The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040551	Burkholderia pseudomallei strain VB2514 chromosome 1, complete sequence	3116035	922068	999907	3116035	plate,transposase	Ralstonia_phage(25.0%)	48	NA	NA
WP_004539275.1|922068_922797_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	31.2	1.2e-21
WP_151270522.1|923619_925374_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_014696891.1|925450_925696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009978512.1|925720_926056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004553663.1|926225_926591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004540322.1|926558_926864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151270040.1|926864_936233_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_071811406.1|936384_936582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004529300.1|936582_936846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076849159.1|937022_937265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004544773.1|937201_937363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151270041.1|937469_942065_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	38.3	1.1e-27
WP_004549806.1|942051_943320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151270042.1|943335_945540_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.8	8.4e-42
WP_004529305.1|945507_945723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009927037.1|946409_946703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524834.1|947514_947862_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	1.6e-40
WP_151270043.1|947858_948266_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZCV4	Stx2-converting_phage	33.6	1.7e-09
WP_151270044.1|948698_950732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004555376.1|950972_953144_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_151270045.1|953148_954000_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_004544732.1|954000_954954_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004524827.1|954986_956228_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_151270046.1|956263_957508_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.8	7.1e-22
WP_151270047.1|957550_959611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076867276.1|959752_959965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076849987.1|959961_961020_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_004553675.1|962414_963200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009941143.1|963931_964360_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_004557924.1|966542_967109_-	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_076906301.1|972053_973205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151270523.1|973215_973545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122650910.1|974509_975028_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	54.3	1.9e-21
WP_151270048.1|974642_976493_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_151270049.1|976452_977163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151270050.1|977178_979383_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_151270051.1|982058_983492_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004524812.1|983488_985360_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_080003475.1|985364_985913_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004190698.1|985943_986435_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004190849.1|986494_988003_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004524810.1|987995_988574_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190988.1|988636_989716_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004529325.1|992362_992590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151270524.1|992574_993534_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_151270052.1|993539_997169_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004190689.1|997171_998488_-	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_004190585.1|998503_999907_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 2
NZ_CP040551	Burkholderia pseudomallei strain VB2514 chromosome 1, complete sequence	3116035	1836959	1842101	3116035	integrase,transposase	Burkholderia_virus(88.89%)	12	1826730:1826746	1852896:1852912
1826730:1826746	attL	CGCGGCGAGCGCCTGCA	NA	NA	NA	NA
WP_004536695.1|1836959_1837199_-	HNH endonuclease	NA	Q8W6N0	Burkholderia_virus	90.9	8.2e-36
WP_071897994.1|1837109_1837307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004525420.1|1837616_1837901_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	50.0	1.4e-10
WP_004547086.1|1837884_1838106_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_025988352.1|1838725_1839001_+	hypothetical protein	NA	Q6JIH4	Burkholderia_virus	98.9	6.1e-43
WP_009923452.1|1839010_1839142_+	bacteriophage protein Gp48	NA	Q8W6Q2	Burkholderia_virus	97.7	2.6e-15
WP_004557715.1|1839143_1839251_+	hypothetical protein	NA	Q6JIH6	Burkholderia_virus	97.1	8.2e-12
WP_004525418.1|1839277_1839499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057039348.1|1839483_1839750_-	hypothetical protein	NA	Q8W6Q4	Burkholderia_virus	95.2	6.1e-40
