The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP030771	Streptomyces sp. YIM 121038 chromosome, complete genome	10130554	482333	530673	10130554	tRNA,plate,tail,holin	Bacillus_phage(33.33%)	44	NA	NA
WP_138957603.1|482333_483137_-|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	NA	NA	NA	NA
WP_138957604.1|483560_484220_+	DUF4360 domain-containing protein	NA	NA	NA	NA	NA
WP_138957605.1|484343_485003_-	DUF1707 domain-containing protein	NA	NA	NA	NA	NA
WP_138957606.1|485290_487699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138957607.1|488012_488786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138965912.1|489006_490110_+	serine hydrolase	NA	A5YJY7	Mycobacterium_phage	28.1	6.3e-22
WP_138957608.1|490154_490643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138957609.1|490769_491804_-	sulfotransferase	NA	NA	NA	NA	NA
WP_138957610.1|491947_493426_-	MFS transporter	NA	NA	NA	NA	NA
WP_138957611.1|493658_494663_+	YdcF family protein	NA	NA	NA	NA	NA
WP_138957612.1|494711_495635_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_138965914.1|495771_496185_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_138957613.1|496516_497263_+	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_171076043.1|497421_498021_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_138957615.1|498181_498859_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_138957616.1|498855_500883_+	AAA family ATPase	NA	A0A0R6PCP6	Moraxella_phage	33.9	1.5e-21
WP_138957617.1|500933_502337_-	hydrolase	NA	NA	NA	NA	NA
WP_138957618.1|502593_504189_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	J9PVC2	Bacillus_phage	32.8	3.3e-64
WP_138957619.1|504261_504705_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_138957620.1|504704_505211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171075611.1|505207_505366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138957621.1|505449_506352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138957622.1|508027_508534_+	extensin	NA	NA	NA	NA	NA
WP_138965916.1|508586_509009_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_138957623.1|509051_509771_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_138957624.1|509770_511654_+	VgrG-related protein	NA	NA	NA	NA	NA
WP_138957625.1|511686_512136_+	GPW/gp25 family protein	NA	A0A1D7SP91	Cyanophage	30.5	3.9e-10
WP_138957626.1|512135_514094_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_138957627.1|514122_514680_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_138957628.1|514676_516005_+	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_138957629.1|516183_518199_+	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_138957630.1|518217_518994_+	L-iditol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_138957631.1|519028_520399_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_138957632.1|520410_521595_+	MFS transporter	NA	NA	NA	NA	NA
WP_138957633.1|521591_522404_+	acetoacetate decarboxylase family protein	NA	NA	NA	NA	NA
WP_138957634.1|522400_522940_+	5'(3')-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_138957635.1|523017_523431_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_171075612.1|523534_523924_-	response regulator	NA	W8CYM9	Bacillus_phage	33.3	1.8e-08
WP_138957637.1|524311_524539_-	DUF5133 domain-containing protein	NA	NA	NA	NA	NA
WP_138957638.1|524657_524903_-	CsbD family protein	NA	NA	NA	NA	NA
WP_138957639.1|524872_526165_-	carboxylesterase family protein	NA	A0A0M4JT58	Mollivirus	36.3	9.7e-30
WP_138957640.1|526186_526996_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_138957641.1|529912_530113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138965918.1|530301_530673_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 2
NZ_CP030771	Streptomyces sp. YIM 121038 chromosome, complete genome	10130554	2473291	2481302	10130554		Mycobacterium_phage(50.0%)	11	NA	NA
WP_138966304.1|2473291_2475136_-	DNA polymerase	NA	A0A2P1CHS7	Mycobacterium_phage	45.6	2.7e-134
WP_138958951.1|2475200_2475749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138958952.1|2475761_2476307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171075687.1|2476303_2477119_-	metallophosphoesterase	NA	G8I7S5	Mycobacterium_virus	55.0	1.3e-72
WP_138958954.1|2477115_2477484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138958955.1|2477480_2478149_-	topoisomerase	NA	A0A249XU42	Mycobacterium_phage	46.4	5.5e-45
WP_138958957.1|2478528_2478807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138958958.1|2478799_2479234_-	hypothetical protein	NA	A0A159B6U4	Tsukamurella_phage	43.6	2.7e-16
WP_138958959.1|2479233_2479572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138958960.1|2479595_2480429_-	AAA family ATPase	NA	Q5J5G2	Mycobacterium_virus	39.8	6.8e-53
WP_138966306.1|2480510_2481302_-	PD-(D/E)XK nuclease family protein	NA	A0A1J0GNS3	Mycobacterium_phage	39.7	2.5e-44
>prophage 3
NZ_CP030771	Streptomyces sp. YIM 121038 chromosome, complete genome	10130554	4766473	4807385	10130554	capsid,terminase,portal	Streptomyces_phage(95.35%)	48	NA	NA
WP_138960574.1|4766473_4768123_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	23.2	8.3e-18
WP_138960575.1|4768198_4769851_-	recombinase family protein	NA	A0A1J0MCY2	Streptomyces_phage	48.8	4.6e-133
WP_138960576.1|4769847_4770213_-	hypothetical protein	NA	A0A1V0E644	Streptomyces_phage	66.1	2.5e-36
WP_138960577.1|4770228_4770678_-	helix-turn-helix domain-containing protein	NA	A0A1V0E635	Streptomyces_phage	73.3	1.5e-54
WP_138960578.1|4771144_4771339_+	hypothetical protein	NA	A0A1V0E670	Streptomyces_phage	79.7	1.5e-16
WP_138966755.1|4771403_4771760_+	hypothetical protein	NA	A0A1V0E656	Streptomyces_phage	65.9	6.1e-35
WP_138960579.1|4771756_4772137_+	hypothetical protein	NA	A0A1J0MC56	Streptomyces_phage	64.5	6.7e-32
WP_138960580.1|4772133_4773375_+	recombinase RecT	NA	A0A1V0E653	Streptomyces_phage	72.1	3.7e-143
WP_138960581.1|4773371_4774004_+	hypothetical protein	NA	A0A1V0E652	Streptomyces_phage	72.6	2.7e-78
WP_138960582.1|4774225_4775188_+	mucin-2	NA	A0A1J0MCR8	Streptomyces_phage	77.5	2.1e-130
WP_138960583.1|4775184_4775865_+	cell surface glycoprotein	NA	A0A1J0MCX6	Streptomyces_phage	65.7	3.2e-77
WP_138960584.1|4775861_4776407_+	hypothetical protein	NA	A0A1V0E642	Streptomyces_phage	73.1	2.4e-67
WP_171075798.1|4776403_4776574_+	hypothetical protein	NA	A0A1J0MD79	Streptomyces_phage	78.6	2.4e-13
WP_138960585.1|4776694_4777210_+	HNH endonuclease	NA	A0A1J0MCN4	Streptomyces_phage	85.7	9.1e-64
WP_138960586.1|4777209_4777701_+	single-stranded DNA-binding protein	NA	A0A1J0MC80	Streptomyces_phage	77.9	2.1e-65
WP_171075582.1|4777787_4777964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138960587.1|4777992_4778418_+	hypothetical protein	NA	A0A1V0E663	Streptomyces_phage	77.5	6.4e-47
WP_138960588.1|4778617_4779625_+	hypothetical protein	NA	A0A1V0E662	Streptomyces_phage	43.4	4.7e-32
WP_138960589.1|4779621_4780449_+	hypothetical protein	NA	A0A1V0E674	Streptomyces_phage	83.6	3.2e-127
WP_138960590.1|4780721_4782539_+	hypothetical protein	NA	A0A1J0MCL2	Streptomyces_phage	36.1	1.1e-71
WP_138960591.1|4782601_4783420_+	hypothetical protein	NA	A0A1J0MCP3	Streptomyces_phage	50.3	3.6e-30
WP_138960592.1|4783498_4783930_+	hypothetical protein	NA	A0A1J0MCJ1	Streptomyces_phage	59.0	1.2e-24
WP_138960593.1|4784087_4784621_+	helix-turn-helix domain-containing protein	NA	A0A1J0MC31	Streptomyces_phage	72.9	6.7e-62
WP_138960594.1|4784625_4785879_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1J0MCH4	Streptomyces_phage	87.3	6.8e-214
