The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040646	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-H9654 chromosome, complete genome	4679507	1119364	1186189	4679507	capsid,plate,lysis,transposase,integrase,head,tRNA,portal,tail,terminase	Salmonella_phage(91.49%)	65	1119648:1119662	1155612:1155626
WP_089113803.1|1119364_1120475_+|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
1119648:1119662	attL	TGAGCTGGTCACTCA	NA	NA	NA	NA
WP_000445376.1|1121271_1122075_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_001142974.1|1122473_1123067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000360326.1|1123328_1123991_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_000218402.1|1124543_1125560_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_138642905.1|1125562_1126195_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	4.8e-59
WP_000102105.1|1126316_1126559_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000460848.1|1126592_1127102_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000956190.1|1127109_1127310_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000963474.1|1127273_1127615_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_001244219.1|1127682_1127916_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000752613.1|1127915_1128143_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104187.1|1128139_1128997_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000017507.1|1128993_1131408_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_001154433.1|1131560_1131749_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_077681938.1|1131687_1131993_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.8e-35
WP_001673609.1|1132106_1132784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284991.1|1133097_1134762_+	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001542203.1|1134865_1135906_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001098395.1|1135905_1137672_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_000216276.1|1137814_1138648_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_000730759.1|1138664_1139726_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
WP_000059173.1|1139729_1140380_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000673537.1|1140473_1140938_+|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000868184.1|1140937_1141141_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1141144_1141360_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069923.1|1141340_1141856_+	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000196199.1|1141852_1142281_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_072100776.1|1142210_1142414_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	92.5	8.3e-29
WP_001039958.1|1142376_1142808_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000343949.1|1142800_1143247_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_000958562.1|1143248_1144100_-	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_001672413.1|1144177_1144756_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000189373.1|1144752_1145112_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_000268332.1|1145098_1146007_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_001086804.1|1145999_1146605_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_001274649.1|1146601_1148455_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_000143187.1|1148454_1149030_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_000974843.1|1149899_1150124_+	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000046108.1|1150226_1151399_+|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
WP_001207651.1|1151408_1151924_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_001280963.1|1151978_1152281_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_000763316.1|1152295_1152415_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001282768.1|1152407_1155215_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.9	0.0e+00
WP_000980411.1|1155211_1155697_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
1155612:1155626	attR	TGAGTGACCAGCTCA	NA	NA	NA	NA
WP_001102269.1|1155693_1156794_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980500.1|1156862_1157081_+	hypothetical protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_012543392.1|1157632_1158796_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000196151.1|1158803_1160984_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533863.1|1160980_1162390_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237693.1|1162454_1173929_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1174543_1175026_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1175175_1175652_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1175641_1175932_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1176097_1176436_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1176584_1178246_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059151.1|1178331_1179210_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1179333_1179924_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287926.1|1179958_1180564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1180684_1181971_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1181990_1182782_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1182947_1184309_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1184561_1184810_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1184828_1185377_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|1185421_1186189_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP040646	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-H9654 chromosome, complete genome	4679507	1448700	1454753	4679507		Salmonella_virus(50.0%)	6	NA	NA
WP_105789229.1|1448700_1448868_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	63.5	1.3e-11
WP_105789228.1|1448883_1449027_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_000400616.1|1450016_1451939_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_000703599.1|1451956_1452211_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_001576268.1|1452179_1452569_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000377779.1|1453811_1454753_-	membrane protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
>prophage 3
NZ_CP040646	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-H9654 chromosome, complete genome	4679507	1691187	1700358	4679507	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1691187_1692135_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1692118_1692850_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1692830_1692938_-	protein YohO	NA	NA	NA	NA	NA
WP_001240421.1|1692997_1693729_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_000272845.1|1693951_1695637_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1695633_1696353_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|1696399_1696867_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|1696923_1697454_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|1697625_1698084_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|1698324_1700358_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 4
NZ_CP040646	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-H9654 chromosome, complete genome	4679507	1767555	1778062	4679507		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144948.1|1767555_1768959_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|1769136_1770030_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697848.1|1770406_1771492_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|1771491_1772391_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|1772438_1773317_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1773317_1773869_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000018223.1|1773874_1774849_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1774864_1775638_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|1775642_1776722_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1776748_1778062_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_CP040646	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-H9654 chromosome, complete genome	4679507	2430090	2446034	4679507	tRNA,holin	Escherichia_phage(62.5%)	22	NA	NA
WP_001082296.1|2430090_2430525_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159240.1|2430574_2430913_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000089155.1|2430905_2431058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000802786.1|2431758_2432304_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000445513.1|2432300_2432582_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_001688615.1|2432571_2432760_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000900605.1|2432681_2433077_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_000640113.1|2435247_2435784_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|2435780_2436071_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|2436070_2436670_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000882662.1|2437193_2437406_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556389.1|2437775_2438708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|2438704_2439259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|2439420_2439750_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|2440022_2440490_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|2440874_2441030_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|2441137_2441659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|2442096_2442318_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|2442402_2442720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|2442747_2443365_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|2443681_2444617_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|2444660_2446034_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 6