WP_076805202.1|1839939_1840638_-	hypothetical protein	NA	Q6JII1	Burkholderia_virus	96.6	1.7e-105
WP_004537646.1|1840779_1840929_+	bacteriophage protein Gp44	NA	Q8W6Q6	Burkholderia_virus	100.0	3.3e-19
WP_151270219.1|1840925_1842101_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JX31	Burkholderia_virus	98.2	5.1e-211
1852896:1852912	attR	CGCGGCGAGCGCCTGCA	NA	NA	NA	NA
>prophage 3
NZ_CP040551	Burkholderia pseudomallei strain VB2514 chromosome 1, complete sequence	3116035	1993824	2065565	3116035	plate,holin	Vibrio_phage(25.0%)	57	NA	NA
WP_004525541.1|1993824_1994592_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_151270251.1|1994630_1995632_-	HpnL family protein	NA	NA	NA	NA	NA
WP_004525542.1|1995628_1996402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009969808.1|1996398_1997094_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_004188420.1|1997458_1998973_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_076903922.1|1998942_1999239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151270252.1|2000682_2001621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151270253.1|2001654_2002203_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004530038.1|2002199_2003711_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004530039.1|2003854_2004382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190879.1|2004461_2004893_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_004196180.1|2004906_2006769_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190851.1|2006765_2007755_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_151270254.1|2007757_2010628_+	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.2	1.8e-60
WP_151270255.1|2010618_2012910_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004535223.1|2013075_2015364_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004547074.1|2015367_2017584_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004547094.1|2017583_2018654_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004525551.1|2018656_2019373_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004190606.1|2019415_2019805_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004202226.1|2019810_2020404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151270256.1|2020400_2021762_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_151270257.1|2021787_2023503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151270258.1|2023499_2027003_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004190863.1|2027061_2027421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151270259.1|2027443_2027866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004530793.1|2028090_2028462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009923697.1|2028559_2028733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151270260.1|2029008_2029908_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_076857594.1|2030005_2030134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011205424.1|2030141_2031461_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_045590599.1|2033258_2034254_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_076847054.1|2034379_2034562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076853379.1|2036437_2036626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186853.1|2036860_2038114_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_076882195.1|2038367_2038670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151270261.1|2038664_2040329_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.6	4.1e-57
WP_151270262.1|2040460_2042026_-	glycoside hydrolase family 68 protein	NA	NA	NA	NA	NA
WP_004530800.1|2042214_2043231_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004523135.1|2043719_2044919_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.2	8.4e-12
WP_004198247.1|2045096_2046122_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_009923708.1|2046280_2046544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186965.1|2046555_2047830_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	6.9e-105
WP_004186989.1|2047902_2048874_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_004186987.1|2049024_2049558_+	4-vinyl reductase	NA	NA	NA	NA	NA
WP_004186960.1|2049618_2051682_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_004186901.1|2051684_2053610_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_151270263.1|2053614_2054787_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_004530055.1|2054783_2055569_+	drug:proton antiporter	NA	NA	NA	NA	NA
WP_004523139.1|2055593_2056862_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004530056.1|2056882_2058028_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004186918.1|2058137_2059001_+	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004186811.1|2059181_2060837_+	APC family permease	NA	NA	NA	NA	NA
WP_004186920.1|2060923_2061799_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_004186868.1|2061942_2062842_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186939.1|2062977_2064531_+|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_151270264.1|2064566_2065565_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 4
