The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031185	Lactobacillus brevis strain SA-C12 chromosome, complete genome	2440441	674864	739450	2440441	tRNA,holin,transposase,protease	Streptococcus_phage(21.74%)	59	NA	NA
WP_011667382.1|674864_675908_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	NA	NA	NA	NA
WP_011667383.1|675988_677167_-	MFS transporter	NA	NA	NA	NA	NA
WP_011667384.1|677224_677521_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011667385.1|677629_679582_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.4	4.2e-53
WP_011667386.1|679814_680453_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_011667387.1|680633_680918_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	43.0	2.6e-12
WP_011667388.1|680973_682599_+	chaperonin GroEL	NA	A0A240F766	uncultured_virus	53.5	7.4e-152
WP_015473419.1|682990_684826_+	APC family permease	NA	NA	NA	NA	NA
WP_011667390.1|685079_685886_-|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
WP_080504821.1|685930_686299_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_011667399.1|686777_687872_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_087609310.1|687925_688585_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	47.6	4.9e-38
WP_087609311.1|688659_689979_+	DNA/RNA helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.6	3.8e-58
WP_139560021.1|689975_690650_+	ComF family protein	NA	NA	NA	NA	NA
WP_011667403.1|690787_691348_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_011667404.1|691549_693913_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_107696456.1|693989_695105_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_107696455.1|695149_696370_+|protease	serine protease	protease	NA	NA	NA	NA
WP_021741445.1|696374_697082_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.3	7.1e-43
WP_024525621.1|697078_698422_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	34.1	4.8e-24
WP_086231761.1|698571_699495_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	2.1e-31
WP_011667410.1|699731_700613_+	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011667412.1|701538_702423_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011667413.1|702435_703260_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	2.4e-13
WP_011667414.1|703275_704034_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.7	3.6e-16
WP_011667415.1|704045_704726_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011667416.1|704919_705249_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_015473430.1|705249_705621_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_011667418.1|705709_706645_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_011667419.1|706650_707514_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_011667420.1|707529_708543_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011667421.1|708580_709486_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.8	1.6e-71
WP_011667422.1|709557_710499_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.1	4.2e-83
WP_011667423.1|710592_711234_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_015473432.1|711230_711755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011667425.1|711871_713878_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_011667426.1|713897_716753_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.7	4.5e-306
WP_011667427.1|716908_717454_+	membrane protein	NA	NA	NA	NA	NA
WP_011667428.1|717600_718485_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.8	2.1e-07
WP_015473435.1|718481_719492_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	52.8	1.3e-93
WP_139560022.1|719494_720433_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.7	5.9e-53
WP_011667431.1|720556_721153_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	52.8	2.2e-53
WP_087609314.1|721386_721830_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011373852.1|721773_722694_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_011667433.1|722911_723625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011667434.1|723858_724470_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_011667435.1|724890_725919_+	SorC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011667436.1|725987_726998_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011667437.1|727177_728380_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_011667438.1|728524_729283_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_011667439.1|729390_730710_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	68.8	4.1e-169