WP_138960595.1|4785847_4786291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138960596.1|4786333_4787818_+|portal	phage portal protein	portal	A0A1J0MCN7	Streptomyces_phage	79.6	2.5e-231
WP_138966757.1|4787854_4790056_+|capsid	phage capsid protein	capsid	A0A1V0E608	Streptomyces_phage	69.2	3.9e-265
WP_138960597.1|4790064_4790244_+	hypothetical protein	NA	A0A1J0MC96	Streptomyces_phage	63.3	5.1e-14
WP_138960598.1|4790357_4791083_+	hypothetical protein	NA	A0A1J0MD42	Streptomyces_phage	50.8	3.7e-47
WP_138960599.1|4791103_4792114_+|capsid	phage capsid protein	capsid	A0A1J0MCK3	Streptomyces_phage	55.5	3.2e-89
WP_138960600.1|4792125_4792371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138960601.1|4792375_4792765_+	hypothetical protein	NA	A0A1J0MCI1	Streptomyces_phage	81.4	4.2e-53
WP_138960602.1|4792761_4793079_+	hypothetical protein	NA	A0A1J0MC76	Streptomyces_phage	70.8	7.8e-34
WP_138960603.1|4793075_4793426_+	hypothetical protein	NA	A0A1V0E617	Streptomyces_phage	82.8	7.1e-44
WP_138960604.1|4793422_4793854_+	hypothetical protein	NA	A0A1J0MC59	Streptomyces_phage	38.4	2.5e-14
WP_138960605.1|4793865_4794411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138960606.1|4794410_4794881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138960607.1|4795126_4797184_+	hypothetical protein	NA	A0A1V0E632	Streptomyces_phage	61.5	2.5e-27
WP_138960608.1|4797205_4799350_+	hypothetical protein	NA	A0A142K644	Streptomyces_phage	34.7	1.3e-82
WP_138966761.1|4799397_4800999_+	right-handed parallel beta-helix repeat-containing protein	NA	D7NW65	Streptomyces_phage	50.2	3.5e-138
WP_138960609.1|4802518_4803445_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0K1Y5X7	Streptomyces_phage	67.8	1.8e-78
WP_138960610.1|4803498_4803735_+	hypothetical protein	NA	A0A1J0MD62	Streptomyces_phage	83.3	8.4e-25
WP_138960611.1|4803731_4803995_+	hypothetical protein	NA	A0A1J0MCF7	Streptomyces_phage	90.4	1.0e-34
WP_138960612.1|4804055_4805408_-	transcriptional regulator	NA	A0A1J0MD11	Streptomyces_phage	83.6	1.3e-215
WP_138960613.1|4805566_4806001_+	ATP-binding protein	NA	A0A1V0E640	Streptomyces_phage	66.7	4.2e-46
WP_138960614.1|4805979_4806480_+	hypothetical protein	NA	A0A1J0MCS0	Streptomyces_phage	63.4	9.1e-53
WP_171075799.1|4806620_4806794_+	hypothetical protein	NA	A0A1J0MCJ2	Streptomyces_phage	63.2	7.6e-15
WP_171075800.1|4806938_4807385_+	NUDIX hydrolase	NA	D0R7I2	Paenibacillus_phage	39.1	8.3e-05
>prophage 4
NZ_CP030771	Streptomyces sp. YIM 121038 chromosome, complete genome	10130554	8978999	9001940	10130554	head,terminase,capsid,tail,portal,protease	Streptomyces_phage(58.82%)	25	NA	NA
WP_138964143.1|8978999_8979440_-	hypothetical protein	NA	Q6VY36	Streptomyces_phage	65.7	8.0e-53
WP_138964145.1|8979439_8979622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138964147.1|8979631_8980420_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0K1Y5X7	Streptomyces_phage	64.4	6.6e-98
WP_138964149.1|8980419_8980656_-	hypothetical protein	NA	A0A1D8EVF2	Mycobacterium_phage	56.8	3.6e-15
WP_171075964.1|8980718_8983364_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K1Y5U2	Streptomyces_phage	42.4	3.3e-141
WP_138964151.1|8983376_8983994_-	hypothetical protein	NA	A0A0K1Y5B7	Streptomyces_phage	63.7	3.2e-71
WP_138967480.1|8984005_8984920_-	hypothetical protein	NA	A0A0K1Y5A0	Streptomyces_phage	61.3	4.1e-99
WP_138964153.1|8984934_8986092_-|tail	phage tail protein	tail	A0A0K1Y599	Streptomyces_phage	56.6	1.3e-115
WP_138964155.1|8986091_8986970_-	hypothetical protein	NA	A0A0K1Y5X3	Streptomyces_phage	50.3	3.8e-70
WP_138964157.1|8986990_8991364_-|tail	phage tail tape measure protein	tail	A0A0K1Y580	Streptomyces_phage	51.4	6.7e-224
WP_138967482.1|8991386_8991761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138964159.1|8991808_8992174_-	hypothetical protein	NA	Q6VY44	Streptomyces_phage	55.8	6.9e-26
WP_138964161.1|8992178_8992544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138964163.1|8992629_8993400_-	Ig-like domain-containing protein	NA	A0A2H4PA05	Gordonia_phage	37.3	4.7e-24
WP_138967484.1|8993462_8993882_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_138964165.1|8993878_8994160_-	hypothetical protein	NA	A0A2H4P9V4	Gordonia_phage	48.8	2.4e-10
WP_138964167.1|8994169_8994538_-	hypothetical protein	NA	A0A2P1JSY3	Streptomyces_phage	44.2	1.8e-18
WP_138964169.1|8994554_8995112_-	mobile element protein	NA	NA	NA	NA	NA
WP_138964171.1|8995104_8995410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138964173.1|8995496_8995709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138964175.1|8995724_8997053_-|capsid	phage major capsid protein	capsid	A0A222ZEN6	Arthrobacter_phage	40.0	1.4e-76
WP_138967486.1|8997059_8997950_-|head,protease	HK97 family phage prohead protease	head,protease	A0A222ZEN8	Arthrobacter_phage	47.3	3.4e-42
WP_138964177.1|8997963_8999922_-|portal	phage portal protein	portal	A0A222ZFM5	Arthrobacter_phage	41.0	2.5e-122
WP_138964179.1|8999921_9000140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138964181.1|9000161_9001940_-|terminase	terminase large subunit	terminase	A0A1B3B1U6	Gordonia_phage	58.7	1.4e-196
>prophage 5
NZ_CP030771	Streptomyces sp. YIM 121038 chromosome, complete genome	10130554	9019445	9025616	10130554		Streptomyces_phage(71.43%)	10	NA	NA
WP_138964250.1|9019445_9020135_-	VWA domain-containing protein	NA	A0A160DF64	Gordonia_phage	37.7	2.1e-31
WP_138964252.1|9020198_9020447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138964254.1|9020443_9020683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138964256.1|9020679_9020979_-	WhiB family transcriptional regulator	NA	NA	NA	NA	NA
WP_138964258.1|9020975_9021533_-	hypothetical protein	NA	A0A0M4QTU3	Streptomyces_phage	47.0	8.7e-36
WP_138967490.1|9021544_9022168_-	hypothetical protein	NA	Q1WDI4	Streptomyces_phage	49.1	3.1e-34
WP_138964260.1|9022358_9023162_-	DNA polymerase III subunit epsilon	NA	Q1WDI5	Streptomyces_phage	35.7	3.8e-32
WP_138967492.1|9023185_9023632_-	HNH endonuclease	NA	G9FH70	Rhodococcus_phage	42.9	5.1e-23
WP_138964262.1|9023757_9024783_-	hypothetical protein	NA	Q6VY80	Streptomyces_phage	50.1	4.4e-86
WP_138964264.1|9024782_9025616_-	hypothetical protein	NA	Q6VY81	Streptomyces_phage	54.7	1.2e-76
>prophage 6
NZ_CP030771	Streptomyces sp. YIM 121038 chromosome, complete genome	10130554	9069162	9078199	10130554		Streptomyces_phage(33.33%)	13	NA	NA
WP_171075974.1|9069162_9069741_+	TerD family protein	NA	A0A1J0GW82	Streptomyces_phage	37.8	9.0e-28
WP_138964379.1|9069902_9070535_+	hypothetical protein	NA	A0A2D1GGF9	Gordonia_phage	37.2	4.9e-19
WP_138964381.1|9070531_9071398_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0R8VB90	Thermobifida_phage	44.7	1.5e-58
WP_138964383.1|9071394_9072258_+	hypothetical protein	NA	A0A1B3B1U8	Gordonia_phage	51.2	7.3e-66
WP_138964385.1|9072337_9072709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138964387.1|9072705_9073083_+	DUF2493 domain-containing protein	NA	A0A1I9SDK9	Streptomyces_phage	50.8	4.3e-23
WP_138964389.1|9073183_9073441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138964391.1|9073437_9073833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138964393.1|9073829_9074252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138964395.1|9074248_9075271_+	DNA cytosine methyltransferase	NA	A5YK40	Mycobacterium_phage	38.7	5.8e-54
WP_138964397.1|9075385_9076234_+	hypothetical protein	NA	R4JHP8	Mycobacterium_phage	37.1	3.2e-42
WP_138964399.1|9076307_9077459_+	HNH endonuclease	NA	I6RTT8	Marinomonas_phage	36.4	1.4e-11