NZ_CP040551	Burkholderia pseudomallei strain VB2514 chromosome 1, complete sequence	3116035	2745073	2848659	3116035	protease,plate,holin,tail,portal,capsid	Burkholderia_virus(46.67%)	98	NA	NA
WP_004543470.1|2745073_2745946_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_044353057.1|2746156_2746861_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_004199295.1|2748649_2748808_+	lipoprotein	NA	NA	NA	NA	NA
WP_151270417.1|2748823_2749345_+	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	27.1	6.7e-06
WP_151270418.1|2750220_2751207_+	YceI family protein	NA	NA	NA	NA	NA
WP_028358792.1|2751246_2751606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085503275.1|2751859_2752090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524116.1|2752111_2752621_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_076897512.1|2754355_2756395_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_004542822.1|2756606_2757587_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_080291592.1|2757579_2758497_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004551656.1|2760466_2761516_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004202595.1|2761595_2761808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004543576.1|2762136_2762877_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_038727091.1|2763201_2763453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151270419.1|2763615_2764875_-	monooxygenase	NA	NA	NA	NA	NA
WP_004202588.1|2765092_2766562_-	MFS transporter	NA	NA	NA	NA	NA
WP_151270420.1|2766786_2767143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539128.1|2767064_2767313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004543649.1|2767761_2767962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524130.1|2767954_2768227_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_004184766.1|2768330_2769725_-	heavy metal sensor histidine kinase IrlS	NA	W8CYF6	Bacillus_phage	28.9	1.2e-20
WP_004197868.1|2769721_2770411_-	heavy metal response regulator transcription factor IrlR	NA	W8CYM9	Bacillus_phage	36.8	1.7e-36
WP_151270421.1|2770417_2773651_-	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_151270422.1|2773696_2775163_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004532722.1|2776787_2777072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524134.1|2777470_2777611_-	bacteriophage protein	NA	NA	NA	NA	NA
WP_151270423.1|2778075_2778249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004528293.1|2778236_2778725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197880.1|2779056_2779542_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_009897097.1|2779746_2780085_-	helix-turn-helix domain-containing protein	NA	A4JWW9	Burkholderia_virus	100.0	5.4e-57
WP_009971782.1|2780325_2780478_+	hypothetical protein	NA	R4JMC2	Burkholderia_phage	68.0	1.2e-11
WP_009976613.1|2780465_2781248_+	hypothetical protein	NA	A4JWW8	Burkholderia_virus	99.6	1.5e-142
WP_011205516.1|2781381_2781567_+	hypothetical protein	NA	A4JWW7	Burkholderia_virus	100.0	4.3e-24
WP_009897093.1|2781563_2781785_+	hypothetical protein	NA	A4JWW6	Burkholderia_virus	100.0	1.6e-38
WP_009909345.1|2781788_2782004_+	hypothetical protein	NA	A4JWW5	Burkholderia_virus	98.6	7.9e-30
WP_006027274.1|2782012_2782150_+	hypothetical protein	NA	A4JWW4	Burkholderia_virus	97.8	6.2e-20
WP_023358395.1|2782306_2782525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009976619.1|2782476_2782716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038778439.1|2784203_2785997_+	replication endonuclease	NA	A4JWW0	Burkholderia_virus	99.5	0.0e+00
WP_004532731.1|2786274_2786481_+	bacteriophage-acquired protein	NA	A4JWV8	Burkholderia_virus	100.0	8.7e-34
WP_011205518.1|2786567_2787224_+	AAA family ATPase	NA	A4JWV7	Burkholderia_virus	100.0	3.8e-115
WP_011205519.1|2787424_2787580_+	CopG family transcriptional regulator	NA	A4JWV6	Burkholderia_virus	98.0	1.6e-19
WP_004532793.1|2787682_2788216_+	bacteriophage gp29 protein	NA	A4JWV5	Burkholderia_virus	100.0	8.4e-97
WP_004532838.1|2788212_2788950_+	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	99.6	1.0e-132
WP_011205521.1|2788958_2790080_+	DUF3396 domain-containing protein	NA	A4JWV3	Burkholderia_virus	100.0	4.4e-220
WP_011205522.1|2790644_2790968_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	99.1	1.7e-55
WP_004202809.1|2790970_2791327_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_151270424.1|2791370_2792426_-|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	98.9	1.7e-205
WP_004532870.1|2794334_2795144_+|capsid	GPO family capsid scaffolding protein	capsid	A4JWU8	Burkholderia_virus	100.0	3.2e-148
WP_004531048.1|2795177_2796191_+|capsid	phage major capsid protein, P2 family	capsid	K4NZP8	Burkholderia_phage	100.0	7.2e-190
WP_151270425.1|2797447_2797699_+	hypothetical protein	NA	K4NXI9	Burkholderia_phage	98.8	3.8e-39
WP_004524438.1|2797695_2797902_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	100.0	2.4e-31
WP_004524439.1|2797916_2798261_+	membrane protein	NA	K4NZQ3	Burkholderia_phage	100.0	2.9e-50
WP_004524440.1|2798262_2798535_+|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	100.0	8.8e-42
WP_009941345.1|2798531_2799344_+	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	100.0	1.2e-150