WP_047021316.1|730824_731925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015473442.1|731991_733548_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_011667442.1|733644_733881_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_011667443.1|733965_734724_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011667444.1|734727_737121_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.6	1.3e-88
WP_011667445.1|737136_737610_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	58.1	1.9e-44
WP_011667446.1|737678_738416_+	amino acid ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	8.3e-10
WP_011373852.1|738529_739450_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
>prophage 2
NZ_CP031185	Lactobacillus brevis strain SA-C12 chromosome, complete genome	2440441	807239	815593	2440441		Lactobacillus_phage(44.44%)	15	NA	NA
WP_139560032.1|807239_807581_-	helix-turn-helix domain-containing protein	NA	A8ASM2	Listeria_phage	51.9	1.1e-20
WP_043022770.1|807744_807990_+	helix-turn-helix transcriptional regulator	NA	A8ASM3	Listeria_phage	43.8	9.7e-08
WP_139560033.1|807989_808175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086231641.1|808163_808412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069360054.1|808793_809300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085768829.1|809305_809617_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_097547572.1|809887_810181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015474119.1|810171_810387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139560034.1|810387_811449_+	recombinase RecT	NA	D7RWF9	Brochothrix_phage	51.5	4.8e-59
WP_128491763.1|811375_812239_+	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	50.9	1.6e-76
WP_139560035.1|812250_813177_+	DUF4373 domain-containing protein	NA	A0A0H4TKJ7	Bacillus_phage	35.2	3.7e-15
WP_139560036.1|813188_813899_+	toxin Bro	NA	A0A059NT90	Lactococcus_phage	35.0	6.3e-31
WP_051053382.1|813891_814335_+	RusA family crossover junction endodeoxyribonuclease	NA	D6PSU4	Lactobacillus_phage	61.8	5.8e-43
WP_139560037.1|814450_814879_+	hypothetical protein	NA	D6PSU8	Lactobacillus_phage	61.0	5.5e-22
WP_139560038.1|815116_815593_+	DUF1642 domain-containing protein	NA	A0A2K9VC25	Lactobacillus_phage	65.3	6.9e-50
>prophage 3
NZ_CP031185	Lactobacillus brevis strain SA-C12 chromosome, complete genome	2440441	820368	845928	2440441	plate,tail,terminase	Lactobacillus_phage(100.0%)	30	NA	NA
WP_087609355.1|820368_820575_+	hypothetical protein	NA	D6PSW6	Lactobacillus_phage	98.0	1.5e-22
WP_139560195.1|821347_822691_+|terminase	PBSX family phage terminase large subunit	terminase	D6PSX1	Lactobacillus_phage	99.3	3.9e-167
WP_139560039.1|822706_824068_+	DUF1073 domain-containing protein	NA	D6PSX2	Lactobacillus_phage	99.3	9.5e-262
WP_087612860.1|824070_824898_+	hypothetical protein	NA	D6PSX3	Lactobacillus_phage	98.8	1.9e-132
WP_139560040.1|824881_825208_+	LysM peptidoglycan-binding domain-containing protein	NA	D6PSX4	Lactobacillus_phage	96.0	1.1e-19
WP_139560041.1|825219_826323_+	DUF2213 domain-containing protein	NA	D6PSX5	Lactobacillus_phage	89.6	1.0e-157
WP_042254689.1|826337_826802_+	hypothetical protein	NA	D6PSX6	Lactobacillus_phage	98.7	6.4e-77
WP_042254688.1|826816_827695_+	DUF2184 domain-containing protein	NA	D6PSX7	Lactobacillus_phage	99.3	1.6e-161
WP_015474101.1|827705_828068_+	hypothetical protein	NA	D6PSX8	Lactobacillus_phage	100.0	3.6e-59
WP_139560042.1|828079_828406_+	DUF4054 domain-containing protein	NA	D6PSX9	Lactobacillus_phage	95.4	6.6e-52
WP_139560043.1|828402_829005_+	hypothetical protein	NA	D6PSY0	Lactobacillus_phage	97.0	7.8e-107
WP_139560044.1|829004_829379_+	hypothetical protein	NA	D6PSY1	Lactobacillus_phage	94.4	5.0e-64
WP_069360084.1|829371_829842_+	hypothetical protein	NA	D6PSY2	Lactobacillus_phage	98.3	2.3e-61
WP_139560045.1|829854_830892_+	DUF3383 family protein	NA	D6PSY3	Lactobacillus_phage	88.0	1.2e-131
WP_139560046.1|830906_831305_+	hypothetical protein	NA	D6PSY4	Lactobacillus_phage	97.7	1.3e-70
WP_139560047.1|831375_831750_+	hypothetical protein	NA	D6PSY5	Lactobacillus_phage	95.2	5.9e-65
WP_139560048.1|831945_837651_+|tail	phage tail tape measure protein	tail	D6PSY9	Lactobacillus_phage	95.1	1.2e-159
WP_015474091.1|837650_838298_+	LysM peptidoglycan-binding domain-containing protein	NA	D6PSZ4	Lactobacillus_phage	92.1	3.4e-108
WP_139560049.1|838303_838702_+	hypothetical protein	NA	D6PSZ5	Lactobacillus_phage	99.2	1.8e-67
WP_139560050.1|838691_839933_+	hypothetical protein	NA	D6PSZ6	Lactobacillus_phage	82.6	2.1e-183
WP_139560051.1|839932_840277_+	hypothetical protein	NA	D6PSZ7	Lactobacillus_phage	95.6	1.8e-55
WP_015474088.1|840276_840675_+	DUF2634 domain-containing protein	NA	D6PSZ8	Lactobacillus_phage	78.6	4.9e-49
WP_139560052.1|840661_841840_+|plate	baseplate J/gp47 family protein	plate	D6PSZ9	Lactobacillus_phage	81.6	2.5e-181
