The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040651	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 chromosome, complete genome	4925949	244167	309500	4925949	plate,transposase,tRNA,protease	uncultured_Mediterranean_phage(10.0%)	55	NA	NA
WP_000753958.1|244167_245595_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	4.2e-26
WP_000929420.1|245747_246905_+	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000272193.1|246993_247380_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_000017194.1|247626_248928_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001186673.1|248964_249789_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_001094519.1|249818_252491_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018214.1|252727_253522_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246886.1|253972_254698_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000808106.1|254955_255807_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224567.1|255951_256677_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622423.1|256823_257381_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811905.1|257521_258718_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_000947413.1|259030_259789_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	42.2	1.9e-25
WP_000922422.1|259801_260659_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000949017.1|260670_262023_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240935.1|262054_264469_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758966.1|264591_265077_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139265.1|265080_266106_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210741.1|266211_266667_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565950.1|266670_267459_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000741212.1|267458_268607_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569412.1|268603_269200_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	1.5e-25
WP_001294826.1|269223_272706_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055753.1|272718_273678_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_000502119.1|273872_274331_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_000524168.1|274569_276333_+	chitinase	NA	NA	NA	NA	NA
WP_001021054.1|276408_278550_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901088.1|278605_278995_+	VOC family protein	NA	NA	NA	NA	NA
WP_000210056.1|279057_280350_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062330.1|280433_280694_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000955207.1|280680_280899_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185319.1|281078_281624_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000560527.1|281620_282043_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000252573.1|282074_282776_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001260683.1|282849_284568_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000093986.1|284678_285386_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202315.1|285382_285787_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874215.1|285905_286721_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001287486.1|286759_287413_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000594021.1|287405_288437_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
WP_001051726.1|288626_289193_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000154871.1|295452_296256_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	2.1e-38
WP_000648534.1|296276_297191_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001127538.1|297295_298471_+	MFS transporter	NA	NA	NA	NA	NA
WP_001230968.1|298602_299403_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000207224.1|299480_300251_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644706.1|300306_301674_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_001052775.1|301745_302501_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000801238.1|302535_303258_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917872.1|303254_303722_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_001670675.1|303785_304517_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000367626.1|305048_306104_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_000145244.1|306114_307110_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000371508.1|307106_308990_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000108007.1|309005_309500_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP040651	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 chromosome, complete genome	4925949	365350	409332	4925949	integrase,portal,terminase,lysis,tail	Salmonella_phage(87.69%)	66	356120:356136	417627:417643
356120:356136	attL	GATATTGAAATTCGCGT	NA	NA	NA	NA
WP_001043675.1|365350_366403_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|366685_367789_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|367800_369051_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_010835868.1|369256_370420_-|integrase	site-specific integrase	integrase	A0A192Y6Q1	Salmonella_phage	100.0	3.7e-230
WP_016048814.1|370649_371000_-	hypothetical protein	NA	A0A192Y649	Salmonella_phage	100.0	8.3e-61
WP_016048815.1|371070_371739_-	DUF551 domain-containing protein	NA	A0A192Y7X3	Salmonella_phage	100.0	2.5e-130
WP_010835870.1|371742_371931_-	hypothetical protein	NA	A0A192Y8X2	Salmonella_phage	100.0	4.6e-26
WP_010835871.1|372053_372341_-	hypothetical protein	NA	A0A192Y6Q6	Salmonella_phage	100.0	4.3e-47
WP_010835872.1|372351_372645_-	DUF2856 family protein	NA	A0A192Y654	Salmonella_phage	100.0	1.9e-50
WP_016048817.1|372691_372976_-	sigma-70 family RNA polymerase sigma factor	NA	A0A192Y7Y0	Salmonella_phage	100.0	4.0e-45
WP_010835873.1|372975_373683_-	Recombination protein	NA	A0A192Y8X7	Salmonella_phage	100.0	1.1e-139
WP_016048818.1|373691_373880_-	hypothetical protein	NA	I1TEE9	Salmonella_phage	100.0	1.3e-28
WP_033566940.1|373964_374240_-	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	96.7	2.5e-44
WP_010835874.1|374374_374740_-	hypothetical protein	NA	A0A192Y658	Salmonella_phage	100.0	3.6e-59
WP_023890943.1|374883_375462_+	superinfection exclusion protein B	NA	A0A192Y7Z0	Salmonella_phage	100.0	8.8e-100
WP_016048819.1|375482_375866_-	hypothetical protein	NA	A0A192Y8Y8	Salmonella_phage	100.0	3.0e-64
WP_102981635.1|375816_376020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000834165.1|376197_376401_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	100.0	9.1e-28
WP_001532928.1|376439_377519_-	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_001104735.1|377652_378306_-	LexA family transcriptional regulator	NA	C6ZR47	Salmonella_phage	100.0	4.6e-129
WP_001059982.1|378415_378625_+	helix-turn-helix transcriptional regulator	NA	I6S1U2	Salmonella_phage	100.0	2.1e-35
WP_000424138.1|378758_379049_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	100.0	2.4e-45
WP_010835877.1|379217_380039_+	replication protein	NA	A0A192Y6S6	Salmonella_phage	100.0	5.2e-154
WP_016048822.1|380035_381412_+	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	100.0	1.5e-254
