The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP034944	Morganella morganii subsp. morganii strain ATCC 25830 chromosome, complete genome	3889903	110327	119174	3889903		Escherichia_phage(66.67%)	8	NA	NA
WP_115356190.1|110327_112781_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.6	1.1e-215
WP_004237907.1|112792_113410_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	8.0e-75
WP_004237908.1|113411_114272_+	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	35.7	1.1e-26
WP_004237909.1|114357_114969_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.2	2.4e-23
WP_004237910.1|115036_115327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015422349.1|115454_116141_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004237912.1|116229_116850_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	55.5	3.0e-61
WP_004237914.1|117218_119174_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.0	5.7e-82
>prophage 2
NZ_CP034944	Morganella morganii subsp. morganii strain ATCC 25830 chromosome, complete genome	3889903	909370	980740	3889903	portal,head,integrase,capsid,protease,terminase,tRNA,tail	Morganella_phage(67.35%)	77	938672:938718	980897:980943
WP_004237643.1|909370_909850_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_004237644.1|909901_910711_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_004237646.1|910846_913585_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.4	4.8e-111
WP_004237647.1|913726_914143_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004237648.1|914326_916015_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004237649.1|916051_920686_+	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	27.1	2.7e-21
WP_004237650.1|920879_921167_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_004237651.1|921150_921378_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_004237652.1|921680_923165_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_004237653.1|923230_923683_-	NfeD family protein	NA	NA	NA	NA	NA
WP_004237654.1|923679_924618_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_015422944.1|924673_925531_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_004241009.1|925590_926376_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032099246.1|926438_927065_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_004237659.1|927032_927719_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.5	3.9e-30
WP_004237661.1|927715_930148_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004237662.1|930144_931410_-	MFS transporter	NA	NA	NA	NA	NA
WP_004237663.1|931498_932569_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_015422943.1|932568_933093_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_004237665.1|933241_933964_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004237667.1|933966_934461_-	peptidylprolyl isomerase B	NA	A0A076FI46	Aureococcus_anophage	34.0	3.1e-13
WP_004237668.1|934734_936123_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L4N2	Tupanvirus	33.3	1.4e-39
WP_004237672.1|936298_936688_+	cytochrome b562	NA	NA	NA	NA	NA
WP_004237673.1|936767_937301_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	39.3	2.8e-15
WP_004237674.1|937369_937582_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004241000.1|937584_938448_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	33.2	6.5e-30
938672:938718	attL	CCTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTACCAT	NA	NA	NA	NA
WP_024475093.1|938793_938982_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_061057637.1|939012_939561_-	3'-5' exoribonuclease	NA	A0A1W6JP74	Morganella_phage	84.5	2.2e-84
WP_024475095.1|939587_940310_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	94.8	3.2e-91
WP_024475096.1|940352_940580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024475097.1|940678_941506_-	YfdQ family protein	NA	U5P439	Shigella_phage	54.6	9.4e-79
WP_025154873.1|941571_941934_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	65.5	2.4e-34
WP_024475296.1|942154_942367_-	hypothetical protein	NA	A0A1W6JP89	Morganella_phage	81.4	2.0e-25
WP_024475295.1|942467_943100_-	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	43.5	1.1e-39
WP_024475294.1|943201_943414_+	cell division protein	NA	A0A1W6JP24	Morganella_phage	44.3	1.3e-08
WP_024475293.1|943443_943941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057519.1|944005_944197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057518.1|944193_944382_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	91.8	1.4e-27
WP_024475215.1|944378_945263_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	89.8	6.4e-134
WP_061057517.1|945259_945502_+	hypothetical protein	NA	A0A1W6JP32	Morganella_phage	53.8	7.3e-16