WP_087612847.1|841829_842489_+	hypothetical protein	NA	D6PT00	Lactobacillus_phage	83.6	5.6e-74
WP_139560053.1|842491_844147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139560054.1|844159_844567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139560055.1|844578_844746_+	XkdX family protein	NA	NA	NA	NA	NA
WP_129033383.1|844757_845147_+	hypothetical protein	NA	A0A0P0IV33	Lactobacillus_phage	43.4	5.9e-23
WP_047020987.1|845179_845383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139560056.1|845394_845928_+	hypothetical protein	NA	D6PSS1	Lactobacillus_phage	69.1	1.7e-57
>prophage 4
NZ_CP031185	Lactobacillus brevis strain SA-C12 chromosome, complete genome	2440441	1261739	1272417	2440441	tRNA,transposase	Staphylococcus_phage(37.5%)	10	NA	NA
WP_015473763.1|1261739_1262591_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	33.6	1.7e-14
WP_087609482.1|1262759_1263401_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_139560072.1|1263678_1264950_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.9	2.5e-46
WP_024855005.1|1265002_1265494_-	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	37.8	1.5e-23
WP_015473768.1|1265510_1266461_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	62.1	2.0e-117
WP_139560073.1|1266472_1268365_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.2	4.0e-48
WP_024855004.1|1268393_1269587_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	40.2	1.9e-35
WP_011667555.1|1269720_1270659_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.8	2.2e-52
WP_087609486.1|1270776_1272036_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011667553.1|1272141_1272417_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	3.1e-26
>prophage 5
NZ_CP031185	Lactobacillus brevis strain SA-C12 chromosome, complete genome	2440441	1354880	1439668	2440441	capsid,tRNA,tail,terminase,head,integrase,portal,protease	Lactobacillus_phage(52.63%)	98	1367260:1367279	1447130:1447149
WP_011668008.1|1354880_1355792_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_011668009.1|1355872_1356223_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_015473817.1|1356242_1358585_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.4	5.1e-21
WP_011668011.1|1358632_1358935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011668012.1|1358927_1359224_-	YlxR family protein	NA	NA	NA	NA	NA
WP_011668013.1|1359250_1360456_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_011668014.1|1360479_1360953_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_011668015.1|1361079_1361355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011668016.1|1361503_1365841_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	37.6	1.0e-19
WP_011668017.1|1365932_1367642_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
1367260:1367279	attL	AGTCGCTTGTACGACTTAAT	NA	NA	NA	NA
WP_015473823.1|1367677_1368955_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011668019.1|1369050_1369842_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_041815361.1|1369863_1370652_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.0	4.5e-22
WP_011668021.1|1370754_1371177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015473826.1|1371203_1371761_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011668022.1|1371763_1372486_-	UMP kinase	NA	NA	NA	NA	NA
WP_011668023.1|1372632_1373517_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011668024.1|1373666_1374470_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011668025.1|1374707_1375427_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011668026.1|1375548_1376547_-	D-2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	35.5	3.7e-45
WP_024855602.1|1376630_1376900_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_082265294.1|1376886_1377633_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011668029.1|1377728_1378370_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_011668030.1|1378430_1380224_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.2	7.3e-44
WP_024855600.1|1380213_1381974_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.2	3.7e-48
WP_011668031.1|1382104_1382329_-	YneF family protein	NA	NA	NA	NA	NA
WP_096110514.1|1382428_1382662_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_024855599.1|1382859_1383489_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	50.7	1.6e-14
WP_011668033.1|1383528_1383969_-	nucleoside 2-deoxyribosyltransferase	NA	A0A1D3SPR3	Enterococcus_phage	37.2	1.3e-18
WP_107696479.1|1384186_1384786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011668035.1|1384821_1385991_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_139560077.1|1386136_1387018_-	polyphosphate kinase 2 family protein	NA	NA	NA	NA	NA
