The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040562	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7399 chromosome, complete genome	4902004	1133968	1230275	4902004	portal,transposase,head,terminase,integrase,tRNA,capsid,plate,lysis,tail	Salmonella_phage(84.31%)	89	1167808:1167854	1201225:1201271
WP_085983317.1|1133968_1135131_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
WP_000073810.1|1135409_1137392_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000061088.1|1137388_1138027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682341.1|1139740_1140337_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	91.3	2.6e-99
WP_010989066.1|1140914_1142198_+	membrane protein	NA	NA	NA	NA	NA
WP_001521074.1|1142457_1144332_-	membrane protein	NA	NA	NA	NA	NA
WP_000088556.1|1144497_1145373_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_000021514.1|1146489_1148169_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000819716.1|1148391_1149933_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000811366.1|1150062_1150905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682344.1|1150904_1151468_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000776032.1|1151491_1152127_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_000889012.1|1152200_1153403_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001033832.1|1153697_1154711_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_001098984.1|1154721_1155702_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000973738.1|1155698_1156073_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000480483.1|1156069_1156591_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000749979.1|1156703_1156988_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_010989065.1|1157082_1157439_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989064.1|1157592_1158411_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_001520831.1|1158455_1159739_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001520307.1|1160241_1162311_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_000701821.1|1162346_1162562_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001161781.1|1163012_1163840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|1164174_1165368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989063.1|1165757_1166351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542209.1|1166397_1166565_-	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
WP_001542208.1|1166578_1167643_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
1167808:1167854	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001536726.1|1167971_1168997_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
WP_000616878.1|1169000_1169633_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	100.0	1.1e-116
WP_000102102.1|1169752_1169995_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	100.0	1.1e-38
WP_000460861.1|1170027_1170537_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	99.4	3.6e-89
WP_000956166.1|1170544_1170745_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	98.5	1.2e-32
WP_000963480.1|1170708_1171050_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	100.0	2.1e-56
WP_001244238.1|1171117_1171351_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	98.7	2.9e-33
WP_000785513.1|1171350_1171578_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	3.0e-35
WP_138628077.1|1171574_1172159_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.2	1.7e-74
WP_000104131.1|1172155_1173016_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	4.5e-132
WP_000301197.1|1173006_1175436_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	91.1	0.0e+00
WP_001154433.1|1175588_1175777_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_010989062.1|1175715_1176021_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001673609.1|1176134_1176812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284992.1|1177125_1178790_+	AIPR family protein	NA	E5G6M2	Salmonella_phage	99.8	0.0e+00
WP_001542203.1|1178893_1179934_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001098395.1|1179933_1181700_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_000216276.1|1181842_1182676_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_000730759.1|1182692_1183754_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
WP_000059173.1|1183757_1184408_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000673536.1|1184501_1184966_+|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	99.4	3.8e-85
WP_000868184.1|1184965_1185169_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1185172_1185388_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069921.1|1185368_1185884_+	lysozyme	NA	E5G6N1	Salmonella_phage	99.4	1.2e-95
WP_000196199.1|1185880_1186309_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_072100776.1|1186238_1186442_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	92.5	8.3e-29
WP_001039958.1|1186404_1186836_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000343949.1|1186828_1187275_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_000958562.1|1187276_1188128_-	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_001672413.1|1188205_1188784_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000189373.1|1188780_1189140_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_000268332.1|1189126_1190035_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_001086801.1|1190027_1190633_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	99.5	1.1e-116
WP_001274645.1|1190629_1192483_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	99.8	0.0e+00
WP_000143187.1|1192482_1193058_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_000974843.1|1193927_1194152_+	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000046108.1|1194254_1195427_+|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
WP_001207651.1|1195436_1195952_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_001280964.1|1196006_1196309_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	99.0	1.6e-44
WP_000763316.1|1196323_1196443_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001282770.1|1196435_1199243_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.8	0.0e+00
WP_000980411.1|1199239_1199725_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
WP_001102269.1|1199721_1200822_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980500.1|1200890_1201109_+	hypothetical protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_010989057.1|1201660_1202824_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1201225:1201271	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000196159.1|1202831_1205012_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533858.1|1205008_1206418_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001518569.1|1218569_1219052_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1219201_1219678_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1219667_1219958_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1220123_1220462_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1220610_1222272_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1222357_1223236_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1223358_1223949_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287923.1|1223983_1224589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1224709_1225996_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1226015_1226807_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1226972_1228334_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1228647_1228896_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1228914_1229463_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|1229507_1230275_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP040562	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7399 chromosome, complete genome	4902004	1257085	1340198	4902004	portal,transposase,head,integrase,tRNA,holin,terminase,capsid,lysis,tail,protease	Salmonella_phage(37.29%)	97	1249166:1249182	1340373:1340389
