The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040572	Escherichia coli O157:H7 strain ECP17-46 chromosome, complete genome	5475399	1183578	1211138	5475399	tail,holin,integrase,transposase	Stx2-converting_phage(31.58%)	33	1183535:1183594	1204043:1205356
1183535:1183594	attL	ACTGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCA	NA	NA	NA	NA
WP_085948178.1|1183578_1184792_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000800629.1|1186229_1187081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001071599.1|1187180_1187387_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	1.8e-07
WP_000540864.1|1187709_1188915_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1188916_1190230_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1190226_1191858_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1191858_1192257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1192354_1192768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150589.1|1193163_1194336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001417601.1|1194411_1194714_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1194749_1195505_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1195846_1196413_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1196387_1196999_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1196995_1197661_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1197657_1198281_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1198533_1199277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1199362_1199530_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143065.1|1199937_1201791_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1201940_1202156_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1202160_1202505_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1202861_1203242_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1203238_1203586_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998000.1|1203635_1204280_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-69
WP_001299612.1|1204086_1204977_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
WP_000165061.1|1204973_1205300_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
WP_001023396.1|1205517_1205787_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
1204043:1205356	attR	ACTGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATCGTTTCCGATGGAAGCATAATAAGCTTTTTCTGCTTCTGCCGGAGGAGTATGGCCCAGCCTTCCCAGCAATCGTCGATTGTTATACCAGTCCACCCACGTTAGTGTGGCCAGTTCCACTTCTGCACGGTTTTTCCAGCTCTTACGGTGTATTACCTCCGCTTTGTAAAGACCATTGATGCTCTCAGCCATCGCGTTGTCATACGAGTCGCCTGTACTCCCTGTTGATGCCAGTAATCCGGCTTCTTTTAGTCGCTCCGTATAGGCCAGTGACACATACTGAGAGCCTTTATCGCTGTGATGGATGGTGCCAGACGGACGACGGGCCCACAACGCCTGCTCCAGCGCATCCAGCACGAATGTCGTTTCCATAGACGATGAGACCCGCCACCCCACGATGTATCCGGCAAACACATCAATGATAAACGCCACATAGACGAAGCCCTGCCATGTGCTGACGTAAGTAAAATCAGCCACCCACAGCTGGTCAGGTCGTTCTGCCACGAACTGACGGTTTACGCGGTCGCCTGCGGCAACGGCTTTCCGGCTGATGGTCGTACGGACCTTTTTACCCCGGAGAACACCGGCAAGTCCCATAACCGCCATGAGACGTGCCACTGTACATCTGGCCACCCTGATTCCTTCCCGTAACAACTGACGCCAGACTTTACGCACACCGTACACCTGATGATTTTCATCGTATACGCGCTGTATCTCTCTCTTCAGCCAGTCGTCGTGCTGCGCACGGGCACTGCGTTTATCCGGATGATGTCGCTGTTGCTGACAATGGTAATACGTTGACGGGGCAATATGCAGTTCGCTGCATACCGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCATCATTTTTTCCAGAGGCGGTCGAACTCCGCCTTCGCAAAATAAGCGGAAGCCTGGCGAAGGATATCGTTACTGCGGCGCAGTTCACGATTTTCACGTTCCAGCTCTTTCAGACGCTGACGTTCAGCGCTGGTGAGCCCACCATCACCGCCCCCGGTATCCCGCTCATGCTGGCGAACCCAGACACGCAGAGTCTCCGGCGTACAGCCAATCTTTGGGGCAATGGAACAAATTGCCGCCCACTGTGAGTCATATTCATCCTGACTTTCCAGAACCATACGAATCGCCCGCTGACGGACTTCGGGGGAAAAACGAGTATTTTTAGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCAGA	NA	NA	NA	NA
WP_000442132.1|1205947_1206370_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1206499_1207558_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1207636_1208287_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132152.1|1208469_1209060_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001302510.1|1209046_1209166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217542.1|1209561_1209810_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1210655_1211138_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP040572	Escherichia coli O157:H7 strain ECP17-46 chromosome, complete genome	5475399	1488755	1589093	5475399	holin,transposase,bacteriocin,tail,lysis,capsid,terminase,integrase,tRNA,portal	Escherichia_phage(81.11%)	119	1493111:1493135	1557974:1557998
WP_001005794.1|1488755_1489286_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
WP_000403517.1|1489285_1489753_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1489739_1490420_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_001693763.1|1490429_1491566_+	acyltransferase	NA	Q716G3	Shigella_phage	72.4	5.3e-80
WP_000958700.1|1491740_1492898_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
1493111:1493135	attL	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
WP_001218308.1|1493329_1494499_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000453637.1|1494482_1494665_-	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_000994803.1|1494743_1495121_-	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	100.0	2.0e-52
WP_001291844.1|1495156_1495369_-	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000163444.1|1495328_1495955_-	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_000809302.1|1495951_1496383_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000211992.1|1496438_1497116_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	100.0	1.3e-123
WP_001260980.1|1497440_1497698_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	100.0	8.6e-39
WP_001451755.1|1497826_1498024_+	hypothetical protein	NA	A0A0N7BYR2	Escherichia_phage	100.0	4.1e-33
WP_001302866.1|1498112_1498418_+	HigA family addiction module antidote protein	NA	A0A0N7BS23	Escherichia_phage	100.0	4.4e-50
WP_001451754.1|1498460_1499030_-	hypothetical protein	NA	A0A0N7BS22	Escherichia_phage	100.0	7.3e-99
WP_000206752.1|1499292_1499916_-	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	3.1e-119
WP_000212746.1|1499919_1500207_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001142590.1|1500208_1500427_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_001301947.1|1500428_1500644_-	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	100.0	7.9e-38
WP_001301469.1|1500603_1501110_-	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	100.0	4.2e-90
WP_001303141.1|1501111_1502059_-	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	100.0	1.6e-183
WP_000476217.1|1502055_1502295_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	100.0	2.1e-39
WP_000157000.1|1502287_1502491_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_001453790.1|1502487_1503366_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	100.0	1.0e-179
WP_001159716.1|1503473_1503917_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	100.0	1.7e-79
WP_000080417.1|1503993_1504815_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_000077905.1|1504878_1505226_-	hypothetical protein	NA	A0A2R2X2A9	Escherichia_phage	100.0	5.9e-59
WP_085948178.1|1505617_1506830_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000187066.1|1507201_1507891_-	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	100.0	2.7e-135
WP_000459724.1|1507887_1508838_-	recombinase RecT	NA	A0A2R2Z324	Escherichia_phage	100.0	1.4e-179
WP_000995346.1|1508856_1509138_-	host nuclease inhibitor GamL	NA	A0A2R2Z319	Escherichia_phage	100.0	1.7e-48
WP_024175068.1|1509158_1509380_-	hypothetical protein	NA	A0A2R2Z322	Escherichia_phage	100.0	6.4e-35
WP_000917253.1|1509451_1509664_-	hypothetical protein	NA	A0A2R2Z321	Escherichia_phage	100.0	3.4e-33
WP_000201269.1|1509734_1510382_-	Rha family transcriptional regulator	NA	A0A2R2Z320	Escherichia_phage	100.0	1.5e-119
WP_001064714.1|1511242_1512196_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000939558.1|1512192_1513662_-	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001056250.1|1513756_1514470_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240876.1|1514565_1514769_+	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001302923.1|1514939_1515134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271433.1|1515300_1515678_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_000913119.1|1515671_1517192_+	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	100.0	6.4e-307
WP_001193567.1|1517181_1518153_+	DNA primase	NA	A0A2R2Z336	Escherichia_phage	100.0	1.4e-195
WP_000402093.1|1518152_1518602_+	DUF1367 family protein	NA	A0A2R2Z328	Escherichia_phage	100.0	1.3e-82
WP_001187434.1|1518609_1519173_+	bacteriophage lambda NinG family protein	NA	A0A2R2Z332	Escherichia_phage	100.0	4.7e-106
WP_000144764.1|1519169_1519364_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204844.1|1519356_1519791_+	antitermination protein	NA	A0A2R2Z331	Escherichia_phage	100.0	5.6e-83
WP_024165517.1|1519779_1520025_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.8	1.1e-35
WP_001356551.1|1520039_1520192_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000649753.1|1520574_1521534_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|1521545_1521815_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874428.1|1522300_1524238_+	SASA family carbohydrate esterase	NA	A0A2R2Z342	Escherichia_phage	100.0	0.0e+00
WP_000143458.1|1524372_1524552_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290210.1|1524592_1524838_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	100.0	3.6e-18
WP_001072901.1|1524915_1525131_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087729.1|1525135_1525669_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	100.0	1.3e-102
WP_001453789.1|1525901_1526030_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	86.2	1.2e-06
WP_085948178.1|1525995_1527209_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000989259.1|1527262_1527826_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	2.6e-104
WP_000455406.1|1527825_1527975_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082654.1|1527982_1528447_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000738505.1|1528478_1528772_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|1528921_1529125_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_001086073.1|1529180_1529987_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000143988.1|1529967_1531674_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787519.1|1531673_1533818_+|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|1533975_1534983_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|1535006_1536221_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|1536276_1536666_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|1536715_1537177_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|1537160_1537724_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207926.1|1537723_1538374_+	hypothetical protein	NA	A0A0N6WEJ5	Escherichia_phage	100.0	4.6e-121
WP_000117994.1|1538370_1540308_+|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_001024006.1|1540309_1540579_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001303606.1|1540718_1540907_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001146324.1|1541201_1542827_+	hypothetical protein	NA	A0A0N7C0A7	Escherichia_phage	100.0	0.0e+00
WP_000197192.1|1542823_1544092_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455635.1|1544106_1544385_+	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_001301884.1|1544390_1545008_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835362.1|1545098_1545833_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0N7C1B9	Escherichia_phage	100.0	4.4e-136