WP_000248681.1|381484_381691_+	hypothetical protein	NA	A0A192Y802	Salmonella_phage	100.0	1.1e-31
WP_016048823.1|381705_381903_+	hypothetical protein	NA	A0A192Y900	Salmonella_phage	100.0	3.4e-27
WP_023890942.1|382163_382427_+	hypothetical protein	NA	A0A192Y6R5	Salmonella_phage	100.0	8.2e-45
WP_016048826.1|382651_383089_+	recombination protein NinB	NA	A0A192Y6T2	Salmonella_phage	100.0	1.3e-79
WP_023890941.1|383085_383259_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	98.2	2.0e-31
WP_016048827.1|383225_383402_+	NinE family protein	NA	A0A1V0E5I9	Salmonella_phage	100.0	4.6e-28
WP_016048828.1|383404_383746_+	DUF2591 family protein	NA	A0A192Y677	Salmonella_phage	100.0	1.2e-64
WP_010835878.1|383738_383915_+	protein ninF	NA	A0A192Y808	Salmonella_phage	100.0	6.7e-27
WP_010835879.1|383907_384177_+	hypothetical protein	NA	A0A192Y905	Salmonella_phage	100.0	1.6e-43
WP_000002244.1|384176_384467_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	100.0	1.0e-51
WP_016048829.1|384463_384859_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y6T7	Salmonella_phage	100.0	3.1e-72
WP_001287665.1|384855_385425_+	HNH endonuclease	NA	A0A192Y683	Salmonella_phage	100.0	1.1e-107
WP_000149880.1|385421_385625_+	protein ninH	NA	A0A1V0E5I5	Salmonella_phage	100.0	5.5e-33
WP_016048830.1|385605_385785_+	hypothetical protein	NA	A0A192Y814	Salmonella_phage	100.0	7.1e-24
WP_000027541.1|385781_386300_+	DUF1133 family protein	NA	A0A192Y911	Salmonella_phage	100.0	9.0e-96
WP_000286100.1|386763_386967_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_023890940.1|386944_387442_+	lysozyme	NA	A0A192Y6U3	Salmonella_phage	100.0	3.8e-91
WP_010835883.1|387438_387906_+|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	100.0	1.0e-77
WP_071991695.1|387940_388132_+	hypothetical protein	NA	A0A192Y819	Salmonella_phage	100.0	7.0e-30
WP_016048832.1|388118_388805_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	100.0	1.6e-124
WP_000808100.1|389115_389358_+	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
WP_016048833.1|389360_389765_+	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	100.0	4.0e-67
WP_000729925.1|389768_390257_+	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_010835897.1|390234_391734_+|terminase	terminase large subunit	terminase	I1TEI5	Salmonella_phage	100.0	8.2e-307
WP_010835896.1|391734_393909_+|portal	portal protein	portal	I1TEI6	Salmonella_phage	100.0	0.0e+00
WP_000433852.1|393922_394834_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_010835895.1|394833_396126_+	protein Coat	NA	I1TEI8	Salmonella_phage	100.0	4.2e-243
WP_010835894.1|396164_396374_+	hypothetical protein	NA	I1TEI9	Salmonella_phage	100.0	2.8e-32
WP_010835893.1|396357_396858_+	Packaged DNA stabilization protein gp4	NA	I1TEJ0	Salmonella_phage	100.0	3.2e-90
WP_010835892.1|396817_398236_+	Tail accessory protein	NA	I1TEJ1	Salmonella_phage	100.0	6.4e-277
WP_016048834.1|398239_398941_+	hypothetical protein	NA	I1TEJ2	Salmonella_phage	100.0	9.4e-72
WP_016048835.1|398940_399396_+	DUF2824 family protein	NA	I1TEJ3	Salmonella_phage	100.0	1.8e-87
WP_006819472.1|399398_400088_+	hypothetical protein	NA	I1TEJ4	Salmonella_phage	100.0	3.9e-94
WP_016048836.1|400130_401468_+	DNA transfer protein 2	NA	I1TEJ5	Salmonella_phage	100.0	1.4e-244
WP_016048837.1|401467_403399_+	hypothetical protein	NA	I1TEJ6	Salmonella_phage	100.0	0.0e+00
WP_071533035.1|403537_403831_+	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_000532177.1|403851_404100_-	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_016048838.1|404235_406239_+|tail	tailspike protein	tail	I1TEJ8	Salmonella_phage	100.0	0.0e+00
WP_016048812.1|406297_407755_-	O-antigen conversion translocase	NA	I1TED7	Salmonella_phage	100.0	5.8e-241
WP_016048813.1|407744_408677_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	100.0	5.5e-176
WP_000915523.1|408673_409036_-	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
WP_077942643.1|409152_409332_+	hypothetical protein	NA	M1E3P7	Enterobacteria_phage	92.3	4.3e-13
417627:417643	attR	GATATTGAAATTCGCGT	NA	NA	NA	NA
>prophage 3
NZ_CP040651	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 chromosome, complete genome	4925949	1016239	1024971	4925949	transposase,protease	Dickeya_phage(14.29%)	8	NA	NA
WP_001201751.1|1016239_1017358_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1017354_1019301_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1019430_1019652_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1019975_1020296_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1020326_1022603_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1022794_1023253_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_119920232.1|1023425_1023701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085983316.1|1023715_1024971_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 4
NZ_CP040651	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 chromosome, complete genome	4925949	1075034	1173843	4925949	integrase,portal,terminase,tRNA,lysis,protease,tail,holin	Salmonella_phage(43.1%)	104	1077943:1077962	1149730:1149749
WP_001154025.1|1075034_1075838_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1075830_1077153_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1077133_1077838_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1077837_1082304_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1077943:1077962	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1082648_1084490_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1084749_1085298_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1085325_1085973_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1086034_1087225_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1087409_1088501_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1089107_1090508_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1090708_1091170_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301921.1|1091166_1091400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000544849.1|1091486_1092701_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1092945_1094382_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1094459_1095662_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1095856_1097149_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1097193_1097442_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1097482_1097722_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1097764_1098922_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|1098884_1101770_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|1101896_1102196_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1102217_1102376_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_077905303.1|1102368_1102629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1102678_1103089_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1103208_1103448_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1103413_1103788_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1103872_1104856_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1104858_1105608_