The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP032163	Klebsiella pneumoniae strain XJ-K1 chromosome, complete genome	5454121	450904	484160	5454121	terminase,integrase,portal,tRNA,tail,capsid,protease,head	uncultured_Caudovirales_phage(73.33%)	35	468510:468527	484505:484522
WP_002919147.1|450904_451852_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|451866_452376_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|452504_453629_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|453600_454074_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|454099_454642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|454646_455219_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|455222_456041_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|456037_456295_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|456270_456825_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|462618_462840_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|463133_466244_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|466256_467396_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|467774_468425_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
468510:468527	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|468700_469927_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|470019_470961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|471142_471427_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|471437_472217_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_024194847.1|472340_472535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|472668_472938_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|472930_473119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|473111_473426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|473422_473791_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|473787_474153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|474152_476288_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|476630_476966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|477014_477527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|477790_478957_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|479008_479569_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|479570_480812_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|480808_481144_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|481140_481440_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|481439_481883_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004198610.1|482009_482201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113647.1|482158_482515_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|482498_484160_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
484505:484522	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP032163	Klebsiella pneumoniae strain XJ-K1 chromosome, complete genome	5454121	1219784	1268928	5454121	terminase,integrase,plate,portal,tail,tRNA,capsid,lysis,head,transposase,coat	Salmonella_phage(80.0%)	63	1209265:1209282	1248462:1248479
1209265:1209282	attL	CGGCAAAGAGGCGGGCGA	NA	NA	NA	NA
WP_000019473.1|1219784_1220765_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_062955148.1|1220810_1221809_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_004151019.1|1221811_1222441_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1222563_1222806_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1222838_1223348_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1223355_1223556_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1223519_1223858_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1223925_1224159_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1224158_1224386_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1224382_1225234_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1225230_1227615_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_009483812.1|1227844_1228096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|1228095_1229580_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151011.1|1229687_1229876_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1229887_1230121_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1230216_1230900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1230886_1231966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1231965_1232967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1233488_1233758_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1233814_1234858_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1234857_1236621_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1236761_1237595_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1237611_1238664_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1238667_1239321_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1239416_1239881_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1239880_1240084_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1240087_1240303_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1240283_1240793_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1240797_1241181_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1241177_1241606_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_085955118.1|1241535_1241739_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	3.0e-23
WP_004150997.1|1241701_1242124_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1242116_1242563_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1242585_1243452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1243546_1244119_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1244115_1244478_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_121509260.1|1244464_1245373_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.5	1.6e-108
WP_004152935.1|1245365_1246037_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1246038_1247988_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1247997_1249116_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
1248462:1248479	attR	CGGCAAAGAGGCGGGCGA	NA	NA	NA	NA
WP_004150988.1|1249167_1250241_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1250389_1251562_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1251571_1252087_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1252139_1252439_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1252453_1252573_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150984.1|1252565_1255196_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_004150983.1|1255192_1255678_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1255674_1256769_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1256835_1257054_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1257081_1257459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1258062_1258545_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_004188817.1|1258655_1259132_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1259121_1259412_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1259478_1259820_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1259967_1261629_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1261715_1262594_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1262718_1263309_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1263428_1264715_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1264734_1265526_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1265689_1267054_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1267313_1267562_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1267580_1268129_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1268160_1268928_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP032163	Klebsiella pneumoniae strain XJ-K1 chromosome, complete genome	5454121	1373638	1428291	5454121	terminase,holin,integrase,tail,transposase	Salmonella_phage(37.74%)	63	1366973:1366987	1397078:1397092