WP_024175551.1|1545763_1546009_-	hypothetical protein	NA	Q7Y2U2	Escherichia_phage	98.8	1.6e-39
WP_000078907.1|1546065_1546206_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1546262_1546664_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|1546757_1547414_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455644.1|1547416_1547863_+	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000540391.1|1547872_1548124_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012450.1|1548134_1549400_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000331692.1|1549469_1557851_+	hypothetical protein	NA	A0A0N7BSA7	Escherichia_phage	100.0	0.0e+00
WP_000368131.1|1558072_1559005_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1557974:1557998	attR	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
WP_000776768.1|1559298_1560054_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_001301650.1|1560258_1560375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000952959.1|1560448_1561480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301981.1|1561844_1563185_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000030901.1|1563556_1563841_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_000531969.1|1564020_1565331_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000426146.1|1565330_1567475_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195817.1|1567677_1568163_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033336.1|1568808_1569372_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001112847.1|1569453_1571052_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_000182852.1|1571074_1571833_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000675435.1|1571843_1572344_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001415277.1|1572382_1572811_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001301662.1|1572807_1572981_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000794741.1|1573213_1573735_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001301548.1|1573736_1574579_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730817.1|1574749_1575301_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001302029.1|1575466_1576399_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001297933.1|1576433_1577519_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001043834.1|1577522_1578347_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|1578346_1579156_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089225.1|1579155_1579704_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|1579737_1580016_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000683769.1|1580136_1582143_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817183.1|1582301_1583522_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127753.1|1583796_1584975_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615801.1|1584971_1585967_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000699109.1|1586065_1587202_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.1e-24
WP_001289184.1|1587267_1588281_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283590.1|1588280_1589093_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP040572	Escherichia coli O157:H7 strain ECP17-46 chromosome, complete genome	5475399	1804076	1888575	5475399	holin,tail,terminase,portal,protease,tRNA,integrase	Enterobacteria_phage(52.0%)	100	1806551:1806571	1863993:1864013
WP_000569336.1|1804076_1805003_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1805007_1805739_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1805719_1805827_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1805886_1806588_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
1806551:1806571	attL	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000063648.1|1806608_1807895_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1807928_1808183_-	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556581.1|1808201_1808336_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.4e-21
WP_000457728.1|1808339_1808582_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1808669_1809032_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1809028_1809385_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001113545.1|1809461_1809749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356547.1|1809718_1809895_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1809896_1810844_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1810840_1811062_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1811160_1811442_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1811452_1811644_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1811616_1811799_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1811798_1812476_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1812472_1813258_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|1813263_1813560_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000233576.1|1813635_1813842_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000866321.1|1814322_1814700_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380252.1|1814677_1815739_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000858974.1|1815819_1816509_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067457.1|1816613_1816844_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_001182899.1|1816913_1817453_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001415640.1|1817539_1818469_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	3.6e-111
WP_000788810.1|1818465_1819167_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000145915.1|1819163_1819466_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070451.1|1819533_1819866_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032102575.1|1819957_1820065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1820122_1821649_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001302427.1|1822113_1822665_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1822674_1823472_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1823588_1823690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054341.1|1823686_1824142_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_000224916.1|1824141_1824312_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774488.1|1824304_1824595_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099712.1|1824591_1824954_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1824950_1825091_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1825176_1825611_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_024165948.1|1825599_1825848_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.8	1.2e-34
WP_001356551.1|1825862_1826015_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1826818_1828765_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1828901_1829081_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1829121_1829367_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1829444_1829660_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1829664_1830198_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1830468_1831038_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1831037_1831184_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1831411_1831597_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1832114_1832591_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077621.1|1832587_1833595_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	1.8e-201
WP_000114064.1|1833756_1834995_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
WP_000229066.1|1834987_1835212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038670.1|1835271_1835853_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	61.3	1.5e-51
WP_088136225.1|1835833_1836553_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000335965.1|1836545_1836770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551748.1|1836762_1837356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728901.1|1837552_1837795_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032311625.1|1837791_1839606_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.9	4.4e-129
WP_001399692.1|1839893_1840139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126660.1|1840135_1840558_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001114742.1|1841024_1841219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860404.1|1841215_1843105_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000133409.1|1843362_1843644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000102414.1|1845136_1845349_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1845348_1846851_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114426.1|1846795_1848820_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_001097065.1|1848907_1849234_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1849226_1849508_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1849510_1850134_+	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1850146_1850545_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1850552_1851305_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1851318_1851741_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000438877.1|1851767_1852076_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000918269.1|1852119_1854765_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|1854761_1855091_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|1855090_1855789_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194801.1|1855799_1856543_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_123007081.1|1856488_1857118_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	3.9e-101
WP_000514967.1|1857358_1860835_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.5	0.0e+00
WP_001228302.1|1860902_1861502_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.5	1.3e-109
WP_000268979.1|1861566_1862880_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.1	2.4e-76
WP_001023381.1|1862881_1863151_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_001261937.1|1863518_1863767_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1864281_1865967_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
1863993:1864013	attR	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000598641.1|1865963_1866683_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1866729_1867200_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1867241_1867703_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1867827_1869831_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1869827_1870964_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1870956_1871688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1871706_1873236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1873246_1874335_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1875575_1875893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1875954_1879584_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_122989774.1|1879593_1881135_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001411921.1|1881298_1882579_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1886541_1888575_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 4