WP_024475217.1|945501_946038_+	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	93.8	3.2e-96
WP_024475218.1|946034_946436_+	hypothetical protein	NA	A0A1W6JP58	Morganella_phage	42.5	5.1e-14
WP_024475219.1|946453_947242_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	97.7	9.7e-142
WP_024475220.1|947241_948258_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	96.4	3.6e-197
WP_024475221.1|948288_948666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057436.1|948907_949102_+	hypothetical protein	NA	A0A1W6JP28	Morganella_phage	98.4	2.3e-28
WP_061057516.1|949240_950296_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	94.3	8.4e-173
WP_163628338.1|950519_950660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024474664.1|950825_951017_+	hypothetical protein	NA	A0A1W6JP85	Morganella_phage	100.0	4.9e-31
WP_024474665.1|951009_951486_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	91.7	1.3e-80
WP_163656456.1|951467_951626_+	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	95.6	5.6e-17
WP_061057477.1|951622_952000_+	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	76.6	5.3e-45
WP_024474659.1|952489_952843_+	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	94.0	2.2e-61
WP_024474658.1|952989_953460_+|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	88.5	8.5e-77
WP_061057515.1|953463_955194_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	92.9	0.0e+00
WP_004238661.1|955203_955383_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	62.5	4.4e-10
WP_024474656.1|955382_956603_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	73.5	1.9e-176
WP_061057472.1|956586_957243_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	76.4	2.8e-94
WP_061057471.1|957252_958464_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	62.1	1.1e-139
WP_024474653.1|958505_958799_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	39.8	8.1e-09
WP_024474652.1|958809_959136_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	83.3	4.6e-45
WP_061057470.1|959128_959578_+	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	93.3	9.6e-70
WP_024474650.1|959574_959910_+	DUF3168 domain-containing protein	NA	A0A1W6JP05	Morganella_phage	94.6	3.1e-57
WP_024474649.1|959970_960438_+	hypothetical protein	NA	A0A1W6JP06	Morganella_phage	93.5	7.7e-78
WP_036412064.1|960441_960825_+|tail	phage tail protein	tail	A0A1W6JP08	Morganella_phage	94.5	6.3e-62
WP_024474647.1|960836_961121_+	DUF4035 domain-containing protein	NA	A0A1W6JP68	Morganella_phage	98.9	3.6e-46
WP_024474646.1|961145_964406_+|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	95.2	0.0e+00
WP_024474645.1|964402_964738_+|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	92.8	7.4e-59
WP_024474644.1|964734_965493_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	96.4	1.4e-145
WP_024474643.1|965495_966197_+	C40 family peptidase	NA	A0A1W6JP31	Morganella_phage	95.6	1.0e-134
WP_024474642.1|966229_966832_+|tail	tail assembly protein	tail	A0A1W6JNY8	Morganella_phage	90.0	2.5e-97
WP_024474641.1|966865_970954_+	DUF1983 domain-containing protein	NA	A0A1W6JNZ7	Morganella_phage	67.5	0.0e+00
WP_061057513.1|972615_973986_+	tyrosine phenol-lyase	NA	NA	NA	NA	NA
WP_024475164.1|974120_975389_+	tryptophan permease	NA	NA	NA	NA	NA
WP_024474762.1|978610_978892_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024474763.1|978971_979256_-	DinI-like family protein	NA	A0A1W6JP10	Morganella_phage	86.5	1.2e-36
WP_024474764.1|979522_980740_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.3	9.4e-35
980897:980943	attR	CCTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTACCAT	NA	NA	NA	NA
>prophage 3
NZ_CP034944	Morganella morganii subsp. morganii strain ATCC 25830 chromosome, complete genome	3889903	1297568	1335751	3889903	protease,terminase,portal,tail	Morganella_phage(40.91%)	54	NA	NA
WP_004238015.1|1297568_1298198_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.2	2.1e-54
WP_004238016.1|1298216_1299443_-	DUF3440 domain-containing protein	NA	L0P6Z6	Lactobacillus_phage	33.7	1.1e-62
WP_032098716.1|1299675_1300149_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_064483691.1|1300393_1301566_-	hypothetical protein	NA	A0A2D1GN00	Marinobacter_phage	30.8	2.6e-29
WP_115356044.1|1301813_1302383_-	3'-5' exoribonuclease	NA	A0A1W6JP74	Morganella_phage	89.4	1.2e-96
WP_049246558.1|1302375_1302675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115356182.1|1302674_1303205_-	hypothetical protein	NA	A0A2I7R6M5	Vibrio_phage	30.5	4.4e-13
WP_115356045.1|1303237_1303498_-	antitoxin	NA	NA	NA	NA	NA
WP_115356046.1|1303500_1304028_-	HD family hydrolase	NA	A0A1W6JP41	Morganella_phage	95.9	5.2e-91
WP_115356047.1|1304137_1304965_-	YfdQ family protein	NA	U5P439	Shigella_phage	53.5	1.4e-77
WP_098935944.1|1305030_1305393_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	64.7	9.0e-34