WP_009971799.1|2799340_2799781_+	bacteriophage protein	NA	K4NXJ2	Burkholderia_phage	100.0	3.8e-71
WP_004552557.1|2799758_2799893_+	hypothetical protein	NA	K4PAX1	Burkholderia_phage	100.0	7.4e-18
WP_004531054.1|2799885_2800302_+|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	100.0	3.3e-72
WP_038771442.1|2800298_2800766_+	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	96.1	9.4e-76
WP_076830964.1|2800797_2801193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151270426.1|2801353_2802133_-	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	97.6	2.2e-138
WP_009941342.1|2802306_2802987_+|plate	phage baseplate assembly protein V	plate	A4JWT3	Burkholderia_virus	99.1	1.9e-122
WP_004531058.1|2802983_2803346_+|plate	bacteriophage baseplate assembly protein W	plate	K4PAX6	Burkholderia_phage	100.0	1.7e-61
WP_004531059.1|2803342_2804248_+|plate	bacteriophage baseplate assembly protein J	plate	K4NZR5	Burkholderia_phage	100.0	3.0e-163
WP_004531060.1|2804240_2804795_+|tail	phage tail protein I	tail	K4NXA0	Burkholderia_phage	100.0	2.2e-100
WP_085547614.1|2807903_2809076_+|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	98.7	1.1e-221
WP_085547613.1|2809091_2809601_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	94.7	4.3e-90
WP_004531064.1|2809658_2810003_+|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	100.0	1.0e-55
WP_004552648.1|2810011_2810125_+|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	100.0	5.4e-14
WP_009935906.1|2813103_2813529_+|tail	phage tail protein	tail	A4JWS2	Burkholderia_virus	99.3	3.3e-72
WP_151270427.1|2815447_2816563_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_004536620.1|2816627_2816861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524142.1|2817287_2817617_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_151270566.1|2817630_2818182_-	prop effector	NA	NA	NA	NA	NA
WP_009971811.1|2818192_2818477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151270428.1|2818517_2818697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151270429.1|2818621_2819458_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_151270430.1|2820395_2822243_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_151270431.1|2822246_2825054_+	molecular chaperone DnaK	NA	A0A2H4UU19	Bodo_saltans_virus	26.5	6.0e-08
WP_004557566.1|2825347_2826481_-	CapA family protein	NA	S4VS02	Pandoravirus	56.2	9.5e-114
WP_004528305.1|2827048_2827309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151270432.1|2827591_2827813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024428523.1|2828764_2829388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053566184.1|2832041_2832521_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_011205539.1|2833526_2834336_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024428525.1|2834585_2836016_-	thiamine pyridinylase	NA	NA	NA	NA	NA
WP_004547623.1|2836105_2836906_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_004528317.1|2837129_2837870_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_151270433.1|2837885_2838875_-	thymidylate synthase	NA	NA	NA	NA	NA
WP_004528319.1|2838876_2839332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151270434.1|2839328_2839892_-	NUDIX domain-containing protein	NA	A0A0E3JJF3	Streptomyces_phage	42.1	9.4e-14
WP_050865609.1|2840390_2841185_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_004533011.1|2841241_2842390_+	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_004551671.1|2842585_2843422_-	EamA family transporter	NA	NA	NA	NA	NA
WP_151270435.1|2844120_2845611_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_151270436.1|2845918_2846527_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_151270437.1|2846658_2848659_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	46.0	1.4e-104
>prophage 1
NZ_CP040552	Burkholderia pseudomallei strain VB2514 chromosome 2, complete sequence	3987244	13496	24439	3987244	protease	Agrobacterium_phage(16.67%)	10	NA	NA
WP_004196461.1|13496_15797_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
WP_004194131.1|15793_16108_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196460.1|16640_16844_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_045597308.1|16973_18578_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004189626.1|18590_18773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189552.1|18745_20005_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189780.1|20272_20851_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_071810810.1|21113_21332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185496.1|21523_22033_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_004197486.1|22324_24439_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
>prophage 2
NZ_CP040552	Burkholderia pseudomallei strain VB2514 chromosome 2, complete sequence	3987244	613231	646471	3987244	holin,integrase,transposase	Stx2-converting_phage(33.33%)	28	633445:633462	637922:637939
WP_004543876.1|613231_614341_+	DUF3396 domain-containing protein	NA	A4JWV3	Burkholderia_virus	58.0	1.2e-124