NZ_CP040572	Escherichia coli O157:H7 strain ECP17-46 chromosome, complete genome	5475399	1914224	1952291	5475399	head,holin,tail,lysis,capsid,terminase,plate,integrase,tRNA,portal	Escherichia_phage(63.64%)	50	1916005:1916032	1947965:1947992
WP_000807362.1|1914224_1915124_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1915529_1915847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303578.1|1915834_1916014_+	hypothetical protein	NA	NA	NA	NA	NA
1916005:1916032	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985260.1|1916111_1917125_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|1917240_1917540_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1917661_1917937_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000217670.1|1918114_1918615_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557698.1|1918678_1918903_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277898.1|1918902_1919202_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113265.1|1919204_1919429_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_000027664.1|1919425_1919701_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268574.1|1919690_1921973_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000063136.1|1922062_1923286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|1923332_1923785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000844437.1|1923784_1925752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001693738.1|1926069_1927104_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	9.3e-201
WP_000156848.1|1927103_1928876_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_001085952.1|1929049_1929904_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_001248594.1|1929962_1931036_+|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_024178727.1|1931039_1931783_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.2	2.8e-122
WP_000988633.1|1931882_1932392_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846406.1|1932391_1932595_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123123.1|1932598_1932880_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1932879_1933377_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736555.1|1933391_1933817_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_000040644.1|1933804_1934230_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_001300730.1|1934201_1934375_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917144.1|1934337_1934805_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001001810.1|1934797_1935250_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	2.2e-74
WP_001093728.1|1935316_1935952_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_000127154.1|1935948_1936296_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001121479.1|1936300_1937209_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_001285352.1|1937201_1937813_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_000217052.1|1937809_1939129_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.5	1.2e-179
WP_001057694.1|1939128_1939731_+|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_001008233.1|1939702_1940146_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001145592.1|1940166_1940577_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	98.4	5.9e-66
WP_000905094.1|1940607_1941201_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001286706.1|1941260_1942451_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	6.9e-224
WP_001251408.1|1942463_1942982_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1943038_1943314_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001496926.1|1943346_1943466_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_000069957.1|1943458_1945906_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_000978913.1|1945920_1946400_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000882933.1|1946399_1947563_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000468308.1|1947644_1947863_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1948136_1949498_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
1947965:1947992	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001301848.1|1949645_1949978_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|1950168_1950891_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|1950887_1952291_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 5
NZ_CP040572	Escherichia coli O157:H7 strain ECP17-46 chromosome, complete genome	5475399	2051377	2125539	5475399	holin,head,transposase,tail,terminase,protease,integrase,portal	Escherichia_phage(32.61%)	76	2047018:2047033	2102783:2102798
2047018:2047033	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000998048.1|2051377_2052916_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2052965_2053313_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2053309_2053690_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|2054051_2054597_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2054593_2055337_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2055348_2056428_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2056489_2057425_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2057881_2058799_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2058900_2059851_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|2059968_2061612_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2062237_2062954_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2063296_2064751_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2064852_2066169_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2066482_2067535_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014714124.1|2067796_2075779_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2076268_2077066_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2077301_2078324_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2078323_2078527_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034478.1|2078585_2081057_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2081152_2081341_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2081337_2081526_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2082006_2082159_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2082433_2083078_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2083175_2083403_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2083399_2083825_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2083893_2084931_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000373320.1|2084962_2085385_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450610.1|2085419_2086118_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2086139_2086364_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2086360_2086717_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2086749_2086902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2086898_2087210_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2087336_2087900_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2088009_2088114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2088300_2088513_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001302544.1|2088554_2088740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310296.1|2088680_2088959_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2088960_2090010_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2090022_2090382_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2090378_2091068_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001302069.1|2091098_2091221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303558.1|2091701_2092130_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|2092607_2094458_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_085948178.1|2094539_2095753_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000411809.1|2096072_2096279_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731204.1|2096283_2096628_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2096678_2097212_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2097367_2097550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2097562_2097694_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2097921_2098107_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2098633_2098948_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2099029_2099254_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2099648_2100158_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001302857.1|2100129_2102058_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|2102041_2102248_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2102244_2103837_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2102783:2102798	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
WP_001254002.1|2103826_2105332_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2105368_2105716_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2105773_2106040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|2106021_2106762_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2106775_2107207_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2107233_2107647_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000847298.1|2110198_2110528_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_138625799.1|2110937_2111969_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.6	1.1e-172
WP_122997399.1|2111914_2112547_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.7	3.5e-102
WP_001303882.1|2112500_2112707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000649829.1|2112737_2113265_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515111.1|2113398_2116872_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.5	0.0e+00
WP_001230444.1|2116939_2117539_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268962.1|2117603_2118917_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001023352.1|2118918_2119188_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001303884.1|2120520_2120703_-	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.7	1.1e-21
WP_001301613.1|2121320_2122439_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|2122435_2124229_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|2124247_2124955_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|2124951_2125539_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP040572	Escherichia coli O157:H7 strain ECP17-46 chromosome, complete genome	5475399	2385989	2506550	5475399	holin,head,transposase,tail,lysis,capsid,terminase,protease,integrase,tRNA,portal	Enterobacteria_phage(37.61%)	157	2450597:2450612	2480164:2480179