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1105618_1105966_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1105962_1106274_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1106351_1106642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1106933_1107167_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1107278_1107500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1107582_1108185_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001241019.1|1108184_1108391_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_001096552.1|1108393_1109005_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1109001_1109148_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1109137_1109935_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1110001_1110319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1110492_1110618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1110753_1111203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1111563_1112250_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1112525_1112855_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1112838_1113291_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1113308_1113788_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1113995_1114529_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1114485_1116624_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1116620_1116827_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_077679777.1|1116853_1118371_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_010989008.1|1118294_1120376_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1120466_1120790_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1120782_1121082_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1121062_1121629_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1121625_1122027_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1122038_1122788_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1122833_1123232_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1123228_1123558_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_077905305.1|1123637_1126625_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	4.8e-266
WP_000978296.1|1126621_1126954_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1127052_1127550_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1127666_1128200_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1128289_1128985_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1128994_1129732_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1129629_1130334_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_001541992.1|1130405_1132853_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	68.0	0.0e+00
WP_031615525.1|1132831_1133755_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	76.9	5.6e-56
WP_000178849.1|1133793_1134036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|1134089_1136528_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|1136527_1137109_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001533476.1|1137584_1138553_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|1139200_1139827_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1139895_1140195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1140179_1140866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1141136_1141328_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1141754_1144367_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1144574_1145585_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1145750_1146293_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1146289_1147399_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1147497_1149606_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1149618_1151526_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1149730:1149749	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1151540_1152794_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1152798_1154439_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1154435_1154999_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1155254_1155422_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1155521_1156040_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1156108_1157869_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1158054_1158507_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1158578_1159631_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1159988_1160498_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1160714_1161320_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1161306_1163460_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1163478_1163925_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1164048_1166103_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1166138_1166597_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1166691_1167354_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1167524_1167941_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1167985_1168303_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1168360_1169572_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1169786_1170335_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1170360_1171140_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1171188_1171470_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1171466_1171796_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1171882_1172542_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1173162_1173843_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 5
NZ_CP040651	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 chromosome, complete genome	4925949	1961967	1968776	4925949	integrase,tail	Salmonella_phage(33.33%)	11	1956830:1956852	1966545:1966567
1956830:1956852	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1961967_1962849_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1963321_1963510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1963574_1963742_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1963998_1964532_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1964585_1964816_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1965005_1965500_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1965559_1966414_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1966787_1967141_-	YebY family protein	NA	NA	NA	NA	NA
1966545:1966567	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1967157_1968033_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1968033_1968408_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1968545_1968776_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 6
NZ_CP040651	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 chromosome, complete genome	4925949	2044226	2122886	4925949	portal,integrase,head,terminase,transposase,plate,capsid,protease,tail,holin	Salmonella_phage(80.0%)	106	2050764:2050779	2124509:2124524
WP_000502119.1|2044226_2044685_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_000659236.1|2044865_2046071_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079806.1|2046149_2047637_-	flagellin FliC	NA	NA	NA	NA	NA