1249166:1249182	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1257085_1258123_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1258238_1258928_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1259246_1259630_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1259691_1260279_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1260381_1261281_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1261298_1262633_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1262763_1263501_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989191.1|1263485_1265108_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001521719.1|1265192_1265372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014344135.1|1265371_1265536_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1265532_1266108_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1266139_1266790_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1266789_1267746_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1267742_1268222_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1268719_1269949_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1269926_1270211_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1270251_1270491_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1270533_1271691_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017125.1|1271653_1274581_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001539619.1|1274707_1275058_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1275079_1275238_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_000950426.1|1275694_1276357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356948.1|1276356_1276743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111772.1|1276735_1277575_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000660736.1|1277633_1278029_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_000643689.1|1278128_1278371_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_010835408.1|1278330_1278705_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000024044.1|1278796_1279681_+	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_000801764.1|1279677_1280373_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000664368.1|1280386_1281085_+	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000877757.1|1281192_1281825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1282067_1282301_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1282417_1282666_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929791.1|1282700_1283303_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001241017.1|1283302_1283509_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
WP_001096550.1|1283511_1284123_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1284119_1284260_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1284256_1284934_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_072095218.1|1284930_1285116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|1285206_1285770_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1286276_1286465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1286679_1287366_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1287641_1287971_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|1287954_1288407_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|1288424_1288877_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1289112_1289514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1289800_1290346_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1290317_1292249_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1292232_1292436_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1292432_1294013_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1294002_1295499_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1295511_1295859_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1295913_1296942_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1296999_1297359_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1297369_1297753_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1297780_1298359_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1298407_1299538_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1299646_1300048_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1300055_1300802_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1300852_1301248_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1301244_1301583_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|1301554_1304650_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|1304652_1304982_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1304991_1305690_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1305696_1306434_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1306331_1306979_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1307040_1310403_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1310441_1310684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1310737_1313110_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1313106_1313931_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1313920_1314499_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1314595_1314823_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1314929_1315142_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_015701342.1|1315204_1315270_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_015589559.1|1315849_1316014_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1316726_1316864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1317336_1318830_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1319234_1321034_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1321050_1322025_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1322298_1322979_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1322975_1323881_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1323892_1324621_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1324632_1325364_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1325363_1325744_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1325855_1326116_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1326153_1327080_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276365.1|1327195_1328392_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684022.1|1328413_1329331_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1329369_1330218_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1330333_1331227_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1331237_1332599_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1332602_1333238_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1333262_1333814_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000734248.1|1333864_1335409_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001747289.1|1335409_1335643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000970045.1|1335664_1339552_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_000502119.1|1339739_1340198_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
1340373:1340389	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 3
NZ_CP040562	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7399 chromosome, complete genome	4902004	1688648	1718232	4902004	tail,protease,holin	Salmonella_phage(38.46%)	32	NA	NA
WP_000781589.1|1688648_1689143_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1689556_1690048_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1690037_1690301_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1690297_1692784_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1692790_1693486_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1693472_1694342_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1694457_1694907_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1694916_1695519_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1695539_1696157_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	2.2e-11