WP_046025136.1|1305614_1305827_-	hypothetical protein	NA	A0A1W6JP89	Morganella_phage	100.0	4.4e-33
WP_098935942.1|1305978_1306866_+	NAD-dependent DNA ligase	NA	NA	NA	NA	NA
WP_046024009.1|1306851_1307538_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	43.0	6.2e-44
WP_024475202.1|1307663_1307900_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_115356048.1|1307957_1308422_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	73.9	1.2e-59
WP_036423206.1|1308486_1308678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025155132.1|1308674_1308863_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	98.4	4.5e-29
WP_115356049.1|1308859_1309744_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	96.9	1.6e-145
WP_115356050.1|1309740_1309989_+	hypothetical protein	NA	A0A1W6JP32	Morganella_phage	86.2	3.6e-34
WP_115356051.1|1310527_1310938_+	hypothetical protein	NA	A0A1W6JP58	Morganella_phage	96.3	7.7e-66
WP_115356052.1|1310934_1311147_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_115356053.1|1311121_1311502_+	hypothetical protein	NA	A0A1W6JP80	Morganella_phage	88.8	3.3e-55
WP_115356054.1|1311498_1311906_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1W6JP40	Morganella_phage	99.0	9.4e-56
WP_024474758.1|1311923_1312712_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	98.9	1.4e-143
WP_115356055.1|1312711_1313728_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	89.1	1.2e-181
WP_024474760.1|1313758_1314436_+	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	98.7	1.3e-129
WP_062773656.1|1314601_1314796_+	hypothetical protein	NA	A0A1W6JP28	Morganella_phage	100.0	1.0e-28
WP_115356056.1|1314934_1315993_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	93.6	2.9e-173
WP_115356057.1|1316214_1317210_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_162598914.1|1317516_1317669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004240322.1|1317834_1318026_+	hypothetical protein	NA	A0A1W6JNY9	Morganella_phage	98.4	1.9e-30
WP_115356058.1|1318018_1318495_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	91.7	7.5e-81
WP_165894462.1|1318494_1318635_+	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	97.8	1.0e-17
WP_115356059.1|1318631_1319159_+	hypothetical protein	NA	H9C185	Pectobacterium_phage	37.1	6.5e-17
WP_004242385.1|1319456_1319642_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	60.3	1.4e-11
WP_024474667.1|1319965_1320469_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	57.2	2.3e-40
WP_115356060.1|1320465_1322580_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	4.6e-295
WP_115356061.1|1322576_1322795_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	57.1	4.3e-15
WP_115356062.1|1322791_1324267_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	67.2	5.2e-189
WP_115356063.1|1324238_1326275_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	65.2	3.8e-254
WP_115356064.1|1326360_1326702_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	56.5	1.7e-21
WP_115356065.1|1326706_1326985_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_004242398.1|1326986_1327550_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	55.6	1.6e-45
WP_115356066.1|1327549_1327948_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	61.7	8.9e-43
WP_024474673.1|1327957_1328473_+	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	75.5	1.8e-64
WP_115356067.1|1328488_1328890_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	37.2	1.3e-12
WP_087696639.1|1328913_1329222_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.5	2.8e-20
WP_138919855.1|1329202_1332130_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	35.6	1.2e-141
WP_004242405.1|1332132_1332462_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	54.1	7.1e-30
WP_004242407.1|1332964_1333747_+	KilA-N domain-containing protein	NA	Q9MCN2	Enterobacteria_phage	45.0	6.9e-55
WP_004242408.1|1333758_1334457_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	50.9	8.5e-65
WP_108943318.1|1334474_1335203_+	C40 family peptidase	NA	A0A0P0ZE89	Stx2-converting_phage	60.8	4.4e-88
WP_046024959.1|1335106_1335751_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	46.7	3.9e-48
>prophage 4
NZ_CP034944	Morganella morganii subsp. morganii strain ATCC 25830 chromosome, complete genome	3889903	1418644	1469456	3889903	portal,head,integrase,capsid,plate,terminase,tRNA,holin,tail	Morganella_phage(33.33%)	64	1438679:1438694	1471188:1471203
WP_004238115.1|1418644_1419748_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_046025126.1|1419918_1420383_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_004238117.1|1420336_1421017_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004238119.1|1421161_1422415_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	8.0e-21