WP_000146802.1|2047893_2049297_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2049311_2049719_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2049718_2050087_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2050158_2051643_+	alpha-amylase	NA	NA	NA	NA	NA
2050764:2050779	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2051682_2052108_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2052293_2053499_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2053495_2053729_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2053993_2054380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2054499_2054814_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2055030_2056713_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2056705_2057701_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2057693_2058401_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2058400_2059771_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2059792_2060236_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2060232_2061450_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2061554_2062022_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2062026_2063031_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2063027_2063441_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2063440_2063818_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2063817_2064555_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2064564_2064834_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2064842_2065637_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2065918_2066542_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2066580_2066829_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2066903_2067131_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2067440_2068256_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2068234_2069947_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2070111_2070357_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2070373_2071285_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2071460_2072381_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2072369_2072840_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2072820_2074251_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2074324_2075020_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2075111_2075411_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2076060_2077257_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2077517_2077706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2077716_2077929_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2078383_2079652_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2079654_2080074_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2080200_2080362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093793.1|2081555_2081768_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000842532.1|2081764_2082178_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_122815478.1|2082225_2082339_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000836773.1|2082413_2082647_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_022742744.1|2082760_2083366_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_020899405.1|2083335_2084898_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	100.0	1.0e-288
WP_001207832.1|2084884_2085472_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785578.1|2085474_2086554_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_000605051.1|2086546_2086960_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|2086964_2087498_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066630.1|2087497_2088556_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_000863827.1|2088552_2089893_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	100.0	5.2e-252
WP_000785390.1|2089926_2091855_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	100.0	0.0e+00
WP_000588854.1|2091939_2092266_-|tail	phage tail assembly protein	tail	A0A192Y6C5	Salmonella_phage	100.0	1.3e-52
WP_000515952.1|2092262_2092619_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007996.1|2092618_2094115_-|tail	tail sheath protein	tail	A0A192Y7L1	Salmonella_phage	100.0	2.1e-278
WP_000497740.1|2094104_2094269_-	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	100.0	1.3e-24
WP_000779216.1|2094272_2094833_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	100.0	8.0e-106
WP_001135699.1|2094829_2095342_-	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	100.0	3.5e-92
WP_000702410.1|2095313_2095718_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
WP_000927378.1|2095714_2096038_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601352.1|2096040_2096241_-	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
WP_000257526.1|2096291_2097497_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	100.0	7.0e-224
WP_001193639.1|2097511_2098162_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_020899404.1|2098139_2099381_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.3	2.9e-241
WP_000605609.1|2099380_2099563_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088175.1|2099574_2101308_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
WP_000929171.1|2101304_2101799_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	100.0	1.7e-88
WP_001135098.1|2101924_2102275_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|2102325_2102658_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_097053918.1|2102957_2103236_-	peptidase	NA	Q8SBD8	Shigella_phage	74.4	1.3e-24
WP_001530346.1|2103120_2103513_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|2103509_2104124_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|2104123_2104405_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|2104391_2104778_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|2104923_2105181_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_020899401.1|2105331_2106084_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_020899400.1|2106097_2107087_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	99.1	4.0e-193
WP_020899399.1|2107094_2107955_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	8.4e-163
WP_001241579.1|2107971_2108361_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2108357_2109251_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2109250_2109733_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2109734_2110553_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2110549_2110774_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2110770_2111928_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2111924_2112479_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2112507_2112732_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_071529734.1|2112670_2112856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020636.1|2112829_2113525_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001067432.1|2113730_2114069_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_023891434.1|2114031_2114256_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_000997191.1|2114795_2115167_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_000080416.1|2115224_2116052_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000008351.1|2116188_2116728_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000215886.1|2116798_2117332_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000224241.1|2117333_2117591_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_020899398.1|2117601_2118183_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_001061334.1|2118186_2118756_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2118780_2119023_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2119024_2120014_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2120305_2121103_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_024159751.1|2121474_2121765_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	50.9	1.0e-08
