The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040564	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7699 chromosome, complete genome	4883741	1241165	1317924	4883741	transposase,integrase,terminase,tail,protease,head,lysis,portal,holin,capsid,tRNA	Salmonella_phage(37.93%)	93	1233246:1233262	1323771:1323787
1233246:1233262	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1241165_1242203_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1242318_1243008_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1243326_1243710_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1243771_1244359_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1244461_1245361_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1245378_1246713_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1246843_1247581_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1247565_1249188_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001521719.1|1249272_1249452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014344135.1|1249451_1249616_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1249612_1250188_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1250219_1250870_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1250869_1251826_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1251822_1252302_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1252799_1254029_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1254006_1254291_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1254331_1254571_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1254613_1255771_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017125.1|1255733_1258661_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001539619.1|1258787_1259138_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1259159_1259318_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_000950426.1|1259774_1260437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356948.1|1260436_1260823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111772.1|1260815_1261655_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000660736.1|1261713_1262109_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_000643689.1|1262208_1262451_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_010835408.1|1262410_1262785_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000024044.1|1262876_1263761_+	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_000801764.1|1263757_1264453_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000664368.1|1264466_1265165_+	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000877757.1|1265272_1265905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1266147_1266381_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1266497_1266746_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929791.1|1266780_1267383_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001241017.1|1267382_1267589_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
WP_001096550.1|1267591_1268203_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1268199_1268340_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1268336_1269014_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_072095218.1|1269010_1269196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|1269286_1269850_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1270356_1270545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1270759_1271446_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1271721_1272051_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|1272034_1272487_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|1272504_1272957_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1273192_1273594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1273880_1274426_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1274397_1276329_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1276312_1276516_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1276512_1278093_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1278082_1279579_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1279591_1279939_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1279993_1281022_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1281079_1281439_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1281449_1281833_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1281860_1282439_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1282487_1283618_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1283726_1284128_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1284135_1284882_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1284932_1285328_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1285324_1285663_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|1285634_1288730_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|1288732_1289062_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1289071_1289770_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1289776_1290514_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1290411_1291059_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1291120_1294483_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1294521_1294764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1294817_1297190_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1297186_1298011_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1298000_1298579_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1298675_1298903_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1299009_1299222_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_015701342.1|1299284_1299350_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_015589559.1|1299929_1300094_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1300806_1300944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1301446_1302940_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1303344_1305144_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1305160_1306135_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1306408_1307089_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1307085_1307991_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1308002_1308731_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1308742_1309474_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1309473_1309854_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1309965_1310226_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1310263_1311190_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276370.1|1311305_1312502_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684022.1|1312523_1313441_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1313479_1314328_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1314443_1315337_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1315347_1316709_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1316712_1317348_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1317372_1317924_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1323771:1323787	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP040564	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7699 chromosome, complete genome	4883741	1671362	1700955	4883741	tail,protease,holin	Salmonella_phage(38.46%)	32	NA	NA