WP_138964401.1|9077455_9078199_+	hypothetical protein	NA	Q6VY73	Streptomyces_phage	43.8	1.6e-37
>prophage 7
NZ_CP030771	Streptomyces sp. YIM 121038 chromosome, complete genome	10130554	9117878	9124526	10130554	capsid,terminase,portal	Mycobacterium_phage(33.33%)	7	NA	NA
WP_171075985.1|9117878_9118043_+	HNH endonuclease	NA	A0A1C9M094	Mycobacterium_phage	59.1	4.2e-07
WP_138964525.1|9118415_9118904_+	hypothetical protein	NA	Q6VY56	Streptomyces_phage	67.9	1.2e-57
WP_138964527.1|9118908_9120585_+|terminase	terminase	terminase	A0A0K1Y5V8	Streptomyces_phage	58.8	2.3e-188
WP_138964529.1|9120581_9122051_+|portal	phage portal protein	portal	A0A2H4JAT8	uncultured_Caudovirales_phage	41.8	2.5e-74
WP_138964531.1|9122028_9122847_+	hypothetical protein	NA	F8S0R5	Gordonia_phage	31.3	3.1e-05
WP_138964533.1|9122910_9123546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138964535.1|9123566_9124526_+|capsid	phage major capsid protein	capsid	A0A127KPY1	Mycobacterium_phage	29.3	2.3e-20
>prophage 1
NZ_CP030772	Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence	967890	143875	289534	967890	transposase,plate,integrase,tail	Enterobacteria_phage(20.0%)	108	155555:155571	274659:274701
WP_138958190.1|143875_145546_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_138967843.1|146017_146794_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_138968754.1|146790_147357_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_138967845.1|147380_147983_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_138967847.1|147979_149167_-	radical SAM protein	NA	NA	NA	NA	NA
WP_138967849.1|149166_150228_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	29.9	9.4e-07
WP_138967851.1|150224_151241_-	thymidylate synthase	NA	NA	NA	NA	NA
WP_138967853.1|151750_153922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968756.1|153918_154119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968758.1|154201_154819_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_138967855.1|154821_155046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138967857.1|155237_155723_-	hypothetical protein	NA	NA	NA	NA	NA
155555:155571	attL	GCTCGTGGATGACCGCG	NA	NA	NA	NA
WP_138968760.1|156303_157395_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
155555:155571	attL	GCTCGTGGATGACCGCG	NA	NA	NA	NA
WP_138967859.1|157428_158334_+	phosphotransferase	NA	NA	NA	NA	NA
WP_138968762.1|159505_160339_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_138967861.1|160338_160665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171076184.1|160661_161240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967863.1|161239_163924_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_138967865.1|163920_164259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967867.1|164264_166967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967869.1|166963_168151_+	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	33.6	7.8e-10
WP_138968766.1|168510_168810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967871.1|169264_169753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968768.1|169992_170649_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_138967873.1|170676_171363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968770.1|171374_172280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967875.1|172392_173793_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_138967877.1|173789_174749_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_138968772.1|174739_175648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967879.1|175692_175914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967881.1|175910_176324_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_138968774.1|176410_176836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967883.1|176835_177312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967885.1|177314_180746_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_138967887.1|181084_181366_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_171076185.1|181503_181656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967889.1|181821_182373_-	flavoprotein	NA	NA	NA	NA	NA
WP_138967891.1|182369_183617_-	helix-turn-helix transcriptional regulator	NA	A0A0M4RQ74	Streptomyces_phage	26.7	4.8e-18
WP_138967893.1|183695_184202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967895.1|184198_184591_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_138967897.1|184870_186073_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_138967899.1|186542_186890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138967901.1|186978_187248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967903.1|187551_188460_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_138967905.1|188475_188889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138967907.1|188888_189830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138967909.1|190111_191818_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_138967911.1|191945_192689_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968776.1|193677_194904_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_138967913.1|195038_197141_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_138967915.1|197103_198495_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	29.2	3.0e-21
197349:197365	attR	CGCGGTCATCCACGAGC	NA	NA	NA	NA
WP_138967917.1|198494_199019_+	ATP-binding protein	NA	NA	NA	NA	NA
197349:197365	attR	CGCGGTCATCCACGAGC	NA	NA	NA	NA
WP_138967919.1|199269_200430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967921.1|200426_200918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967923.1|200914_202867_+	DUF3732 domain-containing protein	NA	NA	NA	NA	NA
WP_138967925.1|202906_203323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138967927.1|203322_205620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138967929.1|205616_207395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138967931.1|207553_209014_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_138967933.1|209148_209562_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	46.8	2.9e-28
WP_138967935.1|210009_210498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138967937.1|211465_211735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967939.1|214803_215178_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_138967941.1|215642_216287_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_138967943.1|216235_216526_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	38.3	1.3e-06
WP_138967945.1|216675_216771_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_138967947.1|216786_217026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967949.1|217180_217378_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_138967951.1|217497_218253_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171076186.1|219215_220589_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	32.2	3.1e-42
WP_138967957.1|222229_223870_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	J9PVC2	Bacillus_phage	35.7	3.2e-38
WP_138967959.1|224052_224502_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_138967961.1|224494_224917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967964.1|226383_226836_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_138967966.1|226882_227680_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_171076187.1|227663_229892_+	VgrG-related protein	NA	NA	NA	NA	NA
WP_138967970.1|229906_230320_+	GPW/gp25 family protein	NA	A0A0E3F3H3	Synechococcus_phage	42.9	8.7e-09
