The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040644	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-0432 chromosome, complete genome	4680325	1120165	1186990	4680325	lysis,tRNA,portal,transposase,plate,capsid,head,tail,integrase,terminase	Salmonella_phage(91.49%)	65	1120449:1120463	1156413:1156427
WP_089113803.1|1120165_1121276_+|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
1120449:1120463	attL	TGAGCTGGTCACTCA	NA	NA	NA	NA
WP_000445376.1|1122072_1122876_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_001142974.1|1123274_1123868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000360326.1|1124129_1124792_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_000218402.1|1125344_1126361_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000932273.1|1126363_1126996_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000102105.1|1127117_1127360_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000460848.1|1127393_1127903_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000956190.1|1127910_1128111_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000963474.1|1128074_1128416_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_001244219.1|1128483_1128717_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000752613.1|1128716_1128944_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104187.1|1128940_1129798_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000017507.1|1129794_1132209_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_001154433.1|1132361_1132550_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_077681938.1|1132488_1132794_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.8e-35
WP_001673609.1|1132907_1133585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284991.1|1133898_1135563_+	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001542203.1|1135666_1136707_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001098395.1|1136706_1138473_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_000216276.1|1138615_1139449_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_000730759.1|1139465_1140527_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
WP_000059173.1|1140530_1141181_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000673537.1|1141274_1141739_+|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000868184.1|1141738_1141942_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1141945_1142161_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069923.1|1142141_1142657_+	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000196199.1|1142653_1143082_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_072100776.1|1143011_1143215_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	92.5	8.3e-29
WP_001039958.1|1143177_1143609_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000343949.1|1143601_1144048_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_000958562.1|1144049_1144901_-	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_001672413.1|1144978_1145557_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000189373.1|1145553_1145913_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_000268332.1|1145899_1146808_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_001086804.1|1146800_1147406_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_001274649.1|1147402_1149256_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_000143187.1|1149255_1149831_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_000974843.1|1150700_1150925_+	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000046108.1|1151027_1152200_+|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
WP_001207651.1|1152209_1152725_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_001280963.1|1152779_1153082_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_000763316.1|1153096_1153216_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001282768.1|1153208_1156016_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.9	0.0e+00
WP_000980411.1|1156012_1156498_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
1156413:1156427	attR	TGAGTGACCAGCTCA	NA	NA	NA	NA
WP_001102269.1|1156494_1157595_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980500.1|1157663_1157882_+	hypothetical protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_012543392.1|1158433_1159597_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000196151.1|1159604_1161785_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533863.1|1161781_1163191_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237694.1|1163255_1174730_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1175344_1175827_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1175976_1176453_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1176442_1176733_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1176898_1177237_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1177385_1179047_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059151.1|1179132_1180011_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1180134_1180725_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287926.1|1180759_1181365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1181485_1182772_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1182791_1183583_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1183748_1185110_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1185362_1185611_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1185629_1186178_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|1186222_1186990_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP040644	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-0432 chromosome, complete genome	4680325	1449501	1455561	4680325		Salmonella_virus(50.0%)	6	NA	NA
WP_108630384.1|1449501_1449753_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	7.6e-08
WP_105789228.1|1449691_1449835_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_000400616.1|1450824_1452747_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_000703599.1|1452764_1453019_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_001576268.1|1452987_1453377_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000377779.1|1454619_1455561_-	membrane protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
>prophage 3
NZ_CP040644	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-0432 chromosome, complete genome	4680325	1691995	1701166	4680325	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1691995_1692943_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1692926_1693658_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1693638_1693746_-	protein YohO	NA	NA	NA	NA	NA
WP_001240421.1|1693805_1694537_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_000272845.1|1694759_1696445_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1696441_1697161_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|1697207_1697675_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|1697731_1698262_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|1698433_1698892_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|1699132_1701166_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 4
NZ_CP040644	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-0432 chromosome, complete genome	4680325	1768363	1778870	4680325		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144948.1|1768363_1769767_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|1769944_1770838_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697848.1|1771214_1772300_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|1772299_1773199_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|1773246_1774125_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1774125_1774677_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|1774682_1775657_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1775672_1776446_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|1776450_1777530_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1777556_1778870_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_CP040644	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-0432 chromosome, complete genome	4680325	2430892	2446836	4680325	holin,tRNA	Escherichia_phage(62.5%)	22	NA	NA