WP_151270706.1|614778_616302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111994465.1|616906_617179_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_076880693.1|617292_617922_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.1	4.9e-27
WP_122835926.1|617929_619492_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.7	2.5e-149
WP_004529308.1|619521_619869_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	73.8	5.6e-41
WP_004555373.1|619865_620273_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	36.5	4.9e-12
WP_151270707.1|620249_621008_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	49.5	3.8e-50
WP_041189647.1|621500_622616_-	5-methylcytosine-specific restriction endonuclease system specificity protein McrC	NA	NA	NA	NA	NA
WP_151270708.1|622618_624454_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	33.8	5.8e-28
WP_080275197.1|624524_625253_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_151270709.1|625249_628336_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.9	6.7e-53
WP_151270710.1|628345_629581_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_151270711.1|629571_631974_-	type I restriction endonuclease subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	36.8	3.6e-70
WP_080275211.1|632520_632763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038745135.1|632945_633140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038745138.1|633340_634159_-	hypothetical protein	NA	NA	NA	NA	NA
633445:633462	attL	CGTCGGCGACGGGATGGG	NA	NA	NA	NA
WP_151270712.1|634155_635439_-|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_009951766.1|635712_636615_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_009962790.1|636901_637120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151270713.1|637607_640337_+	DUF1929 domain-containing protein	NA	NA	NA	NA	NA
637922:637939	attR	CGTCGGCGACGGGATGGG	NA	NA	NA	NA
WP_038719135.1|640364_640958_+	SCO family protein	NA	NA	NA	NA	NA
WP_009972751.1|641333_642167_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004522986.1|642163_642466_-	AzlD family protein	NA	NA	NA	NA	NA
WP_004522987.1|642462_643191_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_004522988.1|643315_643774_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_151270714.1|644011_644308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038765470.1|644353_646471_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
>prophage 3
NZ_CP040552	Burkholderia pseudomallei strain VB2514 chromosome 2, complete sequence	3987244	1062420	1073627	3987244	integrase	Pseudomonas_phage(20.0%)	12	1057966:1058015	1074771:1074820
1057966:1058015	attL	CTGCCCTCCGAAGGCAGGGGTTGCTGGTTCGATCCCAGCCGGGCGCGCCA	NA	NA	NA	NA
WP_011852346.1|1062420_1063347_+	hypothetical protein	NA	A0A077JGB2	Xanthomonas_phage	29.2	1.1e-14
WP_038726517.1|1064702_1064936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038799540.1|1065445_1066225_+	hypothetical protein	NA	A0A1W5LU59	Ralstonia_phage	41.5	2.1e-35
WP_131201518.1|1066324_1067179_+|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	46.4	4.5e-60
WP_131201520.1|1067543_1067876_+	helix-turn-helix domain-containing protein	NA	A0A088CD40	Shigella_phage	52.1	1.6e-16
WP_131201521.1|1068055_1068289_+	hypothetical protein	NA	B3FJW3	Pseudomonas_phage	38.2	2.5e-05
WP_131201532.1|1068778_1069321_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	57.5	2.7e-50
WP_151271493.1|1069578_1070031_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	57.9	6.8e-31
WP_151271492.1|1070030_1071110_+	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	97.2	7.8e-158
WP_131201523.1|1071577_1071811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131201524.1|1071985_1072399_+	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	49.2	1.0e-33
WP_059645399.1|1072403_1073627_+	multidrug DMT transporter	NA	A7XXH6	Thermus_virus	27.1	6.8e-25
1074771:1074820	attR	CTGCCCTCCGAAGGCAGGGGTTGCTGGTTCGATCCCAGCCGGGCGCGCCA	NA	NA	NA	NA
>prophage 4
NZ_CP040552	Burkholderia pseudomallei strain VB2514 chromosome 2, complete sequence	3987244	1316101	1334455	3987244	integrase,protease,plate	Pseudomonas_phage(25.0%)	16	1308704:1308720	1326823:1326839
1308704:1308720	attL	TCGGCGTCGTCGCGCTC	NA	NA	NA	NA
WP_151270840.1|1316101_1316617_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
WP_151270841.1|1316852_1319453_+	type I restriction endonuclease subunit M	NA	A0A142K7G3	Mycobacterium_phage	51.1	7.2e-234
WP_076802946.1|1319462_1319723_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	68.1	2.1e-16
WP_004535005.1|1321258_1322329_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_009932052.1|1322335_1323136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004539222.1|1323569_1323908_+	DUF4102 domain-containing protein	NA	Q8W6M6	Sinorhizobium_phage	49.0	2.4e-17
WP_038776434.1|1324402_1325188_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004521949.1|1325184_1326531_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004521950.1|1326639_1327254_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
1326823:1326839	attR	GAGCGCGACGACGCCGA	NA	NA	NA	NA