WP_138967972.1|230316_233499_+|plate	baseplate J/gp47 family protein	plate	NA	NA	NA	NA
WP_138967974.1|233727_234033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138967976.1|234145_235213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967978.1|235290_235896_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_138967980.1|235913_236108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967982.1|236244_238134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967984.1|238423_242671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967986.1|243007_243655_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_138967988.1|243651_245862_+	AAA family ATPase	NA	A0A0R6PCP6	Moraxella_phage	32.5	8.5e-26
WP_138967990.1|251174_251930_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_138967996.1|257961_261753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967998.1|263159_263351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968000.1|263408_263780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968002.1|263856_264306_+|transposase	transposase	transposase	B6ETC4	Enterobacteria_phage	41.4	7.3e-09
WP_138968779.1|264591_265038_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	34.0	1.0e-18
WP_138968005.1|265328_269099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968007.1|269242_270013_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968009.1|270153_270777_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_138968011.1|272237_272459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968002.1|273477_273927_+|transposase	transposase	transposase	B6ETC4	Enterobacteria_phage	41.4	7.3e-09
WP_138968781.1|274211_274658_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	34.7	3.5e-19
WP_138968013.1|275503_276259_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968783.1|278526_279405_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_138968015.1|279559_280825_-	cytochrome P450	NA	I6XF76	Cotesia_sesamiae_Mombasa_bracovirus	26.5	4.9e-18
WP_138968017.1|280924_281917_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_138968019.1|281913_282996_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_138968021.1|282992_284135_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_138968023.1|284131_286084_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_138968025.1|287189_287522_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138968785.1|287500_288133_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_138968789.1|288307_289534_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP030772	Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence	967890	295198	372174	967890	transposase,integrase	Acinetobacter_phage(25.0%)	56	323919:323978	374829:377108
WP_138968031.1|295198_296146_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	NA	NA	NA	NA
WP_138968033.1|296256_296643_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_138958190.1|296840_298511_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_138967841.1|298638_300639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968035.1|300794_301667_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_138968037.1|301736_302348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968039.1|302307_302883_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_138968041.1|302903_303332_-	RacP protein	NA	NA	NA	NA	NA
WP_138968043.1|303444_305094_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_138968045.1|305039_305660_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968047.1|305584_306124_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138968049.1|306170_307064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968051.1|307063_308347_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_138968053.1|308343_309174_-	RacO protein	NA	NA	NA	NA	NA
WP_138968055.1|309879_310512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968057.1|312094_313123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171076190.1|314403_314550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171076191.1|315934_316084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171076192.1|316080_316401_+|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	36.6	1.2e-10
WP_138968063.1|317783_318692_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_138968065.1|319041_319233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968066.1|319216_319636_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968791.1|321024_321261_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	5.9e-10
WP_171076193.1|321270_322371_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_138968071.1|322572_322800_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_138968074.1|322860_323109_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_138968077.1|323105_323381_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
323919:323978	attL	GTTGCTTCTTGAGTGATGTGGGTGGTTGCGGTCACGCTGCGGGGGCGGGTTGTCCCTGGT	NA	NA	NA	NA
WP_138968080.1|323949_324273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968082.1|327567_327906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171076194.1|328510_328657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171076195.1|328662_329511_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_138968086.1|330145_331174_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968793.1|333446_334925_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968088.1|335174_335480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171076196.1|335568_336036_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	36.2	2.3e-21
WP_138968002.1|336299_336749_-|transposase	transposase	transposase	B6ETC4	Enterobacteria_phage	41.4	7.3e-09
WP_138968092.1|336860_337679_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_171076197.1|338586_338742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171076198.1|339434_339893_+	recombinase family protein	NA	NA	NA	NA	NA
WP_138968098.1|340234_341551_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171076199.1|341985_342333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968100.1|342584_343862_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968795.1|346692_347574_-	SDR family NAD(P)-dependent oxidoreductase	NA	F2NZ12	Diadromus_pulchellus_ascovirus	28.0	3.9e-06
WP_138968007.1|347633_348404_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968105.1|348562_351121_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_138968107.1|351117_358428_-	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	21.7	5.4e-85
WP_138968109.1|358754_359000_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171076200.1|359128_360916_-	maturase	NA	NA	NA	NA	NA
WP_171076201.1|361478_361919_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_138968113.1|362357_364100_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	37.6	4.6e-83
WP_138968115.1|364725_365403_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	40.0	7.8e-31
WP_138968117.1|365419_368143_-	recombinase family protein	NA	NA	NA	NA	NA
WP_138968119.1|368273_368522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968121.1|368778_369075_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171076202.1|371064_371520_+|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_138968125.1|371565_372174_+|transposase	transposase	transposase	NA	NA	NA	NA
