The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040664	Escherichia coli strain KR2009 chromosome, complete genome	4601511	270534	320606	4601511	integrase,holin,transposase	Acinetobacter_phage(22.22%)	42	277657:277673	328884:328900
WP_001254938.1|270534_271686_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|274032_275049_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|275256_276660_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|276646_277579_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
277657:277673	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000192349.1|277687_278734_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000388269.1|280608_281340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|281430_282057_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|282328_283027_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|283053_283908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|284026_284251_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|284247_284688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|284804_286205_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_001111342.1|286489_286900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121359.1|286878_287835_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|287844_290043_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000643333.1|290039_290996_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000070700.1|290992_291682_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|292099_292714_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|292961_293291_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001310578.1|294283_295927_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131096.1|295916_298442_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_138817831.1|298467_299136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000730972.1|299193_299781_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001301257.1|299855_300398_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147279.1|301221_301449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|301483_301624_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|301623_301887_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|302250_302352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000020224.1|303466_304354_+	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_085947771.1|304400_305562_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001299021.1|306835_307429_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474084.1|307440_307677_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046307.1|307785_309111_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000339594.1|309336_310191_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001102108.1|310717_311437_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023927.1|311447_312875_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000370307.1|312867_313563_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001209100.1|313805_314474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001159094.1|314686_316357_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089110.1|316370_317843_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001335745.1|317856_318444_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|318572_320606_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
328884:328900	attR	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 2
NZ_CP040664	Escherichia coli strain KR2009 chromosome, complete genome	4601511	507993	570825	4601511	transposase,protease,tRNA,integrase,terminase,lysis	Enterobacteria_phage(53.57%)	64	553572:553618	574713:574759
WP_001295836.1|507993_508617_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|508587_509274_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|509270_511685_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_138795913.1|512115_516426_+	DUF4329 domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|516422_516791_+	immunity protein	NA	NA	NA	NA	NA
WP_001157938.1|518948_520043_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|520111_521038_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|521267_521750_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|521827_522643_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|522732_524514_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|524526_525303_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|525402_526281_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|526449_527904_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|527963_529325_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|529381_530683_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|530704_531850_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|532077_532863_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|532873_534109_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|534130_535180_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|535496_537164_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|537173_538433_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|538443_539259_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|539255_540149_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|540343_541411_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|541407_541917_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|542034_542757_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|542759_543254_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|543427_544813_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|544848_545370_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|545477_545690_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|545691_546558_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|547028_547571_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|547790_548483_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|548513_551117_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|551095_552136_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|552146_552662_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|552664_553297_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
553572:553618	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|553631_554795_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|554914_555178_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|555500_555596_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|555658_556820_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|557131_557464_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_138817832.1|557511_557667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138817833.1|557672_559178_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	2.5e-29
WP_001306955.1|559642_560194_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|560203_561001_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|561117_561219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|561215_561671_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|561670_561841_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|561833_562124_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|562120_562483_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|562479_562620_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|562705_563089_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|563474_564491_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_138817834.1|564495_565554_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.0	2.6e-150
WP_000839596.1|566126_566342_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|566341_566839_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_012738274.1|567055_567238_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000738492.1|567328_567622_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_095501025.1|567911_568322_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	99.3	3.2e-72
WP_001031427.1|568607_568814_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|568978_569173_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_087087091.1|569561_570107_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	2.3e-94
WP_001027248.1|570081_570825_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
574713:574759	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP040664	Escherichia coli strain KR2009 chromosome, complete genome	4601511	1181061	1202388	4601511	portal,tail,tRNA,integrase,plate	Shigella_phage(25.0%)	32	1173056:1173070	1208955:1208969
1173056:1173070	attL	CTTCAGCGTGGTTGT	NA	NA	NA	NA
WP_001297484.1|1181061_1182168_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1182221_1182683_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1182692_1183346_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|1183517_1184768_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_000241967.1|1185261_1185927_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010723094.1|1185927_1186632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257372.1|1187089_1187983_+	cell death peptidase Lit	NA	NA	NA	NA	NA
WP_000741310.1|1188073_1189201_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
WP_000939945.1|1189181_1189427_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|1189463_1189775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|1189891_1190233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|1190170_1190479_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|1190653_1191328_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|1191418_1191619_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|1191662_1192220_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|1192395_1192575_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|1192564_1193932_+	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|1193943_1194126_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|1194125_1194599_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|1194525_1195317_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|1195307_1195892_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_000554703.1|1195895_1196525_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_010723096.1|1196526_1196940_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000548498.1|1196911_1197514_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_024184299.1|1197513_1198008_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000905001.1|1198079_1198634_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|1198740_1199574_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_138817842.1|1199819_1199972_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.4e-19