WP_000990028.1|1696153_1696813_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1696864_1697602_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1697598_1697811_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1697807_1698287_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1698283_1700215_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1700211_1700769_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001238333.1|1700765_1701809_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1701852_1702500_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1703229_1703793_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1703984_1704188_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1704490_1705282_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1705578_1705782_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1705950_1708317_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1708645_1709635_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1709649_1710018_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1710046_1711378_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1711674_1712004_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1712596_1713838_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1713840_1714368_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1714745_1715189_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1715242_1717072_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1717410_1717701_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1717728_1718232_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 4
NZ_CP040562	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7399 chromosome, complete genome	4902004	1790282	1799453	4902004	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1790282_1791230_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1791213_1791945_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1791925_1792033_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1792092_1792824_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1793046_1794732_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1794728_1795448_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1795494_1795962_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1796018_1796549_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1796720_1797179_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1797419_1799453_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
NZ_CP040562	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7399 chromosome, complete genome	4902004	1867761	1878267	4902004		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1867761_1869165_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1869342_1870236_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1870612_1871698_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1871697_1872597_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1872644_1873523_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1873523_1874075_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1874080_1875073_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1875069_1875843_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1875847_1876927_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1876953_1878267_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP040562	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7399 chromosome, complete genome	4902004	1964261	2011087	4902004	portal,head,terminase,integrase,holin,capsid,plate,tail,protease	Salmonella_phage(86.15%)	69	1958839:1958853	1974969:1974983
1958839:1958853	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|1964261_1964735_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001738920.1|1965382_1965673_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_000598920.1|1966044_1966842_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|1967133_1968123_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|1968124_1968367_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_001061334.1|1968391_1968961_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_020899398.1|1968964_1969546_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_000224241.1|1969556_1969814_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_000215886.1|1969815_1970349_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000008351.1|1970419_1970959_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080416.1|1971095_1971923_-	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000997191.1|1971980_1972352_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_023891434.1|1972891_1973116_+	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_001067432.1|1973078_1973417_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_001020636.1|1973622_1974318_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_071529734.1|1974291_1974477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001191666.1|1974415_1974640_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|1974668_1975223_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
1974969:1974983	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087402.1|1975219_1976377_+	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000620702.1|1976373_1976598_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000061500.1|1976594_1977413_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_001684745.1|1977414_1977897_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000066908.1|1977896_1978790_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001241579.1|1978786_1979176_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_020899399.1|1979192_1980053_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	8.4e-163
WP_020899400.1|1980060_1981050_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	99.1	4.0e-193
WP_020899401.1|1981063_1981816_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_001624505.1|1981966_1982224_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|1982369_1982756_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|1982742_1983024_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|1983023_1983638_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|1983634_1984027_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_097053918.1|1983911_1984190_+	peptidase	NA	Q8SBD8	Shigella_phage	74.4	1.3e-24
WP_001379492.1|1984489_1984822_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001135098.1|1984872_1985223_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_000929171.1|1985348_1985843_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	100.0	1.7e-88
WP_000088175.1|1985839_1987573_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
WP_000605609.1|1987584_1987767_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_020899404.1|1987766_1989008_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.3	2.9e-241
WP_001193639.1|1988985_1989636_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000257526.1|1989650_1990856_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	100.0	7.0e-224
WP_000601352.1|1990906_1991107_+	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
WP_000927378.1|1991109_1991433_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000702410.1|1991429_1991834_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
WP_001135699.1|1991805_1992318_+	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	100.0	3.5e-92
WP_000779216.1|1992314_1992875_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	100.0	8.0e-106
WP_000497740.1|1992878_1993043_+	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	100.0	1.3e-24
WP_001007996.1|1993032_1994529_+|tail	tail sheath protein	tail	A0A192Y7L1	Salmonella_phage	100.0	2.1e-278
WP_000515952.1|1994528_1994885_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588854.1|1994881_1995208_+|tail	phage tail assembly protein	tail	A0A192Y6C5	Salmonella_phage	100.0	1.3e-52
WP_000785390.1|1995292_1997221_+|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	100.0	0.0e+00
WP_000863827.1|1997254_1998595_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	100.0	5.2e-252
WP_001066630.1|1998591_1999650_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_001273648.1|1999649_2000183_+|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_000605051.1|2000187_2000601_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_000785578.1|2000593_2001673_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_001207832.1|2001675_2002263_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_020899405.1|2002249_2003812_+	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	100.0	1.0e-288