WP_115356072.1|1422849_1423692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115356073.1|1423909_1425043_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	72.6	6.7e-152
WP_079549298.1|1425017_1425260_-	excisionase	NA	NA	NA	NA	NA
WP_115356074.1|1425561_1425771_-	hypothetical protein	NA	A0A1W6JP89	Morganella_phage	78.6	1.2e-22
WP_115356075.1|1425885_1426608_-	transcriptional regulator	NA	A0A1R3Y604	Salmonella_virus	35.9	5.4e-30
WP_054424560.1|1426675_1426921_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	42.0	5.7e-08
WP_025155134.1|1426959_1427415_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	47.5	1.2e-30
WP_036422703.1|1427478_1427670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025155132.1|1427666_1427855_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	98.4	4.5e-29
WP_115356076.1|1427851_1428736_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	95.9	1.6e-145
WP_115356077.1|1428732_1428981_+	hypothetical protein	NA	A0A1W6JP32	Morganella_phage	47.5	6.0e-13
WP_115356078.1|1428980_1429997_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	87.6	2.6e-179
WP_115356183.1|1430027_1430468_+	antitermination protein Q	NA	B6SCZ7	Bacteriophage	55.6	1.0e-31
WP_138919857.1|1430772_1431099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170218374.1|1431309_1431900_+	S-adenosylmethionine-binding protein	NA	A0A193GYV6	Enterobacter_phage	78.2	2.5e-81
WP_115356079.1|1432485_1433691_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_115356080.1|1433691_1434837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115356081.1|1435044_1435236_+|holin	holin	holin	A0A1W6JNY9	Morganella_phage	96.8	5.4e-30
WP_115356082.1|1435228_1435705_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	64.7	1.1e-52
WP_170218372.1|1435704_1435845_+	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	86.4	2.0e-13
WP_115356083.1|1435841_1436219_+	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	84.0	9.3e-50
WP_046894974.1|1436824_1437136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115356084.1|1437370_1438015_+	hypothetical protein	NA	NA	NA	NA	NA
1438679:1438694	attL	TACTTGGCATTAGGTT	NA	NA	NA	NA
WP_115356085.1|1439035_1439617_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_115356086.1|1439591_1441565_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	46.4	4.8e-145
WP_004904843.1|1441574_1441826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138919877.1|1441882_1443487_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	36.8	5.0e-92
WP_115356087.1|1443483_1444338_+	S49 family peptidase	NA	A0A0B4SK12	Proteus_phage	44.3	1.9e-50
WP_115356088.1|1444340_1444952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115356089.1|1444951_1445344_+|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	33.0	1.1e-08
WP_115356090.1|1445417_1446464_+|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	34.1	9.8e-49
WP_115356091.1|1446476_1446848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115356092.1|1446837_1447176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115356093.1|1447175_1447724_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_004904824.1|1447726_1447894_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	54.8	4.7e-06
WP_115356094.1|1447890_1449372_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	43.5	2.2e-102
WP_004904816.1|1449381_1449750_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_105212820.1|1449749_1450016_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_115356095.1|1450158_1452051_+	hypothetical protein	NA	A0A0E3GMJ2	Enterobacteria_phage	33.6	7.8e-12
WP_138919858.1|1452085_1452493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115356096.1|1452543_1453011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115356097.1|1453131_1454532_+	DNA circularization protein	NA	NA	NA	NA	NA
WP_115356098.1|1454528_1455599_+|tail	phage tail protein	tail	B5TK72	Pseudomonas_phage	33.7	1.5e-39
WP_170218380.1|1455601_1456186_+|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_115356100.1|1456185_1456623_+	phage GP46 family protein	NA	B5TK74	Pseudomonas_phage	55.2	2.4e-17
WP_115356101.1|1456623_1457763_+|plate	baseplate J/gp47 family protein	plate	C9DGQ6	Escherichia_phage	29.4	3.6e-28
WP_115356102.1|1457759_1458353_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_115356105.1|1459080_1459485_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	48.6	2.2e-09
WP_115356104.1|1459468_1460086_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	36.4	1.4e-26
WP_138919859.1|1460087_1460942_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	41.7	1.7e-19
WP_115356106.1|1460931_1461486_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	73.3	2.0e-69