WP_001219015.1|2122412_2122886_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2124509:2124524	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 7
NZ_CP040651	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 chromosome, complete genome	4925949	2208880	2219386	4925949		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2208880_2210194_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2210220_2211300_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2211304_2212078_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2212074_2213067_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2213072_2213624_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2213624_2214503_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2214550_2215450_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2215449_2216535_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2216911_2217805_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2217982_2219386_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 8
NZ_CP040651	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 chromosome, complete genome	4925949	2267639	2339625	4925949	portal,integrase,head,tRNA,terminase,capsid,tail,holin	Cronobacter_phage(52.5%)	76	2269151:2269172	2299158:2299179
WP_001517981.1|2267639_2269001_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	95.4	2.3e-207
2269151:2269172	attL	CCCTTACGCAGGCTTATTTTTT	NA	NA	NA	NA
WP_033574042.1|2269282_2270605_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_109161413.1|2271272_2271767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058815650.1|2271665_2273366_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.9	5.4e-222
WP_000200789.1|2273368_2273914_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000267957.1|2273885_2274611_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_058815646.1|2274600_2275155_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.5	1.2e-90
WP_138020336.1|2275167_2277273_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	68.8	2.6e-197
WP_001001828.1|2277282_2277870_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000136921.1|2277862_2279047_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_023210885.1|2279043_2279373_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	73.3	2.2e-39
WP_023210886.1|2279369_2281337_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.6	8.3e-267
WP_000411500.1|2281524_2281782_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_001747519.1|2281768_2282002_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	83.1	1.7e-30
WP_000376378.1|2281928_2282261_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	4.4e-35
WP_000175558.1|2282260_2282602_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154426.1|2282598_2282895_-|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_000166745.1|2282907_2283363_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	1.7e-58
WP_033574048.1|2283359_2284487_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	82.9	1.8e-173
WP_033574049.1|2284483_2285188_-	phage protein	NA	F1BUL6	Cronobacter_phage	59.1	8.9e-70
WP_033574050.1|2285184_2285667_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	3.0e-37
WP_077917291.1|2285663_2286116_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	63.3	8.0e-48
WP_000505908.1|2286209_2286401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033574052.1|2286419_2287118_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.0	2.3e-62
WP_033574053.1|2287128_2288148_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	73.5	5.5e-137
WP_033574054.1|2288182_2289001_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.0	1.4e-45
WP_033574055.1|2289144_2290929_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	70.4	1.9e-249
WP_033574056.1|2290925_2291945_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	69.1	7.9e-136
WP_033574057.1|2291944_2292274_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	58.2	1.5e-27
WP_033574064.1|2292319_2293291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033574058.1|2293425_2296080_-	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	46.8	2.1e-241
WP_044713224.1|2296119_2296338_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.7	1.8e-05
WP_033574059.1|2296340_2296910_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	48.4	1.8e-44
WP_033574060.1|2296919_2297255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033574061.1|2297251_2297527_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	82.4	5.2e-42
WP_033574062.1|2297644_2297944_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	86.9	3.9e-43
WP_033574063.1|2298059_2299073_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	89.3	3.2e-177
WP_010989041.1|2299458_2300505_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	75.2	1.6e-147
2299158:2299179	attR	CCCTTACGCAGGCTTATTTTTT	NA	NA	NA	NA
WP_001669236.1|2300540_2300957_-	CesT family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_001542166.1|2301078_2301414_-	membrane protein	NA	NA	NA	NA	NA
WP_001273389.1|2301975_2302875_+	lipid kinase YegS	NA	NA	NA	NA	NA
WP_000129590.1|2302927_2303980_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858692.1|2304233_2305505_+	MFS transporter	NA	NA	NA	NA	NA
WP_138625294.1|2305501_2306506_+	ADP-ribosylglycohydrolase family protein	NA	A0A172WZB4	Catopsilia_pomona_nucleopolyhedrovirus	22.8	8.4e-05
WP_001012658.1|2306502_2307468_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434062.1|2307441_2308188_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001188957.1|2308223_2309024_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001182156.1|2309010_2309808_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000837534.1|2310217_2310532_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000765279.1|2310794_2311802_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945364.1|2311817_2314307_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000698773.1|2314320_2315004_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830686.1|2315059_2315590_-	fimbrial protein YehD	NA	NA	NA	NA	NA