WP_138817843.1|1200074_1200332_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	49.5	1.9e-25
WP_032082692.1|1200868_1200979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1201031_1201436_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1201656_1202388_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
1208955:1208969	attR	ACAACCACGCTGAAG	NA	NA	NA	NA
>prophage 4
NZ_CP040664	Escherichia coli strain KR2009 chromosome, complete genome	4601511	1394441	1458312	4601511	transposase,tail,tRNA,integrase,lysis	Escherichia_phage(37.5%)	61	1385101:1385119	1415474:1415492
1385101:1385119	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000628058.1|1394441_1395674_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1395928_1396912_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1397388_1398762_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1398890_1399826_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1399877_1401113_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1401114_1401330_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_138817846.1|1401408_1401618_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	8.0e-27
WP_001317028.1|1401610_1401805_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1401861_1402671_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1402663_1405264_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_001352098.1|1405714_1405885_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1405884_1406106_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1406547_1407036_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1407032_1407188_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000233809.1|1407198_1407333_-	phage protein	NA	NA	NA	NA	NA
WP_000948459.1|1407641_1408118_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1408241_1408538_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1408560_1408983_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1408995_1409853_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1409859_1410606_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1410628_1411189_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1411276_1411462_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1411658_1413116_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1413253_1413517_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1413497_1413857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001755909.1|1413964_1414165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1415622_1416603_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
1415474:1415492	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_089418980.1|1416645_1416861_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.4	1.4e-29
WP_138817847.1|1416925_1420288_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	8.1e-12
WP_138817848.1|1420287_1420863_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	7.7e-104
WP_000086527.1|1420960_1421551_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1421867_1422101_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1422169_1422283_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1423061_1423496_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_138795931.1|1423636_1424770_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.3	5.4e-117
WP_000628244.1|1425135_1428660_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|1428933_1429200_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001298828.1|1429196_1429619_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762236.1|1429729_1430719_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_000900941.1|1430926_1433566_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|1433562_1433748_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001300734.1|1433755_1434082_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067514.1|1434253_1435159_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138615.1|1435394_1436894_+	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000535469.1|1436951_1439225_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001186469.1|1439472_1441518_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191077.1|1441802_1442732_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|1442743_1443031_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_138817849.1|1443039_1443786_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189201.1|1443800_1444298_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206388.1|1444305_1445376_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292353.1|1445372_1446140_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969784.1|1446139_1446928_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973360.1|1446929_1448357_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018413.1|1448346_1448769_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206197.1|1448768_1449974_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632280.1|1450000_1451314_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039887.1|1451414_1452365_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001123464.1|1452346_1452937_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_085947917.1|1455723_1456997_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001254932.1|1457160_1458312_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 5
NZ_CP040664	Escherichia coli strain KR2009 chromosome, complete genome	4601511	1617193	1636119	4601511	tail,lysis	Enterobacteria_phage(42.86%)	34	NA	NA
WP_000527743.1|1617193_1618654_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1618742_1620026_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000836768.1|1620538_1620772_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1621088_1621679_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_138817854.1|1621776_1622352_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	97.4	1.4e-105
WP_001027733.1|1622351_1623314_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1623264_1623834_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1624222_1624456_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1624513_1624924_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1625075_1625249_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1625420_1625576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1625654_1625720_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1625722_1625911_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1625921_1626134_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1626496_1626994_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1626990_1627524_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1627520_1627832_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1627836_1628052_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1628794_1629010_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1629310_1629523_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1629577_1629667_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1629944_1630697_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1630710_1631760_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1631761_1632040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1632106_1632358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1632574_1632730_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1632801_1633089_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1633088_1633328_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1633352_1633658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1633860_1634193_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1634629_1634779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1635075_1635306_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1635389_1635797_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1635963_1636119_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 6
NZ_CP040664	Escherichia coli strain KR2009 chromosome, complete genome	4601511	2176856	2186297	4601511		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001333512.1|2176856_2177993_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_001375261.1|2177989_2179990_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|2180114_2180576_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2180615_2181086_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2181132_2181852_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2181848_2183534_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2183755_2184487_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2184546_2184654_+	protein YohO	NA	NA	NA	NA	NA
WP_000783123.1|2184634_2185366_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569315.1|2185370_2186297_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 7
NZ_CP040664	Escherichia coli strain KR2009 chromosome, complete genome	4601511	2434126	2445326	4601511	tail,integrase	Enterobacteria_phage(53.33%)	16	2432101:2432117	2449001:2449017
2432101:2432117	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2434126_2435059_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2435370_2436528_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2436680_2437043_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2437039_2437960_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_047792215.1|2439312_2439594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2439892_2440333_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2440359_2440878_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2440927_2441203_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2441202_2441697_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|2441693_2442062_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|2442419_2442782_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2442847_2443672_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2443799_2444336_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2444326_2444689_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2444688_2444994_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2445125_2445326_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2449001:2449017	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 8
NZ_CP040664	Escherichia coli strain KR2009 chromosome, complete genome	4601511	2818826	2825965	4601511		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2818826_2821388_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2821493_2822150_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|2822200_2822968_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|2823163_2824072_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2824068_2825235_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2825326_2825965_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