WP_115356107.1|1461752_1461929_+|tail	tail protein X	tail	O80307	Escherichia_phage	61.5	7.2e-05
WP_138919860.1|1462540_1463785_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_115356109.1|1463785_1464643_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_115356110.1|1465144_1465558_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	94.2	9.2e-67
WP_115356111.1|1465560_1466823_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	95.0	3.4e-229
WP_072161359.1|1467036_1467189_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.0	3.4e-19
WP_004235019.1|1467342_1468413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015422801.1|1468414_1469068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105212831.1|1469060_1469456_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	69.0	1.4e-43
1471188:1471203	attR	TACTTGGCATTAGGTT	NA	NA	NA	NA
>prophage 5
NZ_CP034944	Morganella morganii subsp. morganii strain ATCC 25830 chromosome, complete genome	3889903	1483834	1525945	3889903	portal,coat,integrase,lysis,holin,tail	Morganella_phage(20.0%)	60	1487146:1487160	1526109:1526123
WP_004235063.1|1483834_1484542_-	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	56.1	4.4e-69
WP_004235065.1|1484907_1485345_+	hypothetical protein	NA	A0A1W6JNY5	Morganella_phage	47.5	5.2e-28
WP_004235068.1|1485417_1485612_+	hypothetical protein	NA	A0A1W6JNY9	Morganella_phage	73.0	2.6e-24
WP_004235069.1|1485601_1486078_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	77.7	6.2e-67
WP_004239826.1|1486059_1486218_+	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	67.4	1.8e-10
WP_004235070.1|1486214_1486592_+	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	38.4	7.7e-12
WP_036417780.1|1486563_1486761_+	hypothetical protein	NA	A0A1W6JP52	Morganella_phage	67.9	1.1e-12
1487146:1487160	attL	TTGGTGTCCCCTGCA	NA	NA	NA	NA
WP_025155030.1|1487250_1487439_-	hypothetical protein	NA	E5AGD1	Erwinia_phage	60.0	7.7e-13
WP_087696447.1|1487649_1488189_-	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	64.2	4.6e-58
WP_115356113.1|1488178_1488517_-	DUF2591 family protein	NA	E9NID9	Enterobacter_phage	48.8	2.3e-15
WP_115356114.1|1488500_1488794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115356115.1|1489176_1489443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170218375.1|1489445_1489958_-	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	30.6	1.0e-11
WP_147288219.1|1489980_1490241_-	hypothetical protein	NA	A0A076G6R3	Escherichia_phage	47.1	3.7e-13
WP_004241046.1|1490292_1491093_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	89.4	9.3e-132
WP_004241047.1|1491085_1491904_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1P8DTH1	Proteus_phage	78.7	5.2e-130
WP_115356118.1|1491881_1492112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115356119.1|1492108_1492372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170218376.1|1492381_1492534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024473578.1|1492621_1492843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115356120.1|1492934_1493219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115356121.1|1493716_1494625_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	66.8	1.2e-116
WP_108656559.1|1494696_1495407_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	65.7	1.3e-81
WP_015422887.1|1495502_1495694_+	hypothetical protein	NA	A0A2K8HL98	Pseudomonas_phage	50.8	9.9e-08
WP_025154244.1|1495813_1496140_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	91.7	6.1e-50
WP_004241058.1|1496243_1496414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115356122.1|1496403_1497492_+	replication protein	NA	E5AGE9	Erwinia_phage	48.1	4.0e-77
WP_115356123.1|1497491_1498868_+	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	59.6	2.1e-160
WP_115356124.1|1498892_1499156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115356125.1|1499158_1499368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115356126.1|1499354_1499585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115356127.1|1499584_1499767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138919862.1|1499817_1499979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115356129.1|1500105_1500549_+	recombination protein NinB	NA	A0A1P8DTD8	Proteus_phage	84.9	2.1e-29
WP_112544313.1|1500545_1500743_+	hypothetical protein	NA	A0A1W6JP14	Morganella_phage	89.2	9.5e-30
WP_112548077.1|1501132_1501504_+	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	66.1	5.0e-40
WP_115356131.1|1501693_1502515_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	46.5	1.8e-58
WP_138919863.1|1503026_1503539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170218377.1|1503904_1504219_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	66.7	1.4e-35