374829:377108	attR	GTTGCTTCTTGAGTGATGTGGGTGGTTGCGGTCACGCTGCGGGGGCGGGTTGTCCCTGGTAGCGGACGGCGTGGGTGTGCAGGTGGTCGAGTTCGGTGAAGGAGCGCCAGTACCGCTCGACGTTGCCGTTGTCGATGACGGCGCGCAGGAGGAGGACCGCCTCGGTGCCGGGCAGGCTTCCTCTGGCCCCGGTCGTGTCCAGGCGGTCCTTGACGAGGAGGCGGCAGCTTCCCTCGATCACCCCGGTCGCGATGGGCCAGCCCATAGTGAGGGTGAGGTGGTAGCGCAGGCAGGGCTCCTTGGCCTGCAGGGGAGGCGGCGGTGCGGGCGACGGCGGGCAGTTGCTTCGCGTCATCGGGGCGGGTGCGCAGGTGCTGGCGCAGTGCGACGACGCGGGGACTGTGCCCGTCCAGCACGGTGCGGGCGGCGCCGGCGGCCCAGGCCGCGCGCGCTGCGTGGCCTGGGTGGAGGTCCTCGGCGGCCCGCCACAGATATTCGATTACATGCACGATGTCCACGGTCGTGTCCGCATGGACGCCGCGGGTGCCCGCTTCCCTTGCGATGCACCCGGTCGGGTTGGTGGTTGGCGCCGTCGACCGGGACGATCCGGCGGCGCCGGTGGTCGGGGTCTCGCTGTTCGGTGTGGTCAAACATGGCGGTGACCATGGCCGCGGCGGACCGCTGAAGGGAGCCCAGGTGTCGGCCCCGTGCGCGCGGGCCGTGGGTGCGGGCAGCGCGTTCGGCCGCGGTGGCCGGCAGGACGTCCGCACCGGTGCGTGGGACCCCCACGCACCGGTGCGTGGGACCGGGTCGGCGTCGTAGATAACGAAGACGGTCGCCATCCGCCGGCGACCGGTGTGCTCGCGACTGGACAGCTGGGCCGAGGGCGGCTTGGGGCCGTCGGCTGCCCGTGCGGTGCGGACCGGCTCCCGCGGATCAGACGGGATCATGTTCACGCCGGTCGCGTCGCAGCTGAGCACCAGCAGCCGGTCCCCCTCGCTGCCGGCGGCCGGGGCGGACACACCCTGCTGGCAGAAGGCGGGGATGCGGGCGGCGACGCGACAGGCGATCTCCATCAACTGCCCGGTGCCGGGCCGGCGGCCGGTGGTGCGCTCAAGGTGCGCGCCCGCCCGGCGCAGGGGTGTCTGTGCGGCCTCGAGGGCGACGGCGCGCTGCAGCGGGGAGGAGCAGACCTGCTGCGGCAGGGACAGGGCGGCGTCGCCGGGGTGCAGGTTGGCCGCACCGGGGGCGCGGTAAGCCATCCCGGTCGCCTCCACCCGGCCCAGCGTGGTGGCCAGCAGCCGGCGGTGGCTCCGTTCGGCCCAAGGACGCACCACCGTGTCGCTGCCCGTGACGACCTCCACGCGCACCTCGGCGGCGGCGCGGGCATCCACCTGGGGTAGCGCCGAGGGAAGCCCAAAAGCCGCCAGATCTTGATCGTGGTGGGTCTTTTCAGCTCCGGGTGTGAGCCCCGAGGGCGTTGACGCGGTTCTCGTACTCGCGGCGGGCCTTCCGCTGGGCCGGGATCGCCGCGGTGCCGTCGAGAGGCTGGCAGCGGTCGAGGAGTTGGCGGTGGACCGCGGGAGTGGCGGTGAACGGGCCGGGGACCTGGGGCGCGGACATGTAAGGCGCCACCGGGTCTTCTTCCTTGCCCGGTCTGGCTCCTCACCCGACCAGCAAGAAGGAGGCCCGTCCCCGTACCGGCAGGAAACCCGCGCACCGCGGCACCTCCACGCGCCAGGGTGAAGAGGCCGCCCGGGGTCTGCACCACCCGCCCGGCGGCAGTAGCCTTCTTCAACTGGTGGCGCACCCGCTCCACTTCACGGGACACCGCCTCCAGCCCGAGCCCCTCCACCACCTGCCGACACCGCACCGGACCGGCCTACGCGGCCAGCACCCCCAGCATCCGCCCCGTGAACTCGCCAGCTTCCTCGGCAGCTTGAATGCCGACGGGACCCGACACCTCCGCTCGCGGGGCCGGGGCCCGACCCCGACCCGGCCTCGCCGTGCGCCGCCGGGAGCCCGCCTACGACCTGGCATGCCGTCGCCACCCGGGCCAGCTCCTGCTCGCACACCACCAGCAGCCCCGCGCCCCGCACGGCCTCCCCGCGCAACCGCTCCGCCTCCCGACGGCAGGCCGCCTCCCGCTCCCGCAGCAGCAAGAGCACCTCCCCACAGCCCATCCGGCCCCGCCTCACCCACACCAGCTGATCAACAGCTACCGCAACGAGAAACCCGGCCCACCAGACACACACTCGTCACTCAAGAGGAAACGCACCC	NA	NA	NA	NA
>prophage 3
NZ_CP030772	Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence	967890	377086	592079	967890	transposase,protease	Salmonella_phage(33.33%)	115	NA	NA
WP_171076203.1|377086_377659_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171076204.1|377585_377882_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_138968802.1|378796_379276_+	flavin reductase	NA	NA	NA	NA	NA
WP_138968133.1|379272_381051_+	tryptophan 7-halogenase	NA	NA	NA	NA	NA
WP_138968789.1|381224_382451_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_138968804.1|382790_383990_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_138958190.1|387352_389023_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_138967841.1|389151_391152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968135.1|393711_394164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968137.1|394414_399196_-	acyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_171076205.1|399276_402381_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_171076206.1|402316_402643_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_171076207.1|403927_404293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968145.1|404546_404831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968147.1|407436_407769_+	Lsr2 family protein	NA	A0A160DEV0	Gordonia_phage	39.8	2.3e-12
WP_138968149.1|411981_412419_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_138968151.1|412520_413276_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171076208.1|414968_415424_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171076209.1|416665_418666_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	33.2	5.2e-22
WP_138968157.1|419584_420568_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171076210.1|421304_421556_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171076211.1|421704_422340_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968161.1|426338_426914_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_138968163.1|426910_427426_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138968165.1|428787_429114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968167.1|429721_430276_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_138968169.1|431126_432302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968171.1|434464_435772_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_138968163.1|435914_436430_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138968161.1|436426_437002_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_138968175.1|437133_438054_+|transposase	transposase	transposase	A0A0M5M147	Mycobacterium_phage	60.9	7.6e-53
WP_138968177.1|438492_439695_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_138968179.1|439813_440572_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968181.1|442097_443591_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_138968183.1|445374_446037_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968187.1|448912_449377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968189.1|449764_449971_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968191.1|450052_450418_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_138968193.1|450407_451844_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	30.3	9.1e-29
WP_138968195.1|452323_452626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968198.1|452622_453636_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_138968200.1|453645_454014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968202.1|454010_455144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968204.1|458026_458566_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968206.1|459138_460581_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_138968809.1|460640_461255_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_138968208.1|461251_461737_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171076212.1|461955_463347_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_138968213.1|464452_465325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968811.1|467132_469283_+	recombinase family protein	NA	A0A0K1Y9M7	Streptomyces_phage	27.3	1.5e-06
WP_171076213.1|473803_473968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968218.1|474038_474551_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138968220.1|474728_474998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968814.1|476022_476988_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_138968222.1|476984_477911_+	TniQ family protein	NA	NA	NA	NA	NA
WP_138968816.1|480769_481090_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171076214.1|481139_481286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967903.1|481634_482543_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_138967905.1|482558_482972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138967907.1|482971_483913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968226.1|484128_490389_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_171076215.1|490385_491198_-	acyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_138968230.1|491248_492010_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_138968232.1|492006_492759_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_138968234.1|492751_493987_-	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_138968236.1|493997_495257_-	polyketide beta-ketoacyl:ACP synthase	NA	NA	NA	NA	NA