WP_011668037.1|1387178_1387841_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	29.7	5.5e-05
WP_011668038.1|1387853_1388036_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_011668039.1|1388178_1388643_+	nucleoside-diphosphate kinase	NA	L7Y4C4	Megavirus	46.3	3.5e-22
WP_011668040.1|1388723_1388930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011668041.1|1389125_1389563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560078.1|1390566_1390767_+	XRE family transcriptional regulator	NA	A0A1W6JPV9	Staphylococcus_phage	41.5	3.7e-05
WP_139560079.1|1390813_1391059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560080.1|1391058_1391877_-	autolysin	NA	L0P6H6	Lactobacillus_phage	30.2	2.6e-12
WP_139560081.1|1391869_1392298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560082.1|1392560_1392920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560083.1|1392933_1394547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560084.1|1395364_1395604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560085.1|1395600_1396620_-|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
WP_139560086.1|1396616_1399211_-	hypothetical protein	NA	A0A2P0ZLF8	Lactobacillus_phage	30.7	1.0e-86
WP_139560198.1|1399227_1399965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560087.1|1401202_1406197_-|tail	phage tail tape measure protein	tail	Q9AZS0	Lactococcus_phage	36.1	3.8e-106
WP_024525141.1|1406212_1406425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560088.1|1406424_1406793_-	molecular chaperone	NA	NA	NA	NA	NA
WP_139560089.1|1406878_1407526_-|tail	phage tail protein	tail	A0A0M7RF39	Lactobacillus_phage	48.4	5.7e-47
WP_139560199.1|1407529_1407916_-	DUF806 family protein	NA	NA	NA	NA	NA
WP_139560090.1|1407911_1408331_-	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	37.7	5.2e-17
WP_060463294.1|1408323_1408680_-|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	52.1	1.3e-29
WP_139560091.1|1408663_1408990_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	57.4	7.1e-22
WP_139560092.1|1409047_1410271_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	87.1	2.8e-196
WP_139560093.1|1410270_1410975_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	66.1	2.0e-77
WP_139560094.1|1410967_1412152_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	72.4	4.7e-164
WP_139560095.1|1412154_1412349_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_139560096.1|1412338_1414237_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	77.8	1.4e-298
WP_139560097.1|1414236_1414707_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	64.1	2.5e-52
WP_139560098.1|1414875_1415178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560099.1|1415183_1415654_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	80.8	9.1e-71
WP_139560100.1|1415720_1416269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560101.1|1417069_1417516_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0P0IZR0	Lactobacillus_phage	42.4	1.2e-27
WP_139560102.1|1417759_1418239_-	class I SAM-dependent methyltransferase	NA	A0A2H4PBJ4	Lactobacillus_phage	69.2	4.2e-63
WP_139560103.1|1418242_1418494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560104.1|1418494_1418752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667879.1|1418763_1418961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560105.1|1418974_1419436_-	DUF1064 domain-containing protein	NA	A0A2P0ZKV6	Lactobacillus_phage	46.2	1.1e-25
WP_139560106.1|1419432_1419813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560107.1|1419823_1420066_-	DUF3310 domain-containing protein	NA	E5DV94	Deep-sea_thermophilic_phage	46.0	3.5e-10
WP_139560108.1|1420055_1420481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560109.1|1420473_1421739_-	DNA helicase	NA	U5U3Y9	Lactobacillus_phage	38.4	6.3e-58
WP_139560110.1|1421710_1422538_-	hypothetical protein	NA	A0A0B5D175	Listeria_phage	53.9	2.1e-33
WP_139560111.1|1422556_1423114_-	DUF669 domain-containing protein	NA	NA	NA	NA	NA
WP_139560112.1|1423120_1424098_-	AAA family ATPase	NA	A0A0S2SY47	Bacillus_phage	38.3	7.5e-59
WP_139560113.1|1424099_1424993_-	DUF1351 domain-containing protein	NA	A0A0P0IV40	Lactobacillus_phage	33.5	9.0e-27
WP_139560114.1|1424985_1425165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060463316.1|1425436_1425763_-	DUF771 domain-containing protein	NA	Q4ZD49	Staphylococcus_phage	31.8	9.3e-06