WP_001082296.1|2430892_2431327_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159240.1|2431376_2431715_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000089155.1|2431707_2431860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000802786.1|2432560_2433106_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000445513.1|2433102_2433384_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_001688615.1|2433373_2433562_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000900605.1|2433483_2433879_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_000640113.1|2436049_2436586_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|2436582_2436873_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|2436872_2437472_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000882662.1|2437995_2438208_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556389.1|2438577_2439510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|2439506_2440061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|2440222_2440552_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|2440824_2441292_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|2441676_2441832_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|2441939_2442461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|2442898_2443120_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|2443204_2443522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|2443549_2444167_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|2444483_2445419_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|2445462_2446836_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 6
NZ_CP040644	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-0432 chromosome, complete genome	4680325	2671268	2687383	4680325	tail,holin,lysis,integrase	Salmonella_phage(30.77%)	17	2667898:2667927	2687519:2687548
2667898:2667927	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_072100756.1|2671268_2672132_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
WP_001152416.1|2674772_2675468_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|2675557_2676091_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|2676985_2677465_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2677482_2677935_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2677918_2678248_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|2678523_2679210_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|2679570_2680020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|2680393_2680918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|2681014_2681704_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|2681833_2682061_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|2682057_2682657_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000972675.1|2682720_2683026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001676972.1|2683448_2683640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138624228.1|2683657_2685637_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.2	3.6e-161
WP_001575998.1|2686050_2686329_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|2686303_2687383_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
2687519:2687548	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 7
NZ_CP040644	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-0432 chromosome, complete genome	4680325	2859775	2900473	4680325	tail,protease	Salmonella_phage(28.57%)	40	NA	NA
WP_000938186.1|2859775_2860456_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|2861074_2861734_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|2861820_2862150_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2862146_2862428_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|2862476_2863256_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2863281_2863830_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|2864044_2865256_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2865313_2865631_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975204.1|2865675_2866092_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2866262_2866925_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2867019_2867478_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_138624231.1|2867513_2869568_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2869691_2870138_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2870156_2872310_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2872296_2872902_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288733.1|2873118_2873628_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2873984_2875037_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2875108_2875561_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2875746_2877507_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2877575_2878094_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2878193_2878361_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2878616_2879180_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2879176_2880817_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|2880821_2882075_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2882089_2883997_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2884009_2886118_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|2886216_2887326_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|2887322_2887865_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2888030_2889041_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|2889248_2891861_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|2892287_2892479_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2892749_2893436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2893795_2894422_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2895069_2896038_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_072100753.1|2896263_2896512_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_000143167.1|2896515_2897097_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|2897096_2898806_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000729406.1|2898802_2899429_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000274547.1|2899412_2900042_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_001676370.1|2900062_2900473_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
>prophage 8
NZ_CP040644	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-0432 chromosome, complete genome	4680325	2971752	2979065	4680325	integrase,protease	Ralstonia_phage(16.67%)	7	2966549:2966563	2977801:2977815
2966549:2966563	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|2971752_2972130_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|2972291_2972489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2972701_2974978_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2975008_2975329_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2975652_2975874_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|2976003_2977950_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2977801:2977815	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|2977946_2979065_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
NZ_CP040645	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-0432 plasmid pCFSAN074386, complete sequence	59372	13141	20049	59372	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_001541564.1|13141_13558_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|13741_14077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176303.1|14133_14739_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728919.1|14735_15677_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000427676.1|16091_17297_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_077681951.1|17293_18271_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	6.7e-84
WP_000457542.1|18352_19627_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_000925628.1|19626_20049_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