1366973:1366987	attL	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004151980.1|1373638_1375105_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1375172_1376750_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_062955102.1|1376941_1378192_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
WP_063002073.1|1378134_1378377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197356.1|1378373_1378967_-	MT-A70 family protein	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
WP_062955103.1|1378963_1379626_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
WP_048264082.1|1379622_1379781_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
WP_009485475.1|1379773_1380067_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_062955104.1|1380176_1380425_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
WP_062955105.1|1380473_1381355_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
WP_062955106.1|1381351_1382173_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_004164029.1|1382169_1382469_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004144290.1|1382835_1383417_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004152538.1|1383571_1383805_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1383951_1384161_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1384160_1384928_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|1384924_1385710_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_048328152.1|1385829_1386177_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
WP_062955107.1|1386369_1386780_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
WP_032441402.1|1386763_1386955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441401.1|1386951_1387596_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_072200041.1|1387889_1388357_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
WP_029602865.1|1388356_1388650_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_050491799.1|1388646_1389267_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
WP_032441458.1|1389266_1389470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023339258.1|1389462_1389801_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_004152765.1|1389897_1391382_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|1391381_1391633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418540.1|1391785_1392043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441400.1|1392120_1392705_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
WP_062955142.1|1392701_1394177_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	6.4e-280
WP_004200550.1|1394220_1394592_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
WP_072354015.1|1394641_1394884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004141368.1|1395345_1395552_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_032441398.1|1395566_1397249_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
1397078:1397092	attR	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004152446.1|1397245_1397542_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_032441397.1|1397544_1398225_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
WP_004200546.1|1398239_1399226_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_020953461.1|1399279_1399717_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
WP_062955141.1|1399727_1400069_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
WP_004152441.1|1400119_1400443_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_062955139.1|1400442_1401048_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
WP_062955138.1|1401047_1403525_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
WP_004152438.1|1403524_1403989_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_032447858.1|1403988_1404528_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
WP_062955137.1|1404538_1407073_+	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
WP_062955136.1|1407072_1408983_+	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
WP_062955135.1|1408982_1411739_+	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
WP_062955134.1|1411735_1411930_+	hypothetical protein	NA	Q858F7	Salmonella_phage	67.2	6.5e-15
WP_071787028.1|1411964_1412117_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	2.5e-14
WP_094820965.1|1412215_1412491_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	62.8	4.9e-24
WP_004152765.1|1412553_1414038_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|1414037_1414289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062955131.1|1417249_1417513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123766426.1|1417553_1418381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073547080.1|1418800_1419781_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
WP_000608644.1|1420649_1421912_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_077265603.1|1423020_1424337_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
WP_062955010.1|1424423_1424828_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
WP_023339240.1|1424814_1425120_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_062955009.1|1425109_1425739_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_062955008.1|1425735_1426236_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
WP_004152009.1|1426422_1428291_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
NZ_CP032163	Klebsiella pneumoniae strain XJ-K1 chromosome, complete genome	5454121	1762808	1769713	5454121	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_072353998.1|1762808_1763672_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	7.4e-10
WP_094818808.1|1763682_1764456_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.1e-26
WP_002912636.1|1764696_1765590_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1765835_1767197_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1767515_1768238_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_072353997.1|1768234_1769713_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.9e-29
>prophage 5
NZ_CP032163	Klebsiella pneumoniae strain XJ-K1 chromosome, complete genome	5454121	1813057	1825576	5454121	transposase	Escherichia_phage(30.0%)	11	NA	NA
WP_000043543.1|1813057_1814464_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004180506.1|1814690_1816106_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_039819506.1|1816127_1817498_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
WP_039819536.1|1817652_1818717_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
WP_023278825.1|1818730_1819600_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
WP_004175259.1|1819631_1820522_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_039819508.1|1820536_1821091_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
WP_072353991.1|1821270_1822437_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
WP_000019445.1|1823100_1824081_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_045327201.1|1824307_1824502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004149013.1|1824571_1825576_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.0e-31
>prophage 6
NZ_CP032163	Klebsiella pneumoniae strain XJ-K1 chromosome, complete genome	5454121	2983229	3059036	5454121	terminase,plate,integrase,transposase	Klebsiella_phage(30.19%)	86	3050149:3050163	3056158:3056172