WP_000952736.1|2385989_2386811_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|2386966_2388013_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|2388009_2388804_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|2388970_2390089_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|2390057_2390327_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|2390388_2390778_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|2390910_2391426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|2391540_2391693_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|2392008_2392485_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|2392609_2392933_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|2392916_2393342_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|2393410_2394448_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_001301518.1|2394479_2394902_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_000451012.1|2394935_2395652_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_000017339.1|2395648_2395966_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_001310212.1|2395962_2396265_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|2396254_2396572_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|2396525_2396843_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|2396829_2397267_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|2397268_2397460_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|2397462_2398050_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|2398165_2398270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2398458_2398671_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|2398838_2399117_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265168.1|2399118_2400168_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001217410.1|2400180_2400555_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|2400551_2401373_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000216629.1|2401969_2402137_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023170.1|2402451_2404389_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|2404536_2404719_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|2404756_2405026_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|2405101_2405317_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|2405321_2405666_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2405716_2406250_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2406520_2407090_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2407089_2407236_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|2407463_2407670_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|2407734_2407959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|2408315_2408456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302295.1|2408585_2408771_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000279786.1|2408812_2409178_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|2409467_2410031_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|2410027_2411689_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2411752_2413690_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2413734_2413956_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_001356670.1|2413901_2416403_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	98.8	0.0e+00
WP_000126019.1|2416482_2416809_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2416818_2417169_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2417165_2417612_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2417608_2417953_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2418018_2418735_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2418749_2419124_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453698.1|2419219_2419429_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212850.1|2419481_2422724_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.7	0.0e+00
WP_000807950.1|2422716_2423058_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_001152182.1|2423057_2423756_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|2423772_2424027_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|2424136_2424247_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|2424549_2425428_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|2425481_2426219_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|2426164_2426401_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|2426413_2426503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2426522_2428871_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|2429461_2432863_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301834.1|2434966_2435092_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|2435171_2435447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|2435507_2436869_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303923.1|2436989_2437202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000799385.1|2437232_2438096_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2438079_2439216_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2439465_2440692_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|2440740_2441862_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000085256.1|2442110_2443340_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|2443704_2443893_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_125090562.1|2443942_2444269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226782.1|2444697_2444895_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|2444887_2445100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|2445089_2445554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|2445546_2445780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|2445785_2446085_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833628.1|2446081_2447482_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	5.6e-116
WP_000192401.1|2447682_2447934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|2447930_2448341_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|2448351_2448624_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301569.1|2448580_2448709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001132079.1|2448750_2448975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|2449226_2449433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|2449432_2450488_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|2450500_2450836_+|head	head decoration protein	head	NA	NA	NA	NA
2450597:2450612	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|2450848_2451262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|2451467_2452010_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|2452265_2452547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|2453147_2454608_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|2454607_2455279_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2455447_2456818_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|2456821_2457463_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|2457498_2458605_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2458658_2459120_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|2459129_2459783_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|2459954_2461205_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|2461318_2462461_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|2462450_2462687_-	excisionase	NA	NA	NA	NA	NA
WP_000945520.1|2462790_2463615_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000788869.1|2463611_2464313_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|2464309_2464612_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|2464679_2465012_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|2465076_2465199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709088.1|2465256_2466783_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_071525067.1|2466902_2467094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053040.1|2467284_2467740_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|2467739_2467910_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|2467902_2468193_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|2468189_2468552_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|2468548_2468689_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|2468685_2469375_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|2469696_2470002_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|2469988_2470465_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|2470681_2470864_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|2470954_2471248_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_085948178.1|2471450_2472663_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000079504.1|2472852_2473263_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|2473548_2473755_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|2473919_2474114_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|2474502_2475048_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|2475022_2476948_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|2476944_2477151_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2477147_2478749_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2478729_2480049_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2480058_2480391_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
2480164:2480179	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063265.1|2480446_2481472_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2481513_2481912_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|2481923_2482277_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|2482288_2482867_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|2482863_2483259_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|2483266_2484007_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|2484022_2484445_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|2484426_2484861_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|2484853_2487403_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|2487399_2487729_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|2487728_2488427_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|2488432_2489176_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|2489112_2489745_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|2489805_2493204_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|2493270_2493870_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|2493934_2496850_+	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|2496849_2497431_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|2497550_2498441_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|2498459_2498966_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|2499002_2499503_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|2499581_2499764_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|2500261_2500930_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|2500986_2501235_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|2501310_2501691_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2501687_2502035_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998042.1|2502084_2503623_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_001226373.1|2503925_2505410_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|2505596_2506550_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 7
NZ_CP040572	Escherichia coli O157:H7 strain ECP17-46 chromosome, complete genome	5475399	2605139	2679786	5475399	holin,head,transposase,tail,lysis,capsid,terminase,protease,integrase,portal	Enterobacteria_phage(35.09%)	88	2604963:2604990	2664258:2664285