WP_045597230.1|1327629_1328295_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004521952.1|1328331_1328850_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004521953.1|1328866_1330357_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004527837.1|1330429_1330933_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011205263.1|1330960_1331473_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011205262.1|1331564_1333391_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009971111.1|1333354_1334455_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 5
NZ_CP040552	Burkholderia pseudomallei strain VB2514 chromosome 2, complete sequence	3987244	1659125	1668382	3987244		Hokovirus(16.67%)	7	NA	NA
WP_004194034.1|1659125_1661078_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_004533593.1|1661344_1662475_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	3.8e-22
WP_151270910.1|1662508_1664527_+	chloride transporter	NA	S4VT78	Pandoravirus	34.2	4.1e-51
WP_004194137.1|1664710_1665526_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_151270911.1|1665590_1666274_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.0e-05
WP_004194373.1|1666270_1666798_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_014917872.1|1666834_1668382_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
>prophage 6
NZ_CP040552	Burkholderia pseudomallei strain VB2514 chromosome 2, complete sequence	3987244	2035811	2044637	3987244		Bacillus_phage(16.67%)	9	NA	NA
WP_076849576.1|2035811_2037212_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	1.4e-79
WP_004522359.1|2037180_2038167_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.8	6.7e-15
WP_004190173.1|2038225_2039218_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004189725.1|2039289_2039607_+	competence protein ComE	NA	NA	NA	NA	NA
WP_004550116.1|2039941_2040844_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	3.3e-53
WP_076884762.1|2041070_2042405_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004522362.1|2042532_2043456_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	2.4e-43
WP_151271005.1|2043531_2043717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063831528.1|2043794_2044637_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.2	7.2e-18
>prophage 7
NZ_CP040552	Burkholderia pseudomallei strain VB2514 chromosome 2, complete sequence	3987244	2120087	2177620	3987244	protease,holin,integrase,tail,terminase	Burkholderia_virus(30.3%)	60	2125508:2125525	2143464:2143481
WP_011325758.1|2120087_2121545_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.7	2.7e-20
WP_004191739.1|2121541_2121796_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_004193305.1|2122036_2123830_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.5	2.1e-22
WP_004193513.1|2123845_2124739_+	signal peptidase I	NA	NA	NA	NA	NA
WP_004544100.1|2124889_2126293_+	ribonuclease III	NA	G8DDA3	Micromonas_pusilla_virus	30.3	4.9e-19
2125508:2125525	attL	GCGGCCGAGCAGGCCGCG	NA	NA	NA	NA
WP_004191678.1|2126362_2127262_+	GTPase Era	NA	NA	NA	NA	NA
WP_151271020.1|2127248_2128109_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_004524619.1|2128105_2128879_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_004191194.1|2128884_2129316_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004539664.1|2129343_2130372_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_004192300.1|2130485_2131883_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004193484.1|2132153_2132711_-	elongation factor P	NA	NA	NA	NA	NA
WP_151271021.1|2132900_2134121_-	elongation factor P maturation arginine rhamnosyltransferase EarP	NA	NA	NA	NA	NA
WP_151271022.1|2134338_2136588_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_004192722.1|2136715_2137309_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_151271023.1|2138073_2139273_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	26.5	3.5e-18
WP_151271024.1|2139642_2139903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151271025.1|2139899_2140304_-	hypothetical protein	NA	X5I2N5	Pseudomonas_phage	67.0	2.1e-31
WP_151271026.1|2140264_2141032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151271027.1|2141028_2141298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151271028.1|2141294_2141480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151271029.1|2141476_2142949_-	pyridoxal phosphate biosynthetic protein PdxJ	NA	A0A2I7QW51	Vibrio_phage	27.4	1.2e-07
WP_151271030.1|2142948_2143395_-	ACP synthase	NA	NA	NA	NA	NA
WP_151271031.1|2143391_2143751_-	beta-hexosaminidase	NA	NA	NA	NA	NA
2143464:2143481	attR	CGCGGCCTGCTCGGCCGC	NA	NA	NA	NA
WP_151271032.1|2144127_2144343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151271033.1|2144908_2145517_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_151271034.1|2145529_2145736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080309578.1|2145882_2146335_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	41.4	1.6e-19
WP_004540057.1|2146343_2146736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151271035.1|2146890_2149629_+	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	43.1	2.5e-91
WP_151271036.1|2149900_2150698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151271037.1|2150916_2151675_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	42.3	2.5e-33
WP_020850831.1|2151856_2152486_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	32.3	1.6e-06