WP_002902268.1|2983229_2984315_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004151598.1|2984278_2986033_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004151599.1|2987704_2991130_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002902254.1|2991113_2992253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902252.1|2992249_2992507_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004151601.1|2992551_2994969_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_002902180.1|2994956_2995487_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902178.1|2995554_2996085_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902174.1|2996750_2997281_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902172.1|2997349_2997880_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902169.1|2997943_2998723_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_002902166.1|2998723_3001102_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.2e-18
WP_002902163.1|3001094_3003749_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_002902160.1|3004013_3004505_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004151602.1|3004509_3006216_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004151603.1|3006212_3006902_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002902150.1|3006898_3008239_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002902148.1|3008251_3009796_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002902144.1|3009838_3010330_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000019473.1|3010799_3011780_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_063048273.1|3011837_3012047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902136.1|3012375_3012624_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902133.1|3012846_3013131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|3013208_3014693_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3014692_3014944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|3015145_3015355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902128.1|3015351_3016083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218487.1|3016093_3016822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152577.1|3019172_3019370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152576.1|3019369_3020236_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|3020235_3021009_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3021005_3022202_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3022201_3022555_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3022556_3023210_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|3023263_3023830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004173705.1|3023866_3024052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3024104_3024446_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3024445_3025468_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|3025470_3025773_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|3025773_3026373_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|3026372_3028376_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3028365_3028518_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3028553_3028979_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|3028982_3029423_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152176.1|3030583_3031024_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3031118_3031505_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3031504_3032011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3032007_3032427_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3032395_3032677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3033521_3034502_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_000528476.1|3034869_3035364_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3035367_3036570_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3036621_3037170_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3037225_3038677_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3038914_3040315_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|3040265_3041018_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|3041119_3041440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064754420.1|3041532_3041790_-	hypothetical protein	NA	S5FXQ4	Shigella_phage	70.9	2.3e-23
WP_004153952.1|3041674_3042064_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3042060_3042591_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3042593_3042842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3043247_3044030_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3044026_3044503_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3044499_3045462_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3045463_3047122_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152163.1|3047430_3047724_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
WP_004152162.1|3047698_3047920_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3048017_3048686_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3048856_3049171_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3049163_3049352_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3049521_3049887_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3049879_3050134_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|3050105_3050324_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
3050149:3050163	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|3050320_3050746_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3050742_3050937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3050933_3051761_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3051865_3052384_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3052389_3053100_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3053089_3053314_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3053310_3053523_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|3053519_3053999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|3054177_3054420_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3054400_3055582_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3055778_3056327_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3056158:3056172	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3056525_3058058_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3058274_3059036_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 7
NZ_CP032163	Klebsiella pneumoniae strain XJ-K1 chromosome, complete genome	5454121	3091969	3146061	5454121	protease,holin,transposase,integrase	Enterobacteria_phage(33.33%)	64	3091751:3091766	3121419:3121434
3091751:3091766	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|3091969_3092641_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3092827_3093655_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3093730_3094996_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3094997_3095417_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|3095495_3096980_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3096979_3097231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152776.1|3097877_3098300_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|3098892_3099597_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000679427.1|3100212_3100560_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|3100723_3101515_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001067855.1|3102496_3103201_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_062955100.1|3103237_3103525_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	95.4	4.4e-36