WP_108656572.1|1504211_1504694_+	TIGR02594 family protein	NA	A0A1U9ZAE8	Proteus_phage	71.8	4.7e-62
WP_115356132.1|1504695_1505145_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	55.7	5.9e-35
WP_115356133.1|1505144_1505369_+	hypothetical protein	NA	A0A2I7QSR3	Vibrio_phage	46.8	2.6e-07
WP_115356134.1|1505551_1505959_+	hypothetical protein	NA	Q716B1	Shigella_phage	78.0	7.7e-50
WP_004904172.1|1505940_1506147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070579453.1|1506347_1506572_+	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	57.5	5.9e-12
WP_115356135.1|1506626_1507067_+	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	54.2	6.0e-32
WP_115356136.1|1507044_1508481_+	DNA packaging protein	NA	Q2A0C1	Sodalis_phage	75.7	6.6e-221
WP_115356137.1|1508480_1510568_+|portal	portal protein	portal	G5DA97	Enterobacteria_phage	68.7	3.9e-238
WP_115356138.1|1510582_1511497_+	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	61.2	8.8e-94
WP_115356139.1|1511496_1512780_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	65.3	8.6e-164
WP_115356140.1|1513160_1513658_+	recombinase RmuC	NA	Q76H19	Enterobacteria_phage	60.9	2.2e-46
WP_115356141.1|1513629_1515048_+	packaged DNA stabilization protein gp10	NA	I1TEJ1	Salmonella_phage	69.7	1.0e-202
WP_115356142.1|1515047_1515791_+|tail	phage tail protein	tail	C6ZR14	Salmonella_phage	63.9	1.3e-39
WP_108656588.1|1515798_1516257_+	DUF2824 family protein	NA	G5DA79	Enterobacteria_phage	85.4	5.0e-74
WP_115356143.1|1516259_1516955_+	DNA transfer protein	NA	I6S1K1	Salmonella_phage	60.5	1.6e-63
WP_115356144.1|1516964_1518353_+	phage DNA ejection protein	NA	A0A192Y834	Salmonella_phage	47.5	4.3e-100
WP_115356145.1|1518352_1520464_+	lytic transglycosylase domain-containing protein	NA	A0A2I7QW93	Vibrio_phage	44.8	3.6e-143
WP_115356146.1|1522627_1524466_-	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	46.1	1.7e-144
WP_115356147.1|1524544_1524769_-	DNA polymerase II	NA	H9C187	Pectobacterium_phage	58.2	2.8e-17
WP_115356148.1|1524781_1525945_-|integrase	tyrosine-type recombinase/integrase	integrase	E5AGD0	Erwinia_phage	64.9	2.8e-145
1526109:1526123	attR	TTGGTGTCCCCTGCA	NA	NA	NA	NA
>prophage 6
NZ_CP034944	Morganella morganii subsp. morganii strain ATCC 25830 chromosome, complete genome	3889903	2221059	2313460	3889903	integrase,capsid,plate,terminase,transposase,holin,tail	Morganella_phage(79.73%)	104	2257867:2257926	2313461:2313536
WP_004237433.1|2221059_2221686_-|tail	tail assembly chaperone	tail	A0A218M4J2	Erwinia_phage	33.0	5.4e-26
WP_004237438.1|2223039_2223702_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	38.3	7.1e-37
WP_004237439.1|2223698_2224886_-|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	38.9	2.4e-75
WP_004237440.1|2224878_2225223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004237442.1|2225219_2225912_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	42.0	4.8e-36
WP_004237444.1|2225928_2226744_-	hypothetical protein	NA	B5M9T8	Pseudomonas_phage	27.5	2.9e-16
WP_004237445.1|2226736_2227030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004237446.1|2227026_2227566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004237447.1|2227562_2229533_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	22.6	4.9e-17
WP_004237448.1|2229615_2230074_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	49.3	1.3e-26
WP_004237449.1|2230115_2230568_-	hypothetical protein	NA	I7ATP4	Escherichia_phage	37.8	8.3e-21
WP_004237450.1|2230583_2232071_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.3	9.6e-82
WP_004237451.1|2232080_2232596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004237452.1|2232746_2233310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036415836.1|2233458_2233893_-	antitermination protein Q	NA	B6SCU4	Bacteriophage	47.8	5.4e-25
WP_015422658.1|2234101_2234788_-	DUF4431 domain-containing protein	NA	NA	NA	NA	NA
WP_105212818.1|2235012_2236134_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_004237458.1|2236231_2236891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071888209.1|2237198_2237267_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_036418380.1|2237873_2238386_+	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_061057382.1|2238398_2241473_+	RTX family hemolysin	NA	NA	NA	NA	NA
WP_046024350.1|2241544_2243668_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	28.9	1.1e-46
WP_061057380.1|2243682_2245119_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_036414589.1|2245434_2245770_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_071888208.1|2245858_2246305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036418386.1|2246878_2247130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057378.1|2247810_2248188_-	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	89.6	4.8e-54