WP_000781589.1|1671362_1671857_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1672270_1672762_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1672751_1673015_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778094.1|1673011_1675498_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1675504_1676200_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1676186_1677056_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1677171_1677621_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1677630_1678233_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1678253_1678871_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_000990028.1|1678867_1679527_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1679578_1680316_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1680312_1680525_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1680521_1681001_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1680997_1682929_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1682925_1683483_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001238333.1|1683479_1684523_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1684566_1685214_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1685943_1686507_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1686698_1686902_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1687204_1687996_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1688292_1688496_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1688664_1691031_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_014344510.1|1691359_1692349_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	2.4e-190
WP_010989045.1|1692363_1692732_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1692760_1694092_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1694388_1694718_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1695310_1696552_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1696554_1697082_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1697459_1697903_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1697956_1699786_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1700133_1700424_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1700451_1700955_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 3
NZ_CP040564	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7699 chromosome, complete genome	4883741	1773006	1782177	4883741	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1773006_1773954_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1773937_1774669_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1774649_1774757_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1774816_1775548_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1775770_1777456_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1777452_1778172_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1778218_1778686_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1778742_1779273_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1779444_1779903_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1780143_1782177_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP040564	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7699 chromosome, complete genome	4883741	1850485	1860991	4883741		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1850485_1851889_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1852066_1852960_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1853336_1854422_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1854421_1855321_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1855368_1856247_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1856247_1856799_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1856804_1857797_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1857793_1858567_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1858571_1859651_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1859677_1860991_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_CP040564	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7699 chromosome, complete genome	4883741	1946985	1997735	4883741	integrase,terminase,tail,protease,head,portal,lysis,holin,plate,capsid	Salmonella_phage(89.06%)	71	1941563:1941577	1958039:1958053
1941563:1941577	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|1946985_1947459_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001738920.1|1948106_1948397_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_000598920.1|1948768_1949566_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|1949857_1950847_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|1950848_1951091_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_001061334.1|1951115_1951685_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000208068.1|1951688_1952522_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_000065095.1|1952518_1953136_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000071070.1|1953132_1953648_-	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000764235.1|1953644_1953875_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000008351.1|1953945_1954485_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080415.1|1954621_1955449_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000997190.1|1955506_1955878_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_001020636.1|1956692_1957388_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_071529734.1|1957361_1957547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001191666.1|1957485_1957710_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|1957738_1958293_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
1958039:1958053	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087402.1|1958289_1959447_+	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000620702.1|1959443_1959668_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000061500.1|1959664_1960483_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_001684745.1|1960484_1960967_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000066908.1|1960966_1961860_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001241579.1|1961856_1962246_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_001061457.1|1962262_1963123_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001202278.1|1963130_1964120_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	9.2e-190
WP_000188927.1|1964130_1964754_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001527054.1|1964886_1965144_+	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_014343859.1|1965073_1965508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001527046.1|1965669_1966014_+|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_001005901.1|1966016_1966631_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001050825.1|1966627_1967113_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_000877027.1|1967325_1967745_+	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001292890.1|1967964_1968267_+	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_001135225.1|1968327_1968678_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_000929191.1|1968803_1969298_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_000088182.1|1969294_1971028_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000605609.1|1971039_1971222_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466254.1|1971221_1972463_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_001193639.1|1972440_1973091_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000257528.1|1973105_1974311_+|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_000601353.1|1974361_1974562_+	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000927378.1|1974564_1974888_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000702408.1|1974884_1975289_+|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_001135697.1|1975260_1975773_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000779218.1|1975769_1976330_+	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_000497739.1|1976333_1976498_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_001007991.1|1976487_1977984_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000515952.1|1977983_1978340_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|1978336_1978663_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785385.1|1978747_1980676_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000863818.1|1980709_1982050_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_001066636.1|1982046_1983105_+	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_001273649.1|1983104_1983638_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605050.1|1983642_1984056_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_014343856.1|1984027_1984573_+	phage protein	NA	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_014343855.1|1984607_1985129_+|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