WP_000760404.1|2315868_2316150_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005424.1|2316427_2317537_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_000195332.1|2317701_2319735_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2319975_2320434_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2320605_2321136_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2321192_2321660_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2321706_2322426_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2322422_2324108_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2324330_2325062_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2325121_2325229_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2325209_2325941_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2325924_2326872_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_001278110.1|2326864_2328034_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000155869.1|2328037_2328955_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000871560.1|2329135_2331433_-	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_000095232.1|2331699_2333430_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000911555.1|2333487_2334435_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_001017057.1|2334600_2335188_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_000930540.1|2335319_2335916_+	DedA family protein	NA	NA	NA	NA	NA
WP_000169608.1|2335964_2336726_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001081453.1|2336791_2338228_-	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000698460.1|2338545_2338629_+	protein YohP	NA	NA	NA	NA	NA
WP_001264832.1|2338686_2339625_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP040651	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 chromosome, complete genome	4925949	2398924	2409230	4925949	tail,holin	Salmonella_phage(44.44%)	9	NA	NA
WP_000806401.1|2398924_2399428_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2399455_2399746_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_138020337.1|2400794_2401340_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.2e-11
WP_000554739.1|2401342_2402584_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2403176_2403506_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2403802_2405134_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2405162_2405531_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2405545_2406535_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2406863_2409230_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
>prophage 10
NZ_CP040651	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 chromosome, complete genome	4925949	2749974	2852120	4925949	portal,integrase,head,tRNA,terminase,lysis,transposase,capsid,protease,tail,holin	Salmonella_phage(35.48%)	111	2776830:2776845	2847209:2847224
WP_000940032.1|2749974_2750706_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2750824_2751628_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2751772_2752651_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2752832_2753876_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2753879_2754698_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2754708_2755722_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2755722_2756709_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2756699_2757338_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2757463_2758741_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2758735_2759875_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2760070_2761324_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2761648_2762839_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2763020_2764565_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2764925_2766257_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2766339_2768484_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2768539_2770000_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2770048_2770387_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2770463_2771801_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2771797_2772562_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2772563_2773994_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
WP_000502119.1|2774709_2775168_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_000970045.1|2775355_2779243_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
2776830:2776845	attL	AACGCGGAAATCACCA	NA	NA	NA	NA
WP_001747289.1|2779264_2779498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2779498_2781043_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2781093_2781645_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2781669_2782305_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2782308_2783670_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2783680_2784574_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2784689_2785538_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2785576_2786494_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276365.1|2786515_2787712_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2787827_2788754_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2788791_2789052_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2789163_2789544_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2789543_2790275_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2790286_2791015_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2791026_2791932_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2791928_2792609_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2792882_2793857_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2793873_2795673_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2796077_2797571_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2798019_2798157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2798869_2799034_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2799613_2799679_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2799741_2799954_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2800060_2800288_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2800384_2800963_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2800952_2801777_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2801773_2804146_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2804199_2804442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2804480_2807843_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2807904_2808552_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2808449_2809187_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2809193_2809892_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2809901_2810231_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|2810233_2813329_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|2813300_2813639_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2813635_2814031_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2814081_2814828_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2814835_2815237_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2815345_2816476_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2816524_2817103_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2817130_2817514_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