2604963:2604990	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|2605139_2606270_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2606247_2606496_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|2606560_2609032_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090196.1|2609124_2609316_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2609312_2609501_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|2609898_2610066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2610059_2610293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2610270_2610678_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|2610700_2610919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2610991_2611291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2611554_2611962_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2612038_2612266_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|2612249_2612801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2612772_2613813_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_001302276.1|2613844_2614267_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000774808.1|2614453_2615035_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|2615031_2615196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2615894_2616653_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|2616931_2617144_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|2617364_2617622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2617691_2617970_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|2617971_2619018_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|2619030_2619390_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|2619398_2619929_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2620170_2620368_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_064761991.1|2622067_2622253_+	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
WP_000143067.1|2622372_2624226_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|2624375_2624591_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|2624595_2624940_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2624990_2625524_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2625794_2626364_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2626363_2626510_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001082601.1|2626517_2626985_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	92.2	1.1e-71
WP_001302717.1|2627448_2627763_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2627844_2628069_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_032161313.1|2628084_2628342_-	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	91.4	1.3e-10
WP_000867498.1|2628455_2629001_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2628975_2630901_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2630897_2631104_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2631100_2632702_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2632682_2634002_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2634011_2634344_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2634399_2635425_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2635466_2635865_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2635876_2636230_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2636244_2636778_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2636774_2637170_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2637177_2637930_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2637943_2638366_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2638392_2638806_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_072643101.1|2638786_2641399_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	94.5	0.0e+00
WP_000847298.1|2641395_2641725_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2641724_2642423_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|2642433_2643177_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_122989782.1|2643122_2643752_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.6	2.7e-102
WP_072643102.1|2643992_2646818_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	72.0	0.0e+00
WP_001228334.1|2646885_2647485_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.0	1.0e-106
WP_000216534.1|2647636_2648941_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	3.9e-79
WP_001023474.1|2648942_2649212_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|2650238_2651564_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_024262009.1|2651831_2652020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106409364.1|2653161_2653284_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|2653390_2654302_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|2654367_2654937_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|2655902_2657441_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2657490_2657838_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001303943.1|2658554_2658833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2659260_2659407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2659543_2660191_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2660374_2660965_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001302903.1|2662693_2663122_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_000147167.1|2663715_2663934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079499.1|2664435_2664942_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2664258:2664285	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|2664987_2665488_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2665573_2665753_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2666133_2666940_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2666939_2668133_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001302292.1|2668144_2669503_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000763520.1|2669506_2671102_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|2671101_2672664_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2672755_2672800_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2672937_2673819_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2673815_2674436_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|2674463_2676047_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2676259_2677132_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2677171_2677762_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2677758_2678517_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2678736_2679786_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 8
NZ_CP040572	Escherichia coli O157:H7 strain ECP17-46 chromosome, complete genome	5475399	2951252	3041954	5475399	holin,head,transposase,tail,capsid,terminase,portal	Stx2-converting_phage(43.56%)	113	NA	NA
WP_000214712.1|2951252_2951456_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2951491_2952952_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2953040_2954324_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_016241229.1|2954383_2954698_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001480712.1|2954694_2954829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001143804.1|2954859_2955501_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2955582_2956212_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2956284_2956860_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_138625800.1|2956973_2957243_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	9.3e-44
WP_000268849.1|2957244_2958558_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.6	3.8e-82
WP_001230508.1|2958622_2959222_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000143597.1|2959289_2961803_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.5	0.0e+00
WP_072643105.1|2961799_2963368_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.6	3.9e-299
WP_050439450.1|2963710_2964343_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2964288_2965032_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001303180.1|2965042_2965741_-|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.4	2.9e-129
WP_000807954.1|2965740_2966082_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212925.1|2966074_2969317_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_001453698.1|2969368_2969578_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2969673_2970048_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2970053_2970770_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2970828_2971173_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2971169_2971616_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2971612_2971963_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000125988.1|2971972_2972299_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063023.1|2974339_2974561_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000173065.1|2974605_2976543_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.4	0.0e+00
WP_001303179.1|2976606_2978268_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.1	0.0e+00
WP_000958392.1|2978264_2978828_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
WP_001477518.1|2979019_2979154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032173279.1|2979116_2979482_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	98.3	4.9e-64
WP_000095736.1|2979523_2979751_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2980175_2980361_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2980588_2980735_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2980734_2981304_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|2981574_2982108_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|2982158_2982503_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000411805.1|2982507_2982714_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023184.1|2983161_2985012_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|2985489_2985921_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2986371_2987085_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2987220_2987418_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2987642_2988197_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2988259_2988565_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2988577_2989627_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191871.1|2989628_2989901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000756596.1|2990022_2990367_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2990486_2990699_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2990932_2991490_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2991491_2991710_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2991837_2992149_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2992141_2992369_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2992365_2992647_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2992679_2993396_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_001379651.1|2993429_2993852_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_001356791.1|2993883_2994939_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	84.7	1.6e-83
WP_000693878.1|2995007_2995433_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001416688.1|2996051_2996390_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2996682_2996835_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2996846_2997485_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2997485_2997695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2998259_2998448_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2998444_2998633_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2998725_2999970_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_016241229.1|3000608_3000923_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|3001885_3002266_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3002262_3002610_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3002659_3004198_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|3004780_3005431_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_010917823.1|3005415_3005763_-	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	96.8	6.1e-48