WP_138968238.1|495264_495516_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_171076216.1|495512_497216_-	polyketide synthase	NA	NA	NA	NA	NA
WP_171076217.1|498517_498778_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968244.1|498807_500024_-|transposase	IS3 family transposase	transposase	A0A160DCU2	Gordonia_phage	33.1	1.5e-40
WP_171076218.1|500712_501297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968248.1|502646_502925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968250.1|503712_506940_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_138968818.1|508289_508838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968252.1|508906_510439_+|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_138968254.1|512103_512703_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138968163.1|512837_513353_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138968161.1|513349_513925_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_171076219.1|513878_515075_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_171076220.1|515079_516441_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_138968821.1|517399_518653_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_138968260.1|518576_519017_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968823.1|519652_528217_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	29.6	9.6e-25
WP_171076221.1|528263_533816_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	29.0	4.2e-21
WP_138968264.1|533817_537873_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	28.1	2.6e-20
WP_138968266.1|537869_540122_+	polyketide synthase	NA	NA	NA	NA	NA
WP_138968268.1|540816_542388_+	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_138968271.1|542874_543624_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_138968825.1|544133_544637_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968273.1|544629_544860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968827.1|545622_546879_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_138958988.1|549563_550763_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_138968830.1|552783_553443_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968275.1|553495_554854_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_138968277.1|555813_558924_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.6	4.5e-49
WP_138968279.1|560576_561659_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_138968281.1|561655_562630_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_138968283.1|562678_564061_+	cytochrome P450	NA	S4VQU1	Pandoravirus	29.6	4.4e-20
WP_138968285.1|564598_564907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968287.1|565227_566952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968289.1|567421_568330_-	recombinase family protein	NA	A0A1B0VBM1	Salmonella_phage	28.1	2.6e-05
WP_138958063.1|568572_569328_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_138968291.1|569329_570058_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_138968293.1|570356_572681_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_138968295.1|573253_573589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968297.1|573751_574666_+	recombinase family protein	NA	A0A1B0VBM1	Salmonella_phage	27.5	7.6e-05
WP_171076222.1|574662_576501_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	32.1	1.4e-26
WP_171076223.1|577184_577361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968301.1|578893_580819_+	2,3-oxidosqualene cyclase	NA	NA	NA	NA	NA
WP_138968303.1|580881_581691_+	squalene/phytoene synthase family protein	NA	NA	NA	NA	NA
WP_138968305.1|581678_582965_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_138968307.1|584734_586468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968309.1|586593_587688_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_171076224.1|588341_588854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171076225.1|588875_592079_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	28.0	2.4e-45
>prophage 4
NZ_CP030772	Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence	967890	595422	671083	967890	transposase,integrase,protease	Streptomyces_phage(25.0%)	57	590714:590732	681496:681514
590714:590732	attL	CGTCCAGGACCCGGCCGTC	NA	NA	NA	NA
WP_138968317.1|595422_596535_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_138968177.1|597208_598411_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_138968319.1|598528_598831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968322.1|598966_600376_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_138968324.1|600874_601378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968326.1|602493_603501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171076226.1|603581_604763_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_138968330.1|604928_606107_-	glutathione synthetase	NA	NA	NA	NA	NA
WP_138968332.1|606180_607440_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_138968334.1|607508_608600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968336.1|609964_610702_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138968338.1|610804_612010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968341.1|612293_612776_-	toxin-antitoxin system, toxin component	NA	NA	NA	NA	NA
WP_138968343.1|613884_614856_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_138968345.1|615182_616019_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1J0MC37	Streptomyces_phage	36.8	5.7e-31
WP_171076227.1|616198_617446_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_138968349.1|617518_617803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968351.1|617799_618024_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.2	1.1e-10
WP_138968353.1|618209_618803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968355.1|618846_621270_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_138968834.1|621266_622421_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_138968359.1|623998_624907_+	cytochrome P450	NA	NA	NA	NA	NA
WP_138968361.1|624927_626154_+	cytochrome P450	NA	NA	NA	NA	NA
WP_138968836.1|626235_627000_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_138968363.1|627601_628552_-	magnesium transporter CorA	NA	NA	NA	NA	NA
WP_138968365.1|628596_628785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968367.1|632199_633396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968369.1|636357_636690_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_138968371.1|636747_636954_-	DUF2180 family protein	NA	NA	NA	NA	NA
WP_138968373.1|636953_637529_-|protease	DJ-1/PfpI/YhbO family deglycase/protease	protease	NA	NA	NA	NA
WP_138968375.1|637650_638181_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_138968378.1|638399_639260_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138968380.1|640516_641725_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_138968382.1|642972_645405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968384.1|646254_646668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171076228.1|647641_647941_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968388.1|647996_648662_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	37.8	3.4e-31