WP_001207832.1|1985131_1985719_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554737.1|1985705_1987268_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_000760554.1|1987267_1987837_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
WP_000492926.1|1988121_1989129_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_001526483.1|1989341_1989563_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_099112411.1|1989676_1989892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000500831.1|1990193_1990355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|1990481_1990901_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|1990903_1992172_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|1992626_1992839_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1992849_1993038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|1993298_1994495_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|1995144_1995444_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|1995535_1996231_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|1996304_1997735_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP040564	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7699 chromosome, complete genome	4883741	2101780	2108589	4883741	tail,integrase	Salmonella_phage(33.33%)	11	2103990:2104012	2113705:2113727
WP_000856224.1|2101780_2102011_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2102148_2102523_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2102523_2103399_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2103415_2103769_+	YebY family protein	NA	NA	NA	NA	NA
2103990:2104012	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|2104142_2104997_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2105056_2105551_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2105740_2105971_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2106024_2106558_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2106814_2106982_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2107046_2107235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2107707_2108589_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2113705:2113727	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP040564	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7699 chromosome, complete genome	4883741	2897795	2982531	4883741	integrase,terminase,tail,protease,lysis,portal,holin,tRNA	Salmonella_phage(45.45%)	94	2921889:2921908	2993672:2993691
WP_000938191.1|2897795_2898476_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2899096_2899756_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2899842_2900172_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2900168_2900450_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2900498_2901278_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2901303_2901852_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2902066_2903278_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2903335_2903653_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2903697_2904114_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2904284_2904947_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2905041_2905500_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2905535_2907590_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2907713_2908160_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2908178_2910332_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2910318_2910924_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2911140_2911650_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2912006_2913059_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2913130_2913583_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156453.1|2913768_2915529_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2915597_2916116_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2916215_2916383_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2916638_2917202_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2917198_2918839_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2918843_2920097_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2920111_2922019_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2921889:2921908	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2922031_2924140_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2924238_2925348_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2925344_2925887_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2926052_2927063_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2927270_2929883_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2930309_2930501_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2930771_2931458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|2931442_2931742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2931810_2932437_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001526469.1|2933084_2934053_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
WP_000143167.1|2934528_2935110_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001144679.1|2935109_2937548_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000178849.1|2937601_2937844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033415.1|2937882_2941233_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000246065.1|2941304_2942009_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2941906_2942644_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2942653_2943349_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2943438_2943972_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2944088_2944586_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|2944684_2945017_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|2945013_2948001_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|2948080_2948410_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|2948406_2948805_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|2948850_2949600_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|2949611_2950013_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|2950009_2950576_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|2950556_2950856_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2950848_2951172_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|2951262_2953344_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_077679777.1|2953267_2954785_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_000196190.1|2954811_2955018_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|2955014_2957153_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|2957109_2957643_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|2957850_2958330_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2958347_2958800_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2958783_2959113_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|2959388_2960075_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2960435_2960885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2961020_2961146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|2961319_2961637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|2961703_2962501_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|2962490_2962637_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|2962633_2963245_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001241019.1|2963247_2963454_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_000929805.1|2963453_2964056_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|2964138_2964360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2964471_2964705_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|2964996_2965287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2965364_2965676_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|2965672_2966020_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800013.1|2966030_2966780_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.2	1.1e-137