2817524_2817884_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2817941_2818970_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2819024_2819372_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2819384_2820881_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2820870_2822451_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2822447_2822651_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2822634_2824566_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2824537_2825083_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2825369_2825771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2826006_2826459_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984581.1|2826476_2826929_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|2826912_2827242_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2827517_2828204_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2828418_2828607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2829113_2829677_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_072095218.1|2829767_2829953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097241.1|2829949_2830627_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2830623_2830764_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|2830760_2831372_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_001241017.1|2831374_2831581_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
WP_000929791.1|2831580_2832183_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|2832217_2832466_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2832582_2832816_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000877757.1|2833058_2833691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000664368.1|2833798_2834497_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000801764.1|2834510_2835206_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000024044.1|2835202_2836087_-	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_010835408.1|2836178_2836553_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000643689.1|2836512_2836755_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_000660736.1|2836854_2837250_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_001111772.1|2837308_2838148_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000356948.1|2838140_2838527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950426.1|2838526_2839189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|2839645_2839804_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2839825_2840176_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017125.1|2840302_2843230_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_077248255.1|2843192_2844350_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|2844392_2844632_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2844672_2844957_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2844934_2846164_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2846661_2847141_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2847137_2848094_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
2847209:2847224	attR	TGGTGATTTCCGCGTT	NA	NA	NA	NA
WP_001168374.1|2848093_2848744_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2848775_2849351_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2849347_2849512_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001521719.1|2849511_2849691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000989191.1|2849775_2851398_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2851382_2852120_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP040651	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 chromosome, complete genome	4925949	3409152	3450682	4925949	portal,integrase,head,tRNA,terminase,capsid,tail,holin	Cronobacter_phage(68.42%)	48	3404489:3404504	3447904:3447919
3404489:3404504	attL	ATGGCGGCGTAGCCAG	NA	NA	NA	NA
WP_001264394.1|3409152_3410166_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001144069.1|3410393_3410609_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|3410844_3412590_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|3412739_3414587_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|3414710_3415217_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000340945.1|3415540_3415843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000746531.1|3416274_3416460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680744.1|3417211_3418912_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
WP_000200789.1|3418914_3419460_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000267956.1|3419431_3420157_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000861353.1|3420146_3420701_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000084307.1|3420713_3422948_-|tail	tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_001001828.1|3422957_3423545_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000136921.1|3423537_3424722_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001002797.1|3424718_3425048_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811094.1|3425044_3427015_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_000411339.1|3427202_3427460_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_001670161.1|3427446_3427635_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	77.4	1.5e-21
WP_000376373.1|3427606_3427939_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_000175560.1|3427938_3428280_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|3428276_3428570_-|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166743.1|3428579_3429035_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_000220203.1|3429031_3430159_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000560080.1|3430155_3430863_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000084218.1|3430859_3431366_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000447487.1|3431362_3431851_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_001218537.1|3431911_3432613_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000550495.1|3432616_3433639_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_000018800.1|3433700_3434504_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_001151939.1|3434664_3436440_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000038213.1|3436436_3437498_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001552031.1|3437494_3437818_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000353141.1|3437791_3437998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170874.1|3438117_3440139_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_000279404.1|3440135_3440996_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000551169.1|3440986_3441220_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022786.1|3441287_3441689_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000996837.1|3441688_3442114_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000643375.1|3442103_3442331_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000460878.1|3442340_3442844_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_001247711.1|3442874_3443096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514631.1|3443239_3443821_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_000568372.1|3443837_3444404_+	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_001145219.1|3444407_3445445_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000627044.1|3445434_3447216_+	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_000213760.1|3447473_3448241_-	siderophore-interacting protein	NA	NA	NA	NA	NA