WP_138968390.1|650092_650974_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_138968838.1|650970_651246_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968392.1|651547_652039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968394.1|652614_653526_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_138968396.1|654354_654972_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968398.1|655278_655467_-	hypothetical protein	NA	Q8W6R2	Burkholderia_virus	56.7	4.2e-11
WP_171076229.1|655661_656099_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138968406.1|659902_660262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968408.1|660298_660514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968411.1|660561_660756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968413.1|660736_661390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968415.1|661433_661712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968840.1|662071_663379_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_138968161.1|663476_664052_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_138968417.1|664048_664564_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138968419.1|664617_666063_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_171076261.1|666135_666932_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_171076230.1|666931_667633_-	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_138968789.1|668308_669535_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_138968804.1|669883_671083_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
681496:681514	attR	CGTCCAGGACCCGGCCGTC	NA	NA	NA	NA
>prophage 5
NZ_CP030772	Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence	967890	687350	848251	967890	transposase,integrase	Enterobacteria_phage(30.43%)	111	762131:762173	846511:846553
WP_138968444.1|687350_688415_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_171076231.1|688752_689379_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_138968448.1|689710_691222_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_138968450.1|691913_693401_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_138968452.1|693439_694987_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_138968454.1|695467_696067_+	cytochrome P450	NA	NA	NA	NA	NA
WP_138968254.1|699825_700425_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138968456.1|701631_702321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968458.1|702636_702888_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_138968460.1|703129_703927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968462.1|704254_705493_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_138968464.1|707587_707818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968466.1|708727_709288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968468.1|709519_710002_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138968470.1|710424_710724_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968472.1|710793_711336_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	34.3	2.9e-12
WP_138968474.1|711694_711877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968476.1|715165_715900_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	30.1	1.5e-24
WP_138968477.1|715904_716345_-|transposase	transposase	transposase	B6ETC4	Enterobacteria_phage	42.2	8.1e-05
WP_171076173.1|717598_717763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171076232.1|717853_719485_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	36.5	2.0e-08
WP_138968481.1|719474_720548_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_138968483.1|721182_721476_+	recombinase family protein	NA	NA	NA	NA	NA
WP_138968485.1|722105_722417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171076233.1|722625_723582_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968472.1|723880_724423_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	34.3	2.9e-12
WP_138968470.1|724492_724792_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968489.1|726729_727695_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968491.1|727841_728633_+	response regulator	NA	W8CYM9	Bacillus_phage	34.9	9.8e-33
WP_138968493.1|728629_729865_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_138968789.1|731044_732271_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_138968495.1|732874_733348_-	ester cyclase	NA	NA	NA	NA	NA
WP_138968497.1|733354_734383_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_138968499.1|734459_735266_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.8	5.3e-26
WP_171076234.1|735348_736221_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_138968503.1|736217_737603_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_138968505.1|737654_738722_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_171076235.1|738919_739471_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_138968509.1|739581_740376_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_138968511.1|740377_742600_-	MFS transporter	NA	NA	NA	NA	NA
WP_138968513.1|742700_743207_+	VOC family protein	NA	NA	NA	NA	NA
WP_138968515.1|743221_744718_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_138968517.1|744764_746042_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_138968519.1|746038_747031_-	NAD-binding protein	NA	NA	NA	NA	NA
WP_138968521.1|747194_748229_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_138968523.1|748222_749269_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	30.1	9.0e-26
WP_138968525.1|749284_750130_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_138968527.1|750682_751198_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171076262.1|751079_751592_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968531.1|751555_752116_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138968533.1|753150_754365_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_171076236.1|754811_755732_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	31.7	5.1e-33
WP_171076237.1|756049_756448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968025.1|757048_757381_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138968785.1|757359_757992_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_171076238.1|757993_758707_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	35.2	2.3e-09
WP_138968849.1|758703_758931_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968002.1|760949_761399_+|transposase	transposase	transposase	B6ETC4	Enterobacteria_phage	41.4	7.3e-09
WP_171076239.1|761662_762130_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	34.9	7.3e-20
762131:762173	attL	AGTCATCACCAGACACCTGCCCGGAAAGCGCGAGACCCCTCAG	NA	NA	NA	NA
WP_138968541.1|762320_763076_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968543.1|763575_764166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968080.1|764382_764706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968851.1|768627_771174_+	phosphotransferase	NA	NA	NA	NA	NA
WP_138968545.1|771276_771402_+	SapB/AmfS family lantipeptide	NA	NA	NA	NA	NA
WP_138968547.1|771559_773347_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_138968549.1|773392_775345_+	ATP-binding cassette domain-containing protein	NA	A0A076FI99	Aureococcus_anophage	26.9	9.2e-08
WP_138968551.1|775289_775979_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_138968121.1|777360_777657_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968553.1|779022_780066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171076240.1|780493_781882_-	cytochrome P450	NA	I6WI04	Cotesia_sesamiae_Mombasa_bracovirus	29.1	6.5e-16