WP_000062941.1|2966782_2967766_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2967850_2968225_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2968190_2968430_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2968549_2968960_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_014344008.1|2969009_2969270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|2969262_2969421_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|2969442_2969742_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000017133.1|2969868_2972754_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001539618.1|2972716_2973874_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2973916_2974156_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2974196_2974445_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|2974489_2975782_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|2975976_2977179_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|2977256_2978693_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|2978937_2980152_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000301921.1|2980238_2980472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762342.1|2980468_2980930_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2981130_2982531_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
2993672:2993691	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 8
NZ_CP040564	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7699 chromosome, complete genome	4883741	3046692	3055424	4883741	transposase,protease	Enterobacteria_phage(14.29%)	8	NA	NA
WP_085983316.1|3046692_3047947_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_119920232.1|3047962_3048238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|3048410_3048869_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3049060_3051337_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3051367_3051688_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3052011_3052233_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3052362_3054309_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3054305_3055424_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 9
NZ_CP040564	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7699 chromosome, complete genome	4883741	3157281	3220115	4883741	transposase,integrase,terminase,tail,protease,portal,lysis,holin,coat	Salmonella_phage(64.18%)	87	3180352:3180374	3220181:3220203
WP_000502119.1|3157281_3157740_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000373611.1|3157929_3158634_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000545202.1|3158681_3159134_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_001575835.1|3159135_3159387_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080894.1|3159373_3159859_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084604.1|3159861_3160374_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_000168180.1|3160395_3161385_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001246033.1|3161781_3162690_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.9	7.8e-26
WP_000482001.1|3162781_3165079_-	SPI-1 type III secretion system effector E3 ubiquitin transferase SlrP	NA	Q9MBL9	Phage_Gifsy-2	42.1	2.4e-15
WP_001616936.1|3165086_3165260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000042502.1|3165568_3167590_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_001752195.1|3167586_3167814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000167222.1|3168240_3168927_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000079909.1|3168919_3169675_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118953.1|3169658_3170816_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000090729.1|3170812_3171853_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_000205518.1|3171939_3173229_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.5	7.7e-19
WP_000767419.1|3173286_3173763_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001095227.1|3173847_3175368_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.8	2.2e-81
WP_001115209.1|3175369_3177055_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_000287416.1|3177251_3177977_-	histidine utilization repressor	NA	NA	NA	NA	NA
WP_000195682.1|3178021_3178963_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_001249472.1|3178959_3180183_-	imidazolonepropionase	NA	NA	NA	NA	NA
3180352:3180374	attL	CGTTCAACTTAGTATAAAAAAGC	NA	NA	NA	NA
WP_100514402.1|3180489_3180690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000915520.1|3180806_3181169_+	GtrA family protein	NA	I1TED9	Salmonella_phage	99.2	5.0e-61
WP_039513020.1|3181165_3182098_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	99.0	1.8e-174
WP_023210757.1|3182087_3183545_+	O-antigen conversion protein	NA	A0A192Y7W8	Salmonella_phage	99.0	3.2e-239
WP_023210756.1|3183603_3185607_-|tail	tailspike	tail	A0A192Y6X2	Salmonella_phage	99.6	0.0e+00
WP_000532174.1|3185742_3185994_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	98.8	4.1e-38
WP_000821346.1|3186010_3186430_-	hypothetical protein	NA	B9UDL3	Salmonella_phage	100.0	1.3e-73
WP_023210755.1|3186547_3186877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023210754.1|3186896_3188738_-	hypothetical protein	NA	A0A192Y934	Salmonella_phage	78.3	4.3e-257
WP_049884127.1|3188737_3190075_-	DNA transfer protein	NA	I1TEJ5	Salmonella_phage	95.7	1.1e-233
WP_023210752.1|3190117_3190807_-	hypothetical protein	NA	I1TEJ4	Salmonella_phage	95.6	6.4e-89
WP_023210751.1|3190809_3191265_-	DUF2824 family protein	NA	A0A1R3Y5P3	Salmonella_virus	98.0	8.2e-85
WP_023167450.1|3191264_3191966_-	hypothetical protein	NA	C6ZR14	Salmonella_phage	97.9	2.8e-76
WP_023210750.1|3191969_3193388_-	hypothetical protein	NA	I1TEJ1	Salmonella_phage	97.2	4.0e-271
WP_023210749.1|3193347_3193848_-	packaged DNA stabilization protein gp4	NA	I1TEJ0	Salmonella_phage	98.2	8.7e-88
WP_000684729.1|3193831_3194041_-	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_020899473.1|3194079_3195372_-|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.3	3.2e-243
WP_023210748.1|3195371_3196283_-	scaffolding protein	NA	I6S5W6	Salmonella_phage	99.7	1.1e-160
WP_000774657.1|3196296_3198474_-|portal	portal protein	portal	Q5C835	Enterobacteria_phage	99.3	0.0e+00
WP_000417866.1|3198473_3199973_-|terminase	terminase	terminase	A0A2H4FUR5	Salmonella_phage	100.0	4.8e-307
WP_000729925.1|3199950_3200439_-	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_012532521.1|3200442_3200847_-	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	99.3	1.5e-66
WP_000808100.1|3200849_3201092_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
WP_001028469.1|3201415_3201937_-	DNA-binding protein	NA	H6WRZ8	Salmonella_phage	100.0	1.9e-101
WP_011233123.1|3202149_3202599_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	87.8	3.0e-63
WP_001167374.1|3202616_3203054_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
WP_000738703.1|3203037_3203364_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_071600147.1|3203499_3203709_-	hypothetical protein	NA	M1E3N9	Enterobacteria_phage	97.1	2.2e-32
WP_001235452.1|3203798_3204422_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	87.0	8.3e-96
WP_000994515.1|3204418_3204607_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_023210747.1|3204603_3204966_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	97.5	5.0e-61
WP_000002244.1|3204962_3205253_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	100.0	1.0e-51