WP_022742744.1|2003781_2004387_+|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000836773.1|2004500_2004734_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_122815478.1|2004808_2004922_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000842532.1|2004969_2005383_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_001093793.1|2005379_2005592_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000500831.1|2006785_2006947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|2007073_2007493_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|2007495_2008764_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|2009218_2009431_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2009441_2009630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|2009890_2011087_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
>prophage 7
NZ_CP040562	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7399 chromosome, complete genome	4902004	2118371	2125180	4902004	tail,integrase	Salmonella_phage(33.33%)	11	2120581:2120603	2130296:2130318
WP_000856224.1|2118371_2118602_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2118739_2119114_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2119114_2119990_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2120006_2120360_+	YebY family protein	NA	NA	NA	NA	NA
2120581:2120603	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|2120733_2121588_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2121647_2122142_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2122331_2122562_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2122615_2123149_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2123405_2123573_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2123637_2123826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2124298_2125180_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2130296:2130318	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 8
NZ_CP040562	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7399 chromosome, complete genome	4902004	2913146	2997881	4902004	portal,terminase,holin,integrase,tRNA,lysis,tail,protease	Salmonella_phage(44.64%)	95	2937240:2937259	3009027:3009046
WP_000938191.1|2913146_2913827_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2914447_2915107_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2915193_2915523_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2915519_2915801_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2915849_2916629_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2916654_2917203_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2917417_2918629_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2918686_2919004_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2919048_2919465_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2919635_2920298_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2920392_2920851_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2920886_2922941_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2923064_2923511_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2923529_2925683_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2925669_2926275_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2926491_2927001_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2927357_2928410_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2928481_2928934_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2929119_2930880_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2930948_2931467_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2931566_2931734_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2931989_2932553_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2932549_2934190_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2934194_2935448_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2935462_2937370_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2937240:2937259	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2937382_2939491_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2939589_2940699_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2940695_2941238_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2941403_2942414_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2942621_2945234_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2945660_2945852_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2946122_2946809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|2946793_2947093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2947161_2947788_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001533476.1|2948435_2949404_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000143167.1|2949879_2950461_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001144679.1|2950460_2952899_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000178849.1|2952952_2953195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031615525.1|2953233_2954157_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	76.9	5.6e-56
WP_001541992.1|2954135_2956583_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	68.0	0.0e+00
WP_000246065.1|2956654_2957359_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2957256_2957994_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2958003_2958699_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2958788_2959322_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2959438_2959936_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|2960034_2960367_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_077905305.1|2960363_2963351_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	4.8e-266
WP_010989009.1|2963430_2963760_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|2963756_2964155_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|2964200_2964950_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|2964961_2965363_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|2965359_2965926_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|2965906_2966206_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2966198_2966522_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|2966612_2968694_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_077679777.1|2968617_2970135_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_000196190.1|2970161_2970368_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|2970364_2972503_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|2972459_2972993_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|2973200_2973680_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2973697_2974150_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2974133_2974463_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|2974738_2975425_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2975785_2976235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2976370_2976496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|2976669_2976987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|2977053_2977851_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|2977840_2977987_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|2977983_2978595_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001241019.1|2978597_2978804_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_000929805.1|2978803_2979406_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|2979488_2979710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2979821_2980055_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|2980346_2980637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2980714_2981026_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|2981022_2981370_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|2981380_2982130_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|2982132_2983116_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2983200_2983575_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2983540_2983780_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2983899_2984310_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_077905303.1|2984359_2984620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|2984612_2984771_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|2984792_2985092_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000017133.1|2985218_2988104_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001539618.1|2988066_2989224_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2989266_2989506_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2989546_2989795_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|2989839_2991132_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|2991326_2992529_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|2992606_2994043_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|2994287_2995502_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000301921.1|2995588_2995822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762342.1|2995818_2996280_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2996480_2997881_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