WP_151271038.1|2152424_2154503_+|terminase	phage terminase large subunit family protein	terminase	A0A1B2LRQ2	Wolbachia_phage	34.1	2.0e-101
WP_151271039.1|2154505_2154712_+	hypothetical protein	NA	A0A2H4JA19	uncultured_Caudovirales_phage	46.8	8.5e-05
WP_151271511.1|2156285_2158304_+	peptidase U35	NA	A0A076G7Y9	Pseudoalteromonas_phage	29.3	5.3e-67
WP_004540064.1|2158369_2158705_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_151271040.1|2158707_2159004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539916.1|2159000_2159426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151271512.1|2159474_2160395_+	hypothetical protein	NA	G8CLB2	Synechococcus_phage	36.8	3.6e-47
WP_151271041.1|2160453_2160792_+	hypothetical protein	NA	F4YCS5	Synechococcus_phage	29.1	1.3e-07
WP_151271042.1|2160863_2161169_+	hypothetical protein	NA	A0A0H5ARS5	Pseudomonas_phage	44.3	1.3e-09
WP_151271513.1|2161213_2163994_+|tail	tail tape measure protein	tail	C4ML16	Xanthomonas_virus	26.5	3.7e-18
WP_076847725.1|2163983_2164322_+|tail	phage tail protein	tail	K7PHL4	Enterobacterial_phage	42.3	2.4e-17
WP_151271043.1|2164323_2165727_+|tail	tail fiber domain-containing protein	tail	A4JX12	Burkholderia_virus	77.1	6.9e-199
WP_151271044.1|2165723_2166416_+|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	63.7	1.6e-79
WP_151271045.1|2166420_2167152_+	peptidase P60	NA	Q8W6T2	Burkholderia_virus	50.4	1.3e-63
WP_151271046.1|2167148_2167730_+|tail	tail assembly protein	tail	Q3HQU4	Burkholderia_phage	55.7	1.2e-51
WP_151271047.1|2167726_2171098_+	host specificity protein J	NA	A4JX16	Burkholderia_virus	48.2	1.0e-301
WP_020850420.1|2171097_2171403_+	hypothetical protein	NA	Q8W6S9	Burkholderia_virus	73.5	1.6e-39
WP_151271048.1|2171402_2172140_+	hypothetical protein	NA	Q8W6S8	Burkholderia_virus	66.4	5.2e-97
WP_151271049.1|2172197_2172491_+|holin	holin	holin	C7BGD7	Burkholderia_phage	90.2	4.1e-37
WP_151271050.1|2172483_2172903_+	lysozyme	NA	A0A1Q1PW74	Pseudoalteromonas_phage	43.9	1.1e-22
WP_151271051.1|2172899_2173394_+	DUF2514 family protein	NA	C7BGD9	Burkholderia_phage	58.4	9.1e-37
WP_059670899.1|2173562_2174351_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	90.8	7.2e-145
WP_151271052.1|2174461_2175349_+	hypothetical protein	NA	Q8W6S3	Burkholderia_virus	62.6	2.7e-92
WP_151271053.1|2175401_2175911_-	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	40.4	8.2e-25
WP_151271054.1|2176111_2176768_+	SOS response-associated peptidase	NA	Q8W6R8	Burkholderia_virus	61.1	7.5e-79
WP_059468969.1|2177097_2177340_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_151271055.1|2177326_2177620_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	55.8	1.6e-17
>prophage 8
NZ_CP040552	Burkholderia pseudomallei strain VB2514 chromosome 2, complete sequence	3987244	2548917	2553398	3987244		Burkholderia_virus(57.14%)	9	NA	NA
WP_004196630.1|2548917_2549181_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.5	2.2e-26
WP_071897863.1|2549164_2549350_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.2	4.4e-21
WP_076804729.1|2549370_2549682_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	60.2	4.5e-26
WP_038763587.1|2550102_2550705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080381152.1|2551046_2551553_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.1	5.1e-19
WP_024430357.1|2551549_2551972_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.5	4.9e-15
WP_004557051.1|2552252_2552648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004531416.1|2552901_2553129_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	75.8	3.8e-22
WP_011851785.1|2553164_2553398_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	59.1	2.1e-12
>prophage 9
NZ_CP040552	Burkholderia pseudomallei strain VB2514 chromosome 2, complete sequence	3987244	3762269	3831129	3987244	head,protease,capsid,holin,portal,plate,integrase,tail,transposase,terminase	uncultured_Caudovirales_phage(33.33%)	72	3760068:3760090	3803311:3803333
3760068:3760090	attL	TGCTACAGGGTCGATTTGTAGCA	NA	NA	NA	NA
WP_151271398.1|3762269_3764429_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.1	5.4e-25
WP_151271399.1|3764432_3767192_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.3	5.2e-89
WP_151271400.1|3767535_3768327_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	90.1	2.6e-142
WP_151271401.1|3768607_3769102_-	DUF2514 family protein	NA	C7BGD9	Burkholderia_phage	62.7	4.6e-41
WP_151271402.1|3769098_3769593_-	glycoside hydrolase	NA	Q6J1Q5	Burkholderia_virus	85.4	1.7e-75
WP_048985898.1|3769595_3769880_-|holin	holin	holin	C7BGD7	Burkholderia_phage	93.6	3.8e-40
WP_151271403.1|3769956_3771006_-	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	47.9	9.4e-84
WP_151271404.1|3771015_3771222_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	59.7	5.3e-15
WP_151271405.1|3771196_3772075_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.9	1.8e-35
WP_006497094.1|3774605_3774908_-|tail	phage tail assembly protein	tail	A0A1B2LRV6	Wolbachia_phage	37.7	3.9e-06
WP_006497095.1|3775005_3775509_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	53.1	1.1e-42
WP_151271406.1|3775519_3776689_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	71.3	2.3e-155