WP_001131642.1|3006141_3006717_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|3006830_3007100_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268842.1|3007101_3008325_-|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|3008389_3008989_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001304111.1|3009056_3009272_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_105626756.1|3009274_3012535_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.2	0.0e+00
WP_001179509.1|3012722_3013160_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_000807954.1|3013159_3013501_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212818.1|3013493_3016736_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_001453746.1|3016783_3016993_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3017088_3017463_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3017477_3018194_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3018259_3018604_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3018600_3019047_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3019043_3019394_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3019403_3019730_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001356761.1|3019732_3022312_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.0	0.0e+00
WP_001063099.1|3022257_3022479_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3022523_3024461_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001303187.1|3024524_3026186_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958392.1|3026182_3026746_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
WP_032173279.1|3027035_3027401_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	98.3	4.9e-64
WP_000095736.1|3027442_3027670_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3028094_3028280_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3028507_3028654_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3028653_3029223_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3029493_3030027_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731241.1|3030077_3030422_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000411805.1|3030426_3030633_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023202.1|3031081_3032932_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001303509.1|3033410_3033839_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001302069.1|3034322_3034445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217455.1|3035160_3035520_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|3035532_3036582_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|3036583_3036862_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3037029_3037242_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3037430_3037535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|3037650_3038235_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|3038291_3038687_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788938.1|3039497_3040238_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095669.1|3040244_3041207_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000693943.1|3041229_3041655_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|3041651_3041954_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 9
NZ_CP040572	Escherichia coli O157:H7 strain ECP17-46 chromosome, complete genome	5475399	3353799	3404921	5475399	tail,integrase,tRNA,transposase	Enterobacteria_phage(63.33%)	59	3347023:3347038	3405000:3405015
3347023:3347038	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|3353799_3355533_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|3355709_3356198_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|3356317_3356710_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|3356709_3358788_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|3358780_3359929_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|3360130_3360775_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|3360785_3361175_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|3361189_3362239_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|3362241_3363102_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|3363120_3364722_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|3364767_3366429_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|3366571_3367075_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|3367095_3369060_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|3369064_3369991_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|3369987_3370875_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|3371001_3371580_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|3371582_3371933_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|3372712_3373141_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000089029.1|3373147_3374572_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|3374546_3375347_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|3375513_3376500_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|3376514_3378029_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|3378098_3379088_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179461.1|3379884_3380388_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|3380467_3380719_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|3380833_3380920_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|3381181_3381505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|3381675_3382173_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|3382209_3382449_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|3382640_3383852_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|3383913_3384579_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|3384935_3385937_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|3385942_3386290_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|3386319_3386970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|3386985_3387390_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|3387479_3387617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|3387688_3387892_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|3387913_3388264_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|3388274_3388553_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|3388564_3388807_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|3388803_3388917_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|3389009_3389426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|3389449_3389653_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|3389649_3389916_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|3389912_3390212_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000775057.1|3390534_3390765_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000599379.1|3390837_3391203_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|3391209_3394032_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|3394108_3395068_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|3395072_3395387_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000257965.1|3396592_3397009_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000954203.1|3397052_3397625_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|3397781_3398270_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000763327.1|3401072_3401201_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665314.1|3401236_3401602_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|3401656_3402169_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|3402168_3403353_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|3403510_3403834_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161583.1|3403784_3404921_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
3405000:3405015	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 10
NZ_CP040572	Escherichia coli O157:H7 strain ECP17-46 chromosome, complete genome	5475399	3462502	3511016	5475399	holin,head,transposase,tail,protease,portal	Enterobacteria_phage(34.88%)	64	NA	NA
WP_001023455.1|3462502_3462772_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000268850.1|3462773_3464087_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.3	5.3e-84
WP_001230514.1|3464151_3464751_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_072643111.1|3464818_3468298_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.7	0.0e+00
WP_123007081.1|3468538_3469168_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	3.9e-101
WP_000194801.1|3469113_3469857_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001301816.1|3469867_3470566_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000847298.1|3470565_3470895_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082465.1|3470891_3473471_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.6	0.0e+00
WP_000533402.1|3473451_3473865_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3473891_3474323_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3474336_3475077_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3475058_3475325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|3475382_3475730_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3475766_3477272_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3477261_3478854_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3478850_3479057_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001301919.1|3480941_3481184_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000998048.1|3481233_3482772_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612598.1|3482821_3483169_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
WP_001171554.1|3483165_3483546_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3483621_3483897_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3484647_3484854_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_001303880.1|3484816_3485161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138558.1|3485109_3485382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303879.1|3485314_3485509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3485541_3486075_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3486295_3486409_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3486630_3486816_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3487343_3487658_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085948178.1|3487862_3489076_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000874392.1|3489251_3491102_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_042853491.1|3491219_3491423_+	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
WP_000261909.1|3491869_3492583_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|3492677_3492917_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265265.1|3493203_3494022_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3494173_3494545_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3494534_3494906_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3494918_3495968_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3495969_3496248_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|3496415_3496628_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|3496672_3496810_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_097561939.1|3496972_3497164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000160650.1|3497175_3497949_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3498300_3498714_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3498729_3499500_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788745.1|3499521_3500268_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