WP_165763945.1|2248184_2248343_-	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	71.7	9.3e-12
WP_087769859.1|2248324_2248801_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	92.4	7.5e-81
WP_036418393.1|2248793_2248985_-|holin	holin	holin	A0A1W6JNY9	Morganella_phage	88.9	8.6e-28
WP_061057376.1|2249292_2249568_+	DUF4282 domain-containing protein	NA	NA	NA	NA	NA
WP_036418457.1|2250075_2250315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004242347.1|2250893_2251352_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_036414577.1|2251658_2252099_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	54.0	4.0e-28
WP_087769858.1|2252475_2253129_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004242341.1|2254234_2254447_-	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	100.0	2.0e-33
WP_036418396.1|2254821_2255259_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	96.6	3.6e-77
WP_024473812.1|2256287_2256731_+	universal stress protein	NA	NA	NA	NA	NA
WP_036418399.1|2256758_2257163_-	hypothetical protein	NA	A0A1W6JNY5	Morganella_phage	89.4	3.8e-65
2257867:2257926	attL	CTGGTTGAGAGTTAACGGGTTTAATATGGTGCCGGCTACCGGAGTCGAACTGGTGACCTA	NA	NA	NA	NA
WP_070580250.1|2258734_2259778_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_070580252.1|2260446_2260992_+	fimbrial protein	NA	NA	NA	NA	NA
WP_083297295.1|2261123_2261783_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_115356187.1|2261867_2264402_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_115356161.1|2264455_2264704_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_083297292.1|2264775_2265813_+	fimbrial protein	NA	NA	NA	NA	NA
WP_070580258.1|2266455_2266791_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_083297293.1|2266879_2267329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070580260.1|2267900_2268254_+	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	34.8	7.0e-15
WP_162894878.1|2268420_2268684_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_111759744.1|2268716_2269256_-	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	96.8	4.7e-87
WP_070578886.1|2270407_2270674_-	hypothetical protein	NA	A0A1W6JNS1	Morganella_phage	96.6	2.8e-45
WP_111759696.1|2270676_2271363_-	hypothetical protein	NA	A0A1W6JNU1	Morganella_phage	98.7	2.9e-134
WP_052125932.1|2271359_2271680_-	hypothetical protein	NA	A0A1W6JNW9	Morganella_phage	100.0	3.1e-62
WP_111759697.1|2271681_2274816_-	host specificity protein J	NA	A0A1W6JNW2	Morganella_phage	98.1	0.0e+00
WP_036415823.1|2274816_2275383_-|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	100.0	2.9e-63
WP_036414553.1|2275325_2276039_-	C40 family peptidase	NA	A0A1W6JNU8	Morganella_phage	100.0	9.1e-147
WP_036414551.1|2276042_2276741_-|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	100.0	7.8e-135
WP_048822323.1|2276737_2277067_-|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	98.2	1.5e-59
WP_111759698.1|2277106_2280430_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	98.5	0.0e+00
WP_111759699.1|2280473_2281166_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	97.8	9.5e-125
WP_052926041.1|2281216_2281972_-	Ig domain-containing protein	NA	A0A1W6JNT1	Morganella_phage	97.2	5.7e-131
WP_048822304.1|2282036_2282408_-	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	97.6	3.1e-66
WP_052926039.1|2282404_2282773_-	hypothetical protein	NA	A0A1W6JNX7	Morganella_phage	99.2	3.0e-61
WP_070578217.1|2282774_2283116_-	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	98.2	7.3e-62
WP_036414535.1|2283117_2283495_-	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	100.0	1.6e-62
WP_070578219.1|2283540_2284500_-	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	99.4	2.6e-173
WP_052926036.1|2284505_2285192_-	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	99.6	6.8e-99
WP_070578222.1|2285257_2286319_-|capsid	minor capsid protein	capsid	A0A1W6JNT7	Morganella_phage	96.9	9.3e-188
WP_111759700.1|2286322_2287702_-	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	99.1	8.7e-263
WP_111759701.1|2287703_2289188_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	99.8	5.6e-300
WP_070578228.1|2289189_2289717_-|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	99.4	8.6e-94
WP_111759702.1|2289719_2289917_-	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	98.5	4.3e-30
WP_036414519.1|2290186_2290702_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	100.0	4.3e-98
WP_024473808.1|2291084_2291357_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	100.0	7.2e-44
WP_070578231.1|2291804_2292182_-	hypothetical protein	NA	A0A1W6JNV2	Morganella_phage	99.2	1.4e-61
WP_111759703.1|2292318_2292795_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	97.5	1.2e-86
