.0	7.7e-273
WP_000497751.1|4539123_4539294_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779279.1|4539302_4539863_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_022630978.1|4539859_4540366_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	5.0e-91
WP_000702388.1|4540340_4540751_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000927719.1|4540747_4541071_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_021577001.1|4541045_4541273_-	hypothetical protein	NA	S5FNU1	Shigella_phage	94.9	2.2e-22
WP_021567480.1|4541322_4542528_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	3.5e-223
WP_021578635.1|4542542_4543193_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.1	3.6e-118
WP_001514795.1|4543170_4544412_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.0e-241
WP_000605606.1|4544411_4544594_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000088161.1|4544605_4546339_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	100.0	0.0e+00
WP_048306293.1|4546352_4546838_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	98.8	6.1e-86
WP_001135098.1|4546963_4547314_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|4547364_4547697_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001530346.1|4548159_4548552_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|4548548_4549163_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|4549162_4549444_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|4549430_4549817_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|4549962_4550220_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_048306282.1|4550370_4551123_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	99.6	9.0e-145
WP_033567167.1|4551136_4552126_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	2.1e-194
WP_001061444.1|4552133_4552943_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001398927.1|4552962_4553352_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	100.0	5.4e-69
WP_000210170.1|4553348_4553675_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001433188.1|4553671_4554325_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_086936917.1|4554324_4554819_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	4.7e-86
WP_000104942.1|4554815_4555757_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_001250269.1|4555746_4555926_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515829.1|4556101_4556659_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_000649477.1|4556702_4556903_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|4556993_4557668_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001369946.1|4557839_4558043_+	ClpX C4-type zinc finger	NA	A0A1C9IHZ4	Salmonella_phage	68.3	8.9e-15
WP_000141753.1|4558244_4558490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001323604.1|4558909_4559290_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	1.3e-62
WP_033567165.1|4559355_4560180_+	DUF2303 family protein	NA	U5P439	Shigella_phage	98.9	1.1e-148
WP_000008210.1|4560307_4560844_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_001565177.1|4560834_4561197_+	phage protein	NA	U5P092	Shigella_phage	97.5	1.5e-65
WP_000206745.1|4561196_4562006_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	61.8	3.3e-76
WP_001061343.1|4562005_4562578_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	96.8	3.7e-106
WP_001093909.1|4562614_4562887_+	pyocin activator PrtN family protein	NA	S5MQM5	Escherichia_phage	86.7	5.9e-38
WP_000549966.1|4562913_4563348_-	type II toxin-antitoxin system YafO family toxin	NA	A0A0S2SYH1	Pseudomonas_phage	51.0	5.2e-36
>prophage 12
NZ_CP040458	Salmonella enterica subsp. enterica serovar Typhimurium strain TJWQ005 chromosome, complete genome	4982919	4589797	4610217	4982919	tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_000615248.1|4589797_4590145_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4590720_4591008_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4591010_4591616_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4591628_4591943_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4592102_4592558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4592554_4592752_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4592741_4594169_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4594168_4594693_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4594744_4595062_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4595021_4595150_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4595246_4597601_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4597600_4598554_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4598553_4598763_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4598750_4599794_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4599803_4600526_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4600853_4601216_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4601212_4602142_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4602141_4603689_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4603852_4604212_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4604202_4605318_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4605310_4605943_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4605945_4607691_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4607695_4608301_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4608297_4608753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4609001_4609292_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4609488_4610217_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP040457	Salmonella enterica subsp. enterica serovar Typhimurium strain TJWQ005 plasmid pTJWQ005, complete sequence	254752	149483	211391	254752	transposase	Salmonella_phage(36.36%)	56	NA	NA
WP_087522250.1|149483_150852_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
WP_000783758.1|150951_151110_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001015182.1|151528_151732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743060.1|151777_152128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138271934.1|152187_152787_-	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	42.6	2.8e-08
WP_000778030.1|152886_153831_-	DUF5417 domain-containing protein	NA	NA	NA	NA	NA
WP_001371930.1|154340_154517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272970.1|154932_156117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000710431.1|156182_156464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000893963.1|156720_156927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000744346.1|157047_157344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000286107.1|157388_157826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000800252.1|157893_158430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000537761.1|158594_158963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000442694.1|159395_159698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032029.1|160054_160339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210769.1|160404_160758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338612.1|161044_161776_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_000952983.1|161777_162959_-	S49 family peptidase	NA	B8QTU8	Erwinia_phage	29.2	3.4e-13
WP_000718549.1|162969_163632_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_046788496.1|163618_164728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046788497.1|164727_166812_-	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_001011151.1|166811_169958_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_000128631.1|169967_170705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071885.1|170701_171187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004209.1|171945_172746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140953.1|172747_173260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196728.1|173853_174900_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001257292.1|174889_176305_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_046788498.1|176313_180267_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001284752.1|180447_181737_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	32.9	5.5e-09
WP_015059500.1|181844_182363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000494967.1|182493_183033_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000720274.1|183180_183930_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_000843244.1|183954_184347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000025803.1|184380_184803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000620990.1|184862_185474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031377.1|185580_186390_+	DsbA family protein	NA	NA	NA	NA	NA
WP_042634445.1|186435_187695_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	44.3	2.6e-96
WP_000111290.1|187678_188113_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	48.8	2.5e-22
WP_001130842.1|188306_188924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770127.1|189073_189430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152919720.1|189680_189851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|189887_190592_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_104690414.1|190926_191319_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_063102497.1|191639_192026_-	bleomycin binding protein	NA	NA	NA	NA	NA
WP_063865358.1|193242_194418_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA2	NA	NA	NA	NA	NA
WP_032495443.1|194441_197594_+	multidrug efflux RND transporter permease subunit OqxB2	NA	NA	NA	NA	NA
WP_000888203.1|197663_198143_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|198234_198939_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000434930.1|199979_200606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013188475.1|201110_201986_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_013362812.1|202020_202989_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001067855.1|204701_205406_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001516695.1|208563_209220_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001493761.1|209999_211391_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP040457	Salmonella enterica subsp. enterica serovar Typhimurium strain TJWQ005 plasmid pTJWQ005, complete sequence	254752	217206	226304	254752	transposase	Escherichia_phage(50.0%)	9	NA	NA
WP_001067855.1|217206_217911_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000612791.1|218044_218908_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_011264039.1|219053_219293_-	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_001067855.1|219354_220059_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|220457_221162_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000147567.1|221590_222151_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_015344976.1|222153_225105_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_046788546.1|225113_225515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|225599_226304_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