WP_001205823.1|3500274_3501366_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3501444_3501900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3502106_3502532_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3502515_3502788_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3502896_3503298_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3503325_3503517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3503516_3503804_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_071525099.1|3503805_3504024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|3504081_3504237_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3504378_3504768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3504954_3505140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303875.1|3505141_3505447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3505713_3505902_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3505898_3506090_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3506183_3508655_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3508722_3508965_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000375128.1|3510356_3511016_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
>prophage 11
NZ_CP040572	Escherichia coli O157:H7 strain ECP17-46 chromosome, complete genome	5475399	3741942	3780043	5475399	holin,tail,lysis,terminase,integrase,protease,portal	Enterobacteria_phage(48.84%)	53	3741527:3741541	3780117:3780131
3741527:3741541	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3741942_3742641_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_096976694.1|3742693_3742897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951025.1|3742871_3743753_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.8	1.1e-146
WP_072127173.1|3743922_3744084_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3744580_3745600_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3745633_3746614_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3746790_3747060_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741889.1|3747061_3748378_-|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	95.6	1.2e-70
WP_001233141.1|3748437_3749037_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3749107_3752521_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3752581_3753190_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3753126_3753870_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3753875_3754574_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3754583_3754913_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3754912_3757978_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3757949_3758279_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3758287_3758674_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3758734_3759478_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3759488_3759890_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3759886_3760465_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3760476_3760752_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3760744_3761068_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136596.1|3761154_3763182_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_127446149.1|3763126_3763462_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3763583_3764708_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3764635_3764848_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934096.1|3764844_3766947_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000349509.1|3766946_3767438_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001303851.1|3767427_3767706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001139679.1|3768112_3768265_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3768252_3768720_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3768716_3769214_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3769213_3769429_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3769571_3769970_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3770050_3770209_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3770294_3771038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3771221_3771911_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3771925_3772048_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3772385_3773345_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3773556_3774222_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3774218_3774839_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3774831_3775002_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3774998_3775181_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3775878_3776559_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3776555_3776738_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3776710_3776902_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3776912_3777194_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3777292_3777514_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3777724_3778327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525073.1|3778451_3778637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3778569_3778737_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3778776_3778995_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3778972_3780043_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3780117:3780131	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 12
NZ_CP040572	Escherichia coli O157:H7 strain ECP17-46 chromosome, complete genome	5475399	4323250	4420281	5475399	plate,tail,integrase,transposase	Enterobacteria_phage(26.67%)	99	4349774:4349792	4406468:4406486
WP_000998048.1|4323250_4324789_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4324838_4325186_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4325182_4325563_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4325826_4326090_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4326089_4326230_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4326299_4326491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303810.1|4326552_4326843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4327315_4327858_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4327932_4328520_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4328577_4329246_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4329271_4331797_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001265657.1|4331786_4333430_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4333398_4334109_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001303809.1|4334421_4334751_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4334998_4335613_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4336030_4336720_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4336716_4337673_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667043.1|4337669_4339868_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4339877_4340834_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4341012_4342140_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4342281_4343340_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4343585_4344488_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4345190_4345469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4345635_4346358_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4346456_4347356_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4348031_4348988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4349120_4351454_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
4349774:4349792	attL	GTCCGGCCCCGTCACCGCT	NA	NA	NA	NA
WP_000562750.1|4351467_4351791_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4351790_4352012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4352008_4352566_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4352562_4352823_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000968317.1|4354506_4355058_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4355063_4355336_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_100068595.1|4355483_4355687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350115.1|4355745_4356312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695296.1|4356311_4356515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647286.1|4356511_4356901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4356931_4357564_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4357556_4358015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4358014_4358632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4358604_4359021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4359024_4360206_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4361168_4361912_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000355475.1|4362735_4363509_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4363566_4364121_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115553.1|4364150_4364561_+|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000344820.1|4364581_4365025_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000805544.1|4364996_4365590_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_001096963.1|4365589_4366384_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000788819.1|4366383_4366695_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4367646_4367940_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4368058_4368259_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4368359_4369073_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708831.1|4369200_4369584_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.2	4.4e-07
WP_085948178.1|4369609_4370822_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303805.1|4371149_4371395_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4372464_4373718_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4373729_4374833_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4375120_4376176_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4376214_4376616_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4376673_4377918_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4378009_4378468_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4378728_4380186_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_077626217.1|4380242_4380779_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4380711_4380978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4381284_4381737_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4381746_4382145_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4382147_4382441_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4382492_4383548_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001301640.1|4383618_4384389_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001303130.1|4384348_4386088_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4386905_4387679_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4387864_4388125_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4388143_4388404_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4388559_4389300_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4389270_4390038_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4390142_4390721_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4390960_4393405_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|4393447_4393921_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4394074_4394845_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4394962_4396135_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4396215_4396401_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4396315_4396579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4396780_4398541_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4398543_4399680_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001690273.1|4400426_4401026_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_100199880.1|4401094_4402402_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	6.1e-24