3009027:3009046	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 9
NZ_CP040562	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7399 chromosome, complete genome	4902004	3062017	3070749	4902004	transposase,protease	Enterobacteria_phage(16.67%)	8	NA	NA
WP_085983316.1|3062017_3063272_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_119920232.1|3063287_3063563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|3063735_3064194_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000934063.1|3064385_3066662_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3066692_3067013_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3067336_3067558_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3067687_3069634_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3069630_3070749_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 10
NZ_CP040562	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7399 chromosome, complete genome	4902004	3195420	3236604	4902004	portal,coat,terminase,integrase,lysis,protease	Salmonella_phage(53.85%)	66	3194966:3194988	3236670:3236692
3194966:3194988	attL	CGTTCAACTTAGTATAAAAAAGC	NA	NA	NA	NA
WP_000915523.1|3195420_3195783_+	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
WP_039513020.1|3195779_3196712_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	99.0	1.8e-174
WP_023220032.1|3196701_3198159_+	glucosyl transferase	NA	A0A192Y7W8	Salmonella_phage	99.2	1.9e-239
WP_021293883.1|3198217_3200221_-	endorhamnosidase	NA	A0A192Y6X2	Salmonella_phage	99.4	0.0e+00
WP_000532174.1|3200356_3200608_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	98.8	4.1e-38
WP_000821346.1|3200624_3201044_-	hypothetical protein	NA	B9UDL3	Salmonella_phage	100.0	1.3e-73
WP_021293882.1|3201161_3201491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031623904.1|3201510_3203352_-	hypothetical protein	NA	A0A192Y934	Salmonella_phage	77.8	6.2e-256
WP_031623903.1|3203351_3204668_-	DNA transfer protein	NA	B9UDL0	Salmonella_phage	95.9	6.4e-231
WP_021293881.1|3204710_3205400_-	hypothetical protein	NA	B9UDK9	Salmonella_phage	84.7	1.4e-88
WP_000627697.1|3205402_3205858_-	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
WP_000774927.1|3205857_3206559_-	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_001122424.1|3206562_3207981_-	Packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_001166098.1|3207940_3208441_-	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_021293880.1|3208424_3208634_-	hypothetical protein	NA	A0A192Y697	Salmonella_phage	98.6	6.3e-32
WP_001196937.1|3208672_3209965_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_006831698.1|3209964_3210876_-	scaffolding protein	NA	Q5C834	Enterobacteria_phage	100.0	1.7e-161
WP_000774652.1|3210889_3213067_-|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
WP_000417860.1|3213066_3214566_-|terminase	terminase	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
WP_000729923.1|3214543_3215032_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3215035_3215440_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3215439_3215829_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3215832_3216075_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_015995148.1|3216297_3216828_-	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	100.0	1.3e-94
WP_071533034.1|3216781_3217006_-	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	88.7	3.6e-25
WP_001687043.1|3217040_3217508_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|3217504_3218002_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|3217979_3218183_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_071533031.1|3218267_3218501_-	hypothetical protein	NA	M1E3N9	Enterobacteria_phage	87.0	1.1e-21
WP_001047566.1|3218613_3219387_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000219133.1|3219383_3219563_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_000149882.1|3219543_3219747_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000036320.1|3219743_3219968_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_001107939.1|3219964_3220570_-	recombination protein NinG	NA	E7C9S3	Salmonella_phage	100.0	7.1e-100
WP_000950941.1|3220562_3220739_-	protein ninF	NA	E7C9S2	Salmonella_phage	100.0	6.7e-27
WP_001532927.1|3220731_3221073_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000113765.1|3221075_3221252_-	NinE family protein	NA	C6ZR57	Salmonella_phage	100.0	4.6e-28
WP_000679702.1|3221218_3221392_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_020899478.1|3221388_3221826_-	recombination protein NinB	NA	A8CGE3	Salmonella_phage	99.3	1.4e-78
WP_021293879.1|3221899_3223276_-	AAA family ATPase	NA	A0A075B8G2	Enterobacteria_phage	99.8	5.7e-254
WP_000067075.1|3223272_3224088_-	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001125981.1|3224080_3224227_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000424167.1|3224261_3224540_-	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_001180316.1|3224675_3224903_-	transcriptional regulator	NA	G9L677	Escherichia_phage	89.3	2.1e-33
WP_000250476.1|3224980_3225691_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	87.7	4.0e-118
WP_020899481.1|3225776_3226700_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	99.7	4.3e-181
WP_020899482.1|3226735_3226939_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	98.5	7.7e-27
WP_024143050.1|3227306_3227669_+	hypothetical protein	NA	C6ZR44	Salmonella_phage	88.3	1.1e-52
WP_000843522.1|3227685_3228129_+	hypothetical protein	NA	E5AGE5	Erwinia_phage	62.6	3.0e-47
WP_020899485.1|3228751_3229030_+	hypothetical protein	NA	C6ZR42	Salmonella_phage	98.9	2.3e-45
WP_000776963.1|3229305_3229620_+	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000141641.1|3229704_3229863_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000156731.1|3229843_3230032_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_001046968.1|3230161_3230869_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_001253476.1|3230868_3231153_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111291.1|3231199_3231493_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001214777.1|3231503_3231674_+	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_020899487.1|3231670_3232261_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	73.9	1.7e-74
WP_020899488.1|3232427_3233078_+	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	68.4	4.5e-52
WP_000161224.1|3233079_3233298_+	DUF4014 family protein	NA	C6ZR28	Salmonella_phage	97.2	7.0e-34
WP_000208144.1|3233301_3233694_+	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	59.5	1.0e-38
WP_000662459.1|3233690_3234251_+	DUF551 domain-containing protein	NA	A0A220NQT9	Salmonella_phage	96.7	8.5e-100
WP_000002103.1|3234243_3234528_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	98.9	2.7e-49
WP_024143053.1|3234598_3235228_+	hypothetical protein	NA	A0A220NQT7	Salmonella_phage	94.3	4.0e-114
WP_001556007.1|3235337_3235556_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
WP_000533679.1|3235533_3236604_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E5M7	Salmonella_phage	100.0	1.0e-154