NZ_CP040646	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-H9654 chromosome, complete genome	4679507	2670466	2686581	4679507	tail,holin,lysis,integrase	Salmonella_phage(30.77%)	17	2667096:2667125	2686717:2686746
2667096:2667125	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_072100756.1|2670466_2671330_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
WP_001152416.1|2673970_2674666_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|2674755_2675289_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|2676183_2676663_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2676680_2677133_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2677116_2677446_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|2677721_2678408_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|2678768_2679218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|2679591_2680116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|2680212_2680902_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|2681031_2681259_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|2681255_2681855_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000972675.1|2681918_2682224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001676972.1|2682646_2682838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|2682855_2684835_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|2685248_2685527_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|2685501_2686581_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
2686717:2686746	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 7
NZ_CP040646	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-H9654 chromosome, complete genome	4679507	2858973	2899671	4679507	tail,protease	Salmonella_phage(28.57%)	40	NA	NA
WP_000938186.1|2858973_2859654_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|2860272_2860932_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|2861018_2861348_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2861344_2861626_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|2861674_2862454_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2862479_2863028_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|2863242_2864454_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2864511_2864829_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975204.1|2864873_2865290_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2865460_2866123_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2866217_2866676_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2866711_2868766_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2868889_2869336_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2869354_2871508_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2871494_2872100_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288733.1|2872316_2872826_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2873182_2874235_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2874306_2874759_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2874944_2876705_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2876773_2877292_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2877391_2877559_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2877814_2878378_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2878374_2880015_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|2880019_2881273_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2881287_2883195_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_061204300.1|2883207_2885316_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|2885414_2886524_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|2886520_2887063_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2887228_2888239_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|2888446_2891059_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|2891485_2891677_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2891947_2892634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2892993_2893620_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2894267_2895236_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_072100753.1|2895461_2895710_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_000143167.1|2895713_2896295_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|2896294_2898004_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000729406.1|2898000_2898627_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000274547.1|2898610_2899240_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_001676370.1|2899260_2899671_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
>prophage 8
NZ_CP040646	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-H9654 chromosome, complete genome	4679507	2970950	2978263	4679507	protease,integrase	Ralstonia_phage(16.67%)	7	2965747:2965761	2976999:2977013
2965747:2965761	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|2970950_2971328_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|2971489_2971687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2971899_2974176_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2974206_2974527_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2974850_2975072_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|2975201_2977148_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2976999:2977013	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|2977144_2978263_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
NZ_CP040647	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-H9654 plasmid pCFSAN074385, complete sequence	59372	0	5754	59372	transposase	Escherichia_phage(50.0%)	6	NA	NA
WP_077681951.1|624_1602_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	6.7e-84
WP_000427676.1|1598_2804_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728919.1|3218_4160_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000176303.1|4156_4762_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|4818_5154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|5337_5754_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
>prophage 2
NZ_CP040647	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-H9654 plasmid pCFSAN074385, complete sequence	59372	9302	9863	59372		Ralstonia_phage(100.0%)	1	NA	NA
WP_001240330.1|9302_9863_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	43.2	1.5e-32
>prophage 3
NZ_CP040647	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-H9654 plasmid pCFSAN074385, complete sequence	59372	15369	15534	59372		Salmonella_phage(100.0%)	1	NA	NA
WP_001576629.1|15369_15534_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
>prophage 4
NZ_CP040647	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-H9654 plasmid pCFSAN074385, complete sequence	59372	20476	21309	59372	transposase	Helicobacter_phage(50.0%)	2	NA	NA
WP_000064919.1|20476_20902_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	3.4e-24
WP_001541541.1|20958_21309_+	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
>prophage 5
NZ_CP040647	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-H9654 plasmid pCFSAN074385, complete sequence	59372	24369	25152	59372	integrase	Macacine_betaherpesvirus(100.0%)	1	16393:16405	29272:29284
16393:16405	attL	CCTTTGCCCGACA	NA	NA	NA	NA
WP_000082169.1|24369_25152_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
WP_000082169.1|24369_25152_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
29272:29284	attR	CCTTTGCCCGACA	NA	NA	NA	NA
>prophage 6
NZ_CP040647	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-H9654 plasmid pCFSAN074385, complete sequence	59372	28991	30908	59372		Salmonella_phage(50.0%)	3	NA	NA
WP_000461382.1|28991_29981_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.9	5.0e-103
WP_015059604.1|30307_30469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000751876.1|30521_30908_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	46.9	3.0e-27
>prophage 7
NZ_CP040647	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-H9654 plasmid pCFSAN074385, complete sequence	59372	40476	41034	59372		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000725064.1|40476_41034_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	37.4	5.8e-24
>prophage 8
NZ_CP040647	Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-H9654 plasmid pCFSAN074385, complete sequence	59372	58218	58641	59372		Morganella_phage(100.0%)	1	NA	NA
WP_000925628.1|58218_58641_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