WP_000509129.1|4403641_4407874_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
4406468:4406486	attR	GTCCGGCCCCGTCACCGCT	NA	NA	NA	NA
WP_000103125.1|4407949_4410091_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|4410300_4410819_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4411515_4412016_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4412050_4412275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4412325_4413717_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4413807_4414221_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4414224_4416075_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4416038_4417121_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4417145_4418426_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4418422_4418947_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4418949_4420281_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 13
NZ_CP040572	Escherichia coli O157:H7 strain ECP17-46 chromosome, complete genome	5475399	4858531	4917542	5475399	protease,transposase	Klosneuvirus(12.5%)	60	NA	NA
WP_001162171.1|4858531_4859884_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4859977_4860529_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4860684_4862058_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4862233_4863232_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4863264_4864260_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4864246_4865269_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000265942.1|4866924_4867881_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4868190_4868721_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4868800_4869151_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4869144_4869396_-	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_001219160.1|4869607_4869949_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060931.1|4869951_4873731_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4873727_4875461_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4875666_4876305_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4876627_4877971_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4878049_4878256_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|4878580_4879135_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937659.1|4879197_4880136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4880347_4881088_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|4881277_4883221_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4883338_4883719_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4883807_4884668_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4884775_4885741_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4885848_4886511_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4886555_4887968_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4888276_4888897_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4889114_4889753_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4889887_4891096_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4891103_4891535_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4892157_4892952_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4893022_4893472_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4893513_4893741_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4893745_4894060_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4894066_4894462_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4894788_4895064_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4895192_4895879_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000949515.1|4895878_4896733_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000056760.1|4896742_4897393_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4897406_4897871_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4897880_4898186_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|4898201_4899599_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|4899953_4901018_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|4901125_4901881_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|4901877_4902627_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4902808_4903138_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4903286_4903562_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4903678_4905304_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4905387_4906551_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4906553_4907192_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4907201_4907600_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|4907617_4908277_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4908327_4909026_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4909044_4909446_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4909572_4910304_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|4910484_4912926_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|4912964_4913390_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4913594_4914893_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4914996_4915194_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4915275_4916280_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4916282_4917542_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 14
NZ_CP040572	Escherichia coli O157:H7 strain ECP17-46 chromosome, complete genome	5475399	5054421	5069086	5475399	tail,integrase,tRNA	Enterobacteria_phage(37.5%)	19	5050262:5050277	5067791:5067806
5050262:5050277	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5054421_5055837_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5055919_5056903_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5057068_5057311_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5057444_5058482_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5058570_5059668_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5059729_5059978_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5060138_5060780_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5060861_5061491_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5061563_5062136_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5062247_5062517_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268962.1|5062518_5063832_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230514.1|5063896_5064496_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5065817_5066354_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5066344_5066695_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5066691_5066976_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001449563.1|5066985_5067165_+	hypothetical protein	NA	H9C170	Pectobacterium_phage	76.3	1.2e-20
WP_000829415.1|5067311_5067509_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5067853_5068135_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5067791:5067806	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000956557.1|5068552_5069086_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP040573	Escherichia coli O157:H7 strain ECP17-46 plasmid pCFSAN059540, complete sequence	94177	24023	76200	94177	protease,integrase,transposase	Macacine_betaherpesvirus(30.77%)	49	54968:54982	75925:75939
WP_001034100.1|24023_27926_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_071525077.1|29323_29503_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001302199.1|30104_30926_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|30925_32032_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|32121_33843_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|33916_34915_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|35282_35663_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|35659_36007_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|36056_37595_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001302198.1|37970_38186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001358886.1|38248_40945_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|41031_41907_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001449993.1|41964_43875_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|43874_45380_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173152.1|45381_46605_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|46635_47070_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_000082929.1|47066_47621_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000173396.1|47635_47983_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082782.1|47979_48579_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000776550.1|48575_49553_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_071525076.1|49591_50764_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|50750_51263_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|51320_52154_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|52245_52647_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000520917.1|54561_55053_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
54968:54982	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000217733.1|55054_58051_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|58100_60221_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|60224_61664_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_001303402.1|61730_61925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358890.1|61954_62239_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001302186.1|62239_62437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891288.1|62407_62638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|62758_63499_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|63783_64761_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_071525074.1|65073_65262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708307.1|65168_65369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|65365_65986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|65982_66666_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|67124_67343_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|67344_67650_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|67650_68457_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_077631973.1|69133_69214_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_085948178.1|69179_70393_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000772446.1|71396_72563_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|72562_73534_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_001349526.1|73918_74191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000273919.1|74228_75131_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|75134_75440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|75516_76200_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
75925:75939	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