WP_004238694.1|2292787_2292979_-	hypothetical protein	NA	A0A1W6JNY9	Morganella_phage	100.0	1.4e-30
WP_036414512.1|2293460_2293667_-	hypothetical protein	NA	A0A1W6JNU4	Morganella_phage	100.0	1.3e-32
WP_087825463.1|2293835_2293988_-	MbeCy	NA	A0A1W6JNZ9	Morganella_phage	100.0	8.9e-20
WP_036414510.1|2294592_2295027_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_070578064.1|2295295_2296225_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	99.6	5.7e-149
WP_046024440.1|2296450_2296663_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	98.6	5.8e-33
WP_046024441.1|2297037_2297475_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	97.9	1.9e-78
WP_163623466.1|2297764_2298394_-	recombination protein NinG	NA	A0A1W6JNX3	Morganella_phage	98.6	2.9e-104
WP_036414499.1|2298679_2299108_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	100.0	9.8e-72
WP_046024444.1|2299748_2300192_-	recombination protein NinB	NA	A0A1W6JNZ4	Morganella_phage	100.0	1.1e-81
WP_070579716.1|2300440_2301169_-	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	97.5	6.0e-130
WP_070579775.1|2301168_2301960_-	replication protein	NA	A0A1W6JNY0	Morganella_phage	98.1	3.1e-132
WP_036414494.1|2302101_2302428_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	100.0	1.8e-54
WP_070579719.1|2302560_2302788_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD1	Pseudomonas_phage	39.1	8.4e-06
WP_070579725.1|2302884_2303514_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	81.5	2.5e-79
WP_036414488.1|2303552_2303894_+	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	100.0	1.6e-61
WP_070579728.1|2304046_2304244_-	DUF2767 family protein	NA	A0A1W6JNW1	Morganella_phage	98.5	1.8e-28
WP_046024487.1|2304625_2304934_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	99.0	2.2e-49
WP_004240099.1|2304962_2305172_-	hypothetical protein	NA	A0A1W6JP23	Morganella_phage	100.0	5.9e-30
WP_115356165.1|2305935_2306316_+	hypothetical protein	NA	A0A1W6JNZ6	Morganella_phage	98.6	4.2e-34
WP_115356027.1|2306381_2307468_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	5.3e-45
WP_004240098.1|2307890_2308067_+	hypothetical protein	NA	A0A1W6JNY7	Morganella_phage	100.0	6.3e-25
WP_166707596.1|2308063_2308228_+	hypothetical protein	NA	A0A1W6JNX8	Morganella_phage	98.1	9.3e-23
WP_070579732.1|2308224_2308587_+	hypothetical protein	NA	A0A1W6JNZ2	Morganella_phage	88.3	2.6e-57
WP_111759706.1|2308589_2309204_+	ERF family protein	NA	A0A1W6JP21	Morganella_phage	98.5	1.1e-108
WP_070579736.1|2309204_2309594_+	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	90.8	8.9e-64
WP_087769855.1|2311210_2311810_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	62.4	8.9e-63
WP_070579739.1|2312296_2313460_+|integrase	site-specific integrase	integrase	A0A220NQU7	Salmonella_phage	69.8	1.5e-154
2313461:2313536	attR	CTGGTTGAGAGTTAACGGGTTTAATATGGTGCCGGCTACCGGAGTCGAACTGGTGACCTACTGATTACAAGTCAGT	NA	NA	NA	NA
>prophage 7
NZ_CP034944	Morganella morganii subsp. morganii strain ATCC 25830 chromosome, complete genome	3889903	2682874	2692717	3889903	tRNA,protease	Bacillus_phage(16.67%)	8	NA	NA
WP_015422571.1|2682874_2684644_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.6	2.2e-24
WP_004235803.1|2684646_2686413_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.9	5.8e-17
WP_004235802.1|2686390_2687110_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|2687260_2687479_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004235801.1|2687555_2689841_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.5	2.8e-173
WP_015422570.1|2689874_2690195_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.7	2.6e-16
WP_004235798.1|2690453_2690684_+	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.7	2.6e-15
WP_004235797.1|2690770_2692717_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.9	1.2e-36
>prophage 8
NZ_CP034944	Morganella morganii subsp. morganii strain ATCC 25830 chromosome, complete genome	3889903	2876937	2884992	3889903	tRNA	Mycobacterium_phage(33.33%)	8	NA	NA
WP_004235583.1|2876937_2877147_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	4.5e-22
WP_004235582.1|2877346_2877814_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004235581.1|2877995_2879078_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_004235580.1|2879386_2879605_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	51.4	2.3e-16
WP_004235579.1|2879626_2880043_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	40.4	1.4e-11
WP_004235574.1|2880073_2882194_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.6	3.6e-207
WP_004235573.1|2882218_2883181_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.4	2.2e-135
WP_004235572.1|2883786_2884992_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.5	5.5e-27