WP_004218565.1|3103521_3104061_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|3104057_3104357_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_022644626.1|3104835_3105882_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004232548.1|3106107_3106797_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3106796_3106937_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3106933_3107572_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3107564_3108233_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3108229_3108397_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3108377_3108845_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004218530.1|3109365_3110394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3110601_3110847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3110902_3111205_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3111201_3112050_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3112046_3112907_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3112992_3113214_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3113254_3113482_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3113593_3114292_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|3114314_3114434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201109.1|3114579_3115656_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3115737_3115941_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004135674.1|3116369_3116564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3116652_3116937_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3116952_3117798_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3117794_3118082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3118083_3118764_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3118760_3119189_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3119185_3119848_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004190725.1|3119844_3120159_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
WP_004153574.1|3120055_3121243_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|3121419_3122310_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3121419:3121434	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3122309_3123302_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3123303_3124113_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004176464.1|3124157_3125588_-	cytosine permease	NA	NA	NA	NA	NA
WP_004152967.1|3125784_3126327_+	HutD family protein	NA	NA	NA	NA	NA
WP_004140277.1|3126525_3127314_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004151905.1|3127504_3128662_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002901787.1|3128743_3130678_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
WP_002901786.1|3130836_3131016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002901785.1|3131087_3131837_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_004151906.1|3132109_3132331_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_002901782.1|3132462_3132789_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_004151907.1|3132788_3133526_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_002901781.1|3133717_3134887_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_002901780.1|3134893_3135202_-	LapA family protein	NA	NA	NA	NA	NA
WP_002901779.1|3135337_3136105_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_002901778.1|3136268_3136871_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
WP_002901777.1|3136917_3139590_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_002901776.1|3139978_3140146_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_002901772.1|3140391_3141366_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_002901763.1|3141711_3144309_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901761.1|3144715_3144967_+	YciN family protein	NA	NA	NA	NA	NA
WP_002901758.1|3145014_3146061_-|protease	protease SohB	protease	NA	NA	NA	NA
>prophage 8
NZ_CP032163	Klebsiella pneumoniae strain XJ-K1 chromosome, complete genome	5454121	3251784	3379773	5454121	terminase,integrase,holin,portal,tRNA,tail,capsid,lysis,protease,head,transposase	Klebsiella_phage(31.52%)	151	3278587:3278601	3377584:3377598
WP_002901088.1|3251784_3252285_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3252401_3252848_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3252831_3253623_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150777.1|3253724_3254909_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3254940_3255633_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3255778_3256288_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3256274_3256631_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004150780.1|3256620_3256860_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150781.1|3257160_3258174_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150782.1|3258231_3258333_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_099119317.1|3258332_3258407_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3258524_3258650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3258709_3258973_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3259103_3259742_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3259831_3260746_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150784.1|3261407_3262451_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004150785.1|3262753_3263962_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150787.1|3264035_3265820_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3265826_3266717_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3266837_3268346_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|3268656_3269343_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140501.1|3269740_3269920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3269959_3270592_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3271158_3271356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|3271471_3272482_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004150793.1|3272478_3273885_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3273940_3274828_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3274844_3275351_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150794.1|3275377_3275872_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3275962_3276148_-	general stress protein	NA	NA	NA	NA	NA
WP_004140529.1|3276769_3277963_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3278075_3278303_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
3278587:3278601	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
WP_004150797.1|3278739_3279063_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3279055_3279448_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|3279444_3280158_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3280430_3280583_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_023328083.1|3280737_3282234_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
WP_062955111.1|3282302_3295007_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
WP_023328085.1|3295069_3295663_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
WP_047666390.1|3295689_3296112_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
WP_047666389.1|3296153_3296864_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
WP_023328087.1|3296865_3297621_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
WP_023328088.1|3297617_3297956_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
WP_023328089.1|3297955_3301291_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
WP_071836352.1|3301290_3301509_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	90.5	5.4e-34
WP_014228914.1|3301523_3301889_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_023328090.1|3301946_3302408_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_023328091.1|3302439_3302841_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
WP_017880258.1|3302837_3303227_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_023328092.1|3303207_3303546_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_020317538.1|3303542_3303860_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_049010370.1|3303840_3304101_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
WP_023328094.1|3304159_3305446_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