3447904:3447919	attR	CTGGCTACGCCGCCAT	NA	NA	NA	NA
WP_000983441.1|3448472_3449120_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000478472.1|3449116_3450682_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
>prophage 12
NZ_CP040651	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 chromosome, complete genome	4925949	4487173	4507593	4925949	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4487173_4487902_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4488098_4488389_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4488637_4489093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4489089_4489695_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4489699_4491445_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4491447_4492080_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4492072_4493188_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4493178_4493538_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4493701_4495249_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4495248_4496178_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4496174_4496537_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4496864_4497587_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4497596_4498640_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4498627_4498837_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4498836_4499790_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4499789_4502144_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4502240_4502369_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4502328_4502646_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4502697_4503222_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4503221_4504649_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4504638_4504836_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4504832_4505288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033566939.1|4505447_4505762_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	48.2	3.2e-19
WP_001270441.1|4505774_4506380_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4506382_4506670_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4507245_4507593_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP040652	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 plasmid pSA20070548.1, complete sequence	84296	5540	56824	84296	protease,integrase,transposase	Escherichia_phage(26.32%)	54	NA	NA
WP_001398208.1|5540_8018_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.4	2.9e-83
WP_000843496.1|8058_8256_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000287499.1|8289_9027_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
WP_000027057.1|9251_10112_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|10210_10915_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001354008.1|11729_11975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|12012_12876_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_011264039.1|13021_13261_-	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_001505093.1|13333_13939_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.7e-117
WP_021536379.1|15268_15946_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_001493765.1|16024_17224_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_050195271.1|17255_18140_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|18277_18670_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_112015435.1|20964_21324_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_034167711.1|21522_21738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032482493.1|23783_24755_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	38.1	2.4e-49
WP_072078461.1|25050_25236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011058338.1|26050_26236_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	67.9	3.9e-17
WP_025989258.1|27113_29033_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A2K5B2A5	Erysipelothrix_phage	96.4	0.0e+00
WP_012386611.1|29048_29135_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_001067855.1|29930_30635_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000935452.1|30681_31986_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032300419.1|32024_32660_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_050480520.1|32599_32962_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|32979_34674_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|34725_35148_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|35183_35459_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|35472_35823_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|35894_36329_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001262766.1|37021_38794_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000439434.1|39078_39411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557619.1|39412_39670_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616800.1|39762_40416_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_071529017.1|40605_40992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130643.1|41353_42211_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|42203_42278_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_052936122.1|42307_42472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083830.1|42515_42770_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000766814.1|43009_43600_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_072078460.1|43638_43782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001104887.1|44537_44759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086160.1|44759_45443_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_032155763.1|45518_45824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302618.1|45827_46730_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_001331411.1|46767_47037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000618110.1|47147_47396_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109071.1|47392_47830_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000457496.1|47829_49101_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.4e-142
WP_000340829.1|49105_49498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103697.1|49502_50474_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	1.3e-66
WP_000633913.1|50702_51347_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_000239529.1|51340_51616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000864813.1|55489_55843_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_000016963.1|56014_56824_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	1.0e-53