3236670:3236692	attR	CGTTCAACTTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 11
NZ_CP040562	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7399 chromosome, complete genome	4902004	3767789	3828605	4902004	transposase,protease,plate,tRNA	Vibrio_phage(12.5%)	53	NA	NA
WP_000118732.1|3767789_3769133_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001007106.1|3769136_3769673_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000119444.1|3769739_3770213_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_000379146.1|3770355_3770739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001081550.1|3770723_3771209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000312802.1|3771513_3771999_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_014344502.1|3772252_3772585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010988967.1|3772711_3772822_-	BPSL0067 family protein	NA	NA	NA	NA	NA
WP_000013881.1|3772884_3774393_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000996817.1|3774416_3774959_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000449778.1|3775058_3777698_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	34.5	1.1e-77
WP_000806681.1|3778065_3778968_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_000750535.1|3778954_3779779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000108007.1|3779775_3780270_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371508.1|3780285_3782169_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000145244.1|3782165_3783161_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000367626.1|3783171_3784227_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001670675.1|3784758_3785490_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000917872.1|3785553_3786021_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_000801238.1|3786017_3786740_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052775.1|3786774_3787530_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644706.1|3787601_3788969_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_000207224.1|3789024_3789795_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230968.1|3789872_3790673_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001127538.1|3790804_3791980_-	MFS transporter	NA	NA	NA	NA	NA
WP_000648534.1|3792084_3792999_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000154871.1|3793019_3793823_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	2.1e-38
WP_001051726.1|3800081_3800648_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594021.1|3800837_3801869_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
WP_001287486.1|3801861_3802515_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874215.1|3802553_3803369_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202315.1|3803487_3803892_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000093986.1|3803888_3804596_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260683.1|3804706_3806425_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000252573.1|3806498_3807200_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000560527.1|3807231_3807654_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185319.1|3807650_3808196_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000955207.1|3808375_3808594_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062330.1|3808580_3808841_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000210056.1|3808924_3810217_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901088.1|3810279_3810669_-	VOC family protein	NA	NA	NA	NA	NA
WP_001021054.1|3810724_3812866_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000502119.1|3814944_3815403_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000055753.1|3815597_3816557_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294826.1|3816569_3820052_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569412.1|3820075_3820672_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	1.5e-25
WP_000741212.1|3820668_3821817_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565950.1|3821816_3822605_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210741.1|3822608_3823064_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139265.1|3823169_3824195_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758966.1|3824198_3824684_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240935.1|3824806_3827221_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000949017.1|3827252_3828605_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 12
NZ_CP040562	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7399 chromosome, complete genome	4902004	4482074	4529118	4902004	tail,plate,tRNA	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4482074_4483073_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4483160_4484471_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_138628084.1|4484717_4485233_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4485331_4485541_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4485562_4485676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4485672_4486998_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4487176_4487785_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4487893_4488262_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017369.1|4488432_4490853_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4490951_4491824_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4491837_4492335_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4492515_4493433_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4493596_4494955_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4495043_4496153_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4496514_4497705_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4497836_4499381_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4499395_4500286_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4500451_4500862_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750803.1|4501004_4503101_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4503100_4503838_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_022742863.1|4503834_4504503_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4504536_4504779_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4505222_4506872_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4507216_4508566_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4508698_4509046_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4509621_4509909_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4509911_4510517_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4510529_4510844_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4511003_4511459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4511455_4511653_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4511642_4513070_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4513069_4513594_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4513645_4513963_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4513922_4514051_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4514147_4516502_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4516501_4517455_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4517454_4517664_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4517651_4518695_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4518704_4519427_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4519754_4520117_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4520113_4521043_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4521042_4522590_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4522753_4523113_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4523103_4524219_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4524211_4524844_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4524846_4526592_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4526596_4527202_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4527198_4527654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4527902_4528193_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4528389_4529118_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