WP_171076241.1|781857_782274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968854.1|783090_784434_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_138968557.1|784504_785746_-	TniQ family protein	NA	NA	NA	NA	NA
WP_138968220.1|787703_787973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968218.1|788150_788663_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171076213.1|788733_788898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968559.1|791758_792979_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_138968836.1|796744_797509_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_138968361.1|797590_798817_-	cytochrome P450	NA	NA	NA	NA	NA
WP_171076242.1|798837_799608_-	cytochrome P450	NA	NA	NA	NA	NA
WP_171076262.1|799655_800168_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968531.1|800131_800692_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138968252.1|802453_803986_-|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_138968818.1|804054_804603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968563.1|805487_806042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171076243.1|807302_807545_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968567.1|807564_809787_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_171076263.1|810923_811763_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_138968571.1|812036_812612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968856.1|813851_815228_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_138968858.1|815916_816144_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171076244.1|816140_816773_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	35.2	2.1e-09
WP_171076245.1|818100_818298_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_138968860.1|822606_823551_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_138968161.1|824505_825081_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_138968163.1|825077_825593_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138968577.1|827472_828285_-	methyltransferase domain-containing protein	NA	A0A1X9I6N4	Streptococcus_phage	35.7	1.4e-10
WP_138968580.1|828472_829708_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_138968582.1|831366_832182_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_138968002.1|833130_833580_+|transposase	transposase	transposase	B6ETC4	Enterobacteria_phage	41.4	7.3e-09
WP_138968584.1|833576_834311_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	30.5	1.8e-25
WP_138968586.1|835073_835346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171076246.1|835360_836722_+	cytochrome P450	NA	S4VXU7	Pandoravirus	25.8	7.3e-12
WP_138968864.1|836772_837495_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	31.3	2.0e-08
WP_138968591.1|837662_838679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171076236.1|839766_840687_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	31.7	5.1e-33
WP_138968593.1|841300_842986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968596.1|843063_843276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968002.1|845329_845779_+|transposase	transposase	transposase	B6ETC4	Enterobacteria_phage	41.4	7.3e-09
WP_171076247.1|846042_846510_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	36.2	6.0e-22
WP_138967588.1|846772_848251_+|transposase	transposase	transposase	NA	NA	NA	NA
846511:846553	attR	AGTCATCACCAGACACCTGCCCGGAAAGCGCGAGACCCCTCAG	NA	NA	NA	NA
>prophage 6
NZ_CP030772	Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence	967890	852506	922199	967890	transposase	Streptomyces_phage(28.57%)	48	NA	NA
WP_138968606.1|852506_853376_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_138968868.1|853733_855335_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_138968608.1|855423_855897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968610.1|856007_856331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171076249.1|857380_857557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968870.1|860501_860957_-	hypothetical protein	NA	A0A222YU12	Streptomyces_phage	56.6	1.3e-10
WP_138968614.1|861527_861809_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138968616.1|863437_863929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171076250.1|864122_864959_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_171076251.1|865649_865805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968621.1|866328_866784_-	WhiB family transcriptional regulator	NA	NA	NA	NA	NA
WP_171076252.1|870491_871658_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_138968625.1|871772_871988_+|transposase	transposase	transposase	A0A0M5M147	Mycobacterium_phage	55.0	6.3e-11
WP_171076253.1|872290_872626_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968629.1|872622_873690_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_138968208.1|873853_874339_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138968809.1|874335_874950_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_138968631.1|875005_875302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171076254.1|875778_875916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138967937.1|876267_876537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968633.1|878659_878965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968635.1|880166_880913_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_138968559.1|883191_884412_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_138968637.1|884863_885607_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A291LHM6	Streptomyces_phage	32.5	6.2e-05
WP_138968639.1|885849_886095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138968809.1|886277_886892_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_138968208.1|886888_887374_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_138968419.1|887432_888878_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_171076174.1|889647_889899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171076255.1|891926_892136_-	single-stranded DNA-binding protein	NA	A0A0U4B2E8	Arthrobacter_phage	59.7	4.8e-16
WP_138968645.1|894268_894814_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_171076175.1|896892_897300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968647.1|897296_897578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171076256.1|897632_898844_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_171076257.1|898891_899299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171076258.1|900817_902122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171076259.1|903894_904677_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_138968872.1|904660_905755_+	type III polyketide synthase	NA	NA	NA	NA	NA
WP_138968655.1|905751_906198_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_138968657.1|906201_906702_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_138968659.1|906714_907734_+	methyltransferase	NA	NA	NA	NA	NA
WP_138968661.1|907851_908301_+|transposase	transposase	transposase	B6ETC4	Enterobacteria_phage	41.4	7.3e-09
WP_138968663.1|908297_909032_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	30.5	1.4e-25
WP_138968665.1|910104_916491_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	32.8	9.0e-28
WP_138968874.1|917265_918246_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_138968668.1|918410_919262_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_138968670.1|919554_919782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138968876.1|921989_922199_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