WP_001286918.1|3205245_3205458_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	98.6	4.7e-35
WP_000950962.1|3205450_3205627_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_001532927.1|3205619_3205961_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_023210746.1|3205963_3206140_-	NinE family protein	NA	C6ZR57	Salmonella_phage	98.3	3.0e-27
WP_024150884.1|3206121_3206280_-	hypothetical protein	NA	Q8HAF7	Salmonella_phage	94.2	6.0e-27
WP_023210745.1|3206276_3206723_-	recombination protein NinB	NA	I6R0N7	Salmonella_phage	99.3	1.2e-80
WP_024150883.1|3206679_3206976_-	hypothetical protein	NA	E7C9R7	Salmonella_phage	99.0	2.6e-47
WP_100097535.1|3206978_3207239_-	hypothetical protein	NA	Q8HAG0	Salmonella_phage	98.8	9.9e-43
WP_077909433.1|3207238_3207448_-	hypothetical protein	NA	A0A1R3Y5S8	Salmonella_virus	98.6	7.0e-31
WP_006819448.1|3207457_3207730_-	DUF4752 family protein	NA	A0A220NQX8	Salmonella_phage	100.0	4.2e-44
WP_023210742.1|3207804_3209241_-	AAA family ATPase	NA	E7C9R5	Salmonella_phage	98.5	1.7e-272
WP_006789497.1|3209230_3210130_-	hypothetical protein	NA	A0A220NQX5	Salmonella_phage	99.3	1.5e-154
WP_001125981.1|3210122_3210269_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_023210741.1|3210303_3210582_-	hypothetical protein	NA	A0A220NRS4	Escherichia_phage	92.4	3.8e-40
WP_000276884.1|3210688_3210874_-	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_017441421.1|3210954_3211605_+	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	99.5	2.1e-121
WP_023210740.1|3211943_3212279_+	hypothetical protein	NA	Q5G8T5	Enterobacteria_phage	87.9	1.7e-47
WP_000213981.1|3212357_3212552_+	Restriction inhibitor protein ral	NA	E7C9Q6	Salmonella_phage	100.0	2.5e-30
WP_001748038.1|3213169_3213448_+	hypothetical protein	NA	C6ZR42	Salmonella_phage	100.0	1.3e-45
WP_020838488.1|3213765_3213927_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	E7C9Q3	Salmonella_phage	100.0	4.9e-24
WP_000361564.1|3213919_3214033_+	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
WP_052917792.1|3214029_3214218_+	hypothetical protein	NA	C6ZR38	Salmonella_phage	98.4	1.1e-27
WP_023210737.1|3214226_3214934_+	hypothetical protein	NA	E7C9Q0	Salmonella_phage	98.3	7.6e-138
WP_001253476.1|3214933_3215218_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_023210736.1|3215264_3215558_+	DUF2856 family protein	NA	E7C9P8	Salmonella_phage	97.9	2.7e-49
WP_001214770.1|3215568_3215739_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
WP_001749884.1|3215735_3216113_+	hypothetical protein	NA	I6R9B7	Salmonella_phage	100.0	5.1e-64
WP_023210735.1|3216222_3216582_+	Eaf protein	NA	T1SA95	Salmonella_phage	92.4	1.1e-60
WP_086936903.1|3216731_3217217_+	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	78.3	2.2e-59
WP_000582224.1|3217216_3217972_+	hypothetical protein	NA	H6WRY1	Salmonella_phage	99.6	4.2e-150
WP_001556007.1|3218848_3219067_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
WP_023210729.1|3219044_3220115_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E5M7	Salmonella_phage	99.3	6.8e-154
3220181:3220203	attR	CGTTCAACTTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 10
NZ_CP040564	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7699 chromosome, complete genome	4883741	4463958	4511002	4883741	plate,tail,tRNA	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4463958_4464957_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4465044_4466355_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4466601_4467117_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4467215_4467425_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4467446_4467560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4467556_4468882_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4469060_4469669_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4469777_4470146_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017359.1|4470316_4472737_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4472835_4473708_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4473721_4474219_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4474399_4475317_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4475480_4476839_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4476927_4478037_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4478398_4479589_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4479720_4481265_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4481279_4482170_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4482335_4482746_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4482888_4484985_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4484984_4485722_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_014343934.1|4485718_4486387_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4486420_4486663_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4487106_4488756_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4489100_4490450_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4490582_4490930_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4491505_4491793_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270440.1|4491795_4492401_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	1.2e-59
WP_000777266.1|4492413_4492728_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4492887_4493343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4493339_4493537_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4493526_4494954_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4494953_4495478_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4495529_4495847_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4495806_4495935_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262500.1|4496031_4498386_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_000271423.1|4498385_4499339_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4499338_4499548_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4499535_4500579_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4500588_4501311_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4501638_4502001_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4501997_4502927_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4502926_4504474_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4504637_4504997_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4504987_4506103_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4506095_4506728_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4506730_4508476_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4508480_4509086_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4509082_4509538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4509786_4510077_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4510273_4511002_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP040565	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7699 plasmid pCFSAN059544, complete sequence	93869	83622	92918	93869	transposase	Escherichia_phage(28.57%)	12	NA	NA
WP_001541564.1|83622_84039_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|84222_84558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541562.1|84614_85181_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728917.1|85212_86154_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_000427676.1|86568_87774_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_001541561.1|87770_88748_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
WP_000457541.1|88829_90104_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_000925627.1|90103_90526_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000490265.1|91036_91507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|91499_91856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000091632.1|91904_92093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088645.1|92237_92918_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