WP_139560115.1|1425851_1426112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560116.1|1426180_1426624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139560117.1|1426589_1426793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560118.1|1426808_1427006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560119.1|1427018_1427804_-	ORF6N domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	57.1	1.8e-79
WP_139560120.1|1427806_1428034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560121.1|1429240_1429720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139560122.1|1429845_1430346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139560123.1|1430580_1431420_+	hypothetical protein	NA	A0A1S5SA20	Streptococcus_phage	24.6	2.7e-09
WP_139560124.1|1431726_1432857_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	53.2	2.5e-106
WP_139560078.1|1433614_1433815_+	XRE family transcriptional regulator	NA	A0A1W6JPV9	Staphylococcus_phage	41.5	3.7e-05
WP_139560079.1|1433861_1434107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560080.1|1434106_1434925_-	autolysin	NA	L0P6H6	Lactobacillus_phage	30.2	2.6e-12
WP_139560081.1|1434917_1435346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560082.1|1435608_1435968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560083.1|1435981_1437595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560084.1|1438412_1438652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560085.1|1438648_1439668_-|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
1447130:1447149	attR	AGTCGCTTGTACGACTTAAT	NA	NA	NA	NA
>prophage 6
NZ_CP031185	Lactobacillus brevis strain SA-C12 chromosome, complete genome	2440441	1444242	1457321	2440441		Lactobacillus_phage(50.0%)	19	NA	NA
WP_139560125.1|1444242_1445544_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2I6PEB6	Staphylococcus_phage	32.1	2.6e-43
WP_139560126.1|1446512_1446809_-	hypothetical protein	NA	A0A0P0IXJ2	Lactobacillus_phage	59.4	1.7e-22
WP_139560127.1|1446957_1447638_-	hypothetical protein	NA	U5U3Y9	Lactobacillus_phage	34.0	4.5e-18
WP_139560110.1|1447609_1448437_-	hypothetical protein	NA	A0A0B5D175	Listeria_phage	53.9	2.1e-33
WP_139560128.1|1448455_1449064_-	DUF669 domain-containing protein	NA	NA	NA	NA	NA
WP_139560112.1|1449020_1449998_-	AAA family ATPase	NA	A0A0S2SY47	Bacillus_phage	38.3	7.5e-59
WP_139560113.1|1449999_1450893_-	DUF1351 domain-containing protein	NA	A0A0P0IV40	Lactobacillus_phage	33.5	9.0e-27
WP_139560114.1|1450885_1451065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060463316.1|1451336_1451663_-	DUF771 domain-containing protein	NA	Q4ZD49	Staphylococcus_phage	31.8	9.3e-06
WP_139560115.1|1451751_1452012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560116.1|1452080_1452524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139560117.1|1452489_1452693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560118.1|1452708_1452906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560119.1|1452918_1453704_-	ORF6N domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	57.1	1.8e-79
WP_139560120.1|1453706_1453934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560129.1|1454733_1455138_+	helix-turn-helix domain-containing protein	NA	Q9T1J3	Lactobacillus_phage	38.1	5.3e-11
WP_139560121.1|1455141_1455621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139560122.1|1455746_1456247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139560123.1|1456481_1457321_+	hypothetical protein	NA	A0A1S5SA20	Streptococcus_phage	24.6	2.7e-09
>prophage 7
NZ_CP031185	Lactobacillus brevis strain SA-C12 chromosome, complete genome	2440441	1568812	1639787	2440441	tRNA,transposase,protease	Staphylococcus_phage(16.67%)	57	NA	NA
WP_015473913.1|1568812_1569460_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011668204.1|1569525_1570317_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_011668205.1|1570378_1571605_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011668206.1|1571601_1572336_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.5e-23
WP_024855560.1|1572554_1573004_+	HIT family protein	NA	NA	NA	NA	NA
WP_015473917.1|1573006_1573327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011668209.1|1573439_1574357_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_015473919.1|1574420_1575395_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_082265308.1|1575407_1578032_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_082265492.1|1578021_1579236_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_015473922.1|1579318_1579663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011668214.1|1579753_1581850_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_011668215.1|1582015_1582483_-	arginine repressor	NA	NA	NA	NA	NA
WP_011668216.1|1582717_1584409_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.0	7.6e-75