WP_006497097.1|3776773_3777553_-|tail	tail assembly chaperone	tail	E5E3Q6	Burkholderia_phage	56.5	7.3e-57
WP_151271407.1|3777568_3779587_-|tail	tail fiber protein	tail	A4JWS9	Burkholderia_virus	48.9	9.9e-106
WP_151271408.1|3779574_3780153_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	44.7	4.3e-30
WP_080330796.1|3780142_3781039_-|plate	baseplate J protein	plate	A0A1J0I2M3	Salmonella_phage	41.1	1.4e-48
WP_006497102.1|3781035_3781371_-	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	48.1	2.5e-22
WP_006497103.1|3781370_3781571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151271409.1|3781629_3782310_-|plate	phage baseplate assembly protein V	plate	E5E3V6	Burkholderia_phage	33.3	9.9e-26
WP_006497106.1|3782313_3782838_-	hypothetical protein	NA	Q75QM3	Wolbachia_phage	42.0	8.4e-25
WP_151271410.1|3782827_3783358_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	31.0	7.0e-11
WP_124649301.1|3783360_3783648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151271411.1|3783649_3784645_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	61.2	5.8e-115
WP_151271412.1|3784718_3785063_-|head	head decoration protein	head	NA	NA	NA	NA
WP_151271413.1|3785093_3786161_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	37.6	8.2e-51
WP_151271414.1|3786157_3787651_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.1	1.3e-134
WP_006497114.1|3787647_3787854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151271415.1|3787867_3789979_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	54.1	2.2e-180
WP_151271416.1|3790564_3790804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151271417.1|3791430_3792018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151271418.1|3792233_3794741_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	40.4	3.7e-94
WP_151271419.1|3795001_3795385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151271420.1|3795371_3795914_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.8	5.8e-29
WP_151271543.1|3795999_3796191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151271544.1|3796241_3796850_+	helix-turn-helix transcriptional regulator	NA	G9L6A6	Escherichia_phage	41.3	7.3e-12
WP_151271421.1|3796794_3797259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151271422.1|3797388_3797607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151271423.1|3797655_3798018_+	beta-hexosaminidase	NA	NA	NA	NA	NA
WP_151271424.1|3798017_3799634_+	pyridoxal phosphate biosynthetic protein PdxJ	NA	NA	NA	NA	NA
WP_151271545.1|3799735_3800092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151271425.1|3800088_3800349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085539461.1|3800345_3800576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151271426.1|3800683_3801733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151271427.1|3801766_3801967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151271428.1|3802160_3803264_-|integrase	site-specific integrase	integrase	A0A2D1GMX8	Marinobacter_phage	31.3	3.5e-44
WP_071897713.1|3803718_3804123_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	48.2	4.5e-10
3803311:3803333	attR	TGCTACAGGGTCGATTTGTAGCA	NA	NA	NA	NA
WP_151271429.1|3804056_3805814_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_151271546.1|3805838_3806045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151271430.1|3806075_3806366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193468.1|3817353_3817830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076804738.1|3817765_3817945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151271431.1|3817928_3818270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200110.1|3818286_3818511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044355960.1|3818759_3819896_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_004522511.1|3819993_3820533_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_004192840.1|3820705_3821086_+	lipoprotein	NA	NA	NA	NA	NA
WP_009982345.1|3821298_3821541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076811751.1|3821692_3822103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192184.1|3822119_3822500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102811502.1|3822699_3822924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200095.1|3822962_3823148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004266384.1|3823073_3823586_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_004534176.1|3823709_3825083_+	MFS transporter	NA	NA	NA	NA	NA
WP_004550754.1|3825225_3825483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191641.1|3825852_3826464_+	membrane protein	NA	NA	NA	NA	NA
WP_004534082.1|3826636_3827239_-	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	62.8	3.3e-25
WP_004192381.1|3827231_3828650_-	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_151271432.1|3828782_3828980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151271433.1|3829268_3829820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151271434.1|3829816_3830320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151271435.1|3830376_3830538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137985156.1|3830799_3831129_-|transposase	transposase	transposase	NA	NA	NA	NA