WP_011668217.1|1584880_1585102_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_011668218.1|1585435_1586695_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JAS1	uncultured_Caudovirales_phage	40.0	1.8e-17
WP_087609513.1|1586755_1587289_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_011668220.1|1587355_1587697_+	YisL family protein	NA	NA	NA	NA	NA
WP_011668221.1|1587910_1588624_-	amino acid racemase	NA	NA	NA	NA	NA
WP_011668222.1|1588630_1589887_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_011668223.1|1590021_1591905_-	asparagine synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
WP_021742205.1|1592048_1592777_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_011668225.1|1592885_1594295_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_011668226.1|1594364_1594601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087609514.1|1594748_1596551_-	cell surface protein	NA	NA	NA	NA	NA
WP_011668228.1|1597102_1597354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560134.1|1598089_1600600_-	ATP-binding cassette domain-containing protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.3	2.5e-138
WP_087609515.1|1601693_1602224_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024748245.1|1602309_1603233_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	3.7e-31
WP_011668232.1|1603563_1603857_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015473929.1|1603847_1604366_-	VanZ family protein	NA	NA	NA	NA	NA
WP_011668234.1|1604921_1605398_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_107696657.1|1605449_1606073_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011668236.1|1606438_1606684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011668237.1|1606833_1607796_+	NAD(P)-binding domain-containing protein	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	29.0	8.2e-26
WP_011668238.1|1608015_1610730_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_011668239.1|1610742_1611414_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_011668240.1|1611468_1612239_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_011668241.1|1612392_1613040_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	45.9	9.1e-45
WP_011668242.1|1613087_1613414_-	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_011668243.1|1613487_1614963_-	MFS transporter	NA	NA	NA	NA	NA
WP_015473935.1|1615168_1616356_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	69.4	9.5e-149
WP_011668245.1|1616599_1617307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011668247.1|1617803_1618373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139560135.1|1618579_1618903_+	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	36.5	1.1e-06
WP_011668249.1|1619274_1619844_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_011668250.1|1620081_1620549_+	universal stress protein	NA	NA	NA	NA	NA
WP_011668251.1|1627609_1629667_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	47.0	1.2e-151
WP_011668252.1|1629803_1630040_-	YkuJ family protein	NA	NA	NA	NA	NA
WP_011668253.1|1630117_1631152_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_011668254.1|1631156_1632179_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011668255.1|1632191_1633370_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011668256.1|1633554_1635291_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_011668257.1|1635290_1635557_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_011668258.1|1635724_1635925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011668259.1|1636224_1638462_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.8	5.6e-126
WP_139560136.1|1638515_1639787_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	5.0e-47
>prophage 8
NZ_CP031185	Lactobacillus brevis strain SA-C12 chromosome, complete genome	2440441	1708136	1718194	2440441	transposase	Streptococcus_phage(71.43%)	8	NA	NA
WP_139560141.1|1708136_1709408_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.6	4.3e-46
WP_087609528.1|1709781_1711050_-	LlaJI family restriction endonuclease	NA	NA	NA	NA	NA
WP_139560200.1|1711027_1712116_-	AAA domain-containing protein	NA	M1NSM1	Streptococcus_phage	32.0	5.3e-45
WP_139560142.1|1712403_1712979_-	hypothetical protein	NA	M1NSM1	Streptococcus_phage	31.2	5.4e-17
WP_087609530.1|1712984_1714037_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	59.3	1.7e-117
WP_087609691.1|1714046_1714742_-	site-specific DNA-methyltransferase	NA	M1Q227	Streptococcus_phage	61.4	1.4e-80
WP_087609533.1|1715729_1717103_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	50.8	4.1e-127
WP_011668329.1|1717174_1718194_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.1	4.8e-16