WP_014907815.1|3305523_3306444_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023279520.1|3306480_3307740_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
WP_017898992.1|3307739_3307919_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_021462603.1|3307912_3309634_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
WP_012542168.1|3309633_3310068_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014907818.1|3310316_3310748_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_023297386.1|3310744_3311068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3311019_3311382_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_032749552.1|3311708_3311933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049115059.1|3311971_3312409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|3313358_3313709_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_032432826.1|3313705_3314203_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
WP_016160648.1|3314202_3314418_-|lysis	phage S lysis protein	lysis	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_004147999.1|3315335_3315485_+	small membrane protein	NA	NA	NA	NA	NA
WP_004147997.1|3316222_3316426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025861432.1|3316669_3317272_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_062955112.1|3317288_3318320_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
WP_017898980.1|3318319_3318523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025861428.1|3318519_3318912_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_077255782.1|3318952_3319243_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
WP_025368263.1|3319254_3319488_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
WP_004152765.1|3319566_3321051_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3321050_3321302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109042640.1|3321497_3322544_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_062954989.1|3322891_3323761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062954977.1|3323849_3325241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032443841.1|3325589_3326030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047667474.1|3326043_3326508_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
WP_077265602.1|3326500_3327505_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.0e-31
WP_046622349.1|3327564_3328119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071561166.1|3328121_3328346_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
WP_077257742.1|3328434_3328872_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
WP_040234937.1|3329193_3329508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099143961.1|3329670_3329889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279538.1|3329898_3330093_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3330135_3330480_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_062954978.1|3330621_3332760_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
WP_012542206.1|3332812_3333058_+	excisionase	NA	NA	NA	NA	NA
WP_032418030.1|3333038_3334166_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	4.4e-119
WP_094818795.1|3334283_3334466_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	3.7e-20
WP_049182670.1|3334847_3335609_-	hypothetical protein	NA	Q6J1W3	Lactobacillus_phage	29.4	2.5e-09
WP_094818794.1|3336643_3337369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818793.1|3337420_3338686_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.9	8.1e-207
WP_042934076.1|3338688_3339108_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	1.2e-34
WP_064155591.1|3339186_3339429_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	81.0	1.6e-31
WP_031592310.1|3339428_3339671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094818792.1|3340446_3341199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818791.1|3341209_3343378_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	45.1	6.7e-100
WP_094818790.1|3343455_3346524_-	kinase	NA	A0A286S259	Klebsiella_phage	66.3	0.0e+00
WP_094818789.1|3346520_3346907_-	nitrite transporter	NA	H2BD94	Pseudomonas_phage	35.7	4.0e-16
WP_038433285.1|3346914_3347397_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	67.7	8.5e-56
WP_032420722.1|3347383_3347857_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.5	3.9e-53
WP_094818788.1|3347856_3350553_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.4	4.9e-201
WP_032420719.1|3350533_3350851_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
WP_025714420.1|3350871_3351267_-|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	27.5	1.9e-08
WP_023304948.1|3351309_3351792_-	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
WP_020804325.1|3351799_3352198_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
WP_048291628.1|3352194_3352746_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.3	1.6e-53
WP_020317349.1|3352735_3353029_-	sugar ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_049186541.1|3353021_3353348_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.4	4.0e-33
WP_094818787.1|3353428_3355444_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.2	0.0e+00
WP_020317329.1|3355388_3356888_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.6	1.1e-247
WP_094818786.1|3356884_3357100_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	75.7	6.5e-24
WP_094818785.1|3357096_3359205_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.5	0.0e+00
WP_014228567.1|3359204_3359696_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	84.0	6.4e-67
WP_072002796.1|3360016_3360202_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.1	2.4e-11
WP_108918987.1|3360269_3360530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216876.1|3360756_3361002_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	3.0e-33
WP_094818784.1|3361391_3361541_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	4.5e-16
WP_094818783.1|3361530_3361806_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	46.7	8.6e-13
WP_094818782.1|3361802_3362150_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.3	3.0e-39
WP_019704505.1|3362146_3362686_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	5.7e-101
WP_024176410.1|3362682_3362982_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_040210598.1|3363151_3363391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818781.1|3363541_3364120_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	2.2e-50
WP_094818780.1|3364133_3365114_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	67.5	2.7e-133
WP_065519871.1|3365126_3365504_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	3.9e-48
WP_094818779.1|3365513_3366323_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	5.9e-110
WP_094818778.1|3366319_3367234_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	60.6	1.8e-30
WP_023317571.1|3367190_3367403_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	2.2e-16
WP_004213338.1|3367640_3368102_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_024176406.1|3368127_3368337_-	cell division protein	NA	NA	NA	NA	NA
WP_019705289.1|3368431_3369076_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.7	8.2e-38
WP_094818777.1|3369375_3370299_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	62.9	1.5e-104
WP_040186300.1|3370384_3370684_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.8	1.0e-14
WP_094818776.1|3370683_3371469_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	1.3e-61
WP_094818775.1|3371596_3372088_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	53.4	5.1e-32
WP_064151808.1|3372084_3372348_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	78.0	1.1e-30
WP_094818774.1|3372340_3372985_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	42.8	1.1e-39
WP_004141386.1|3372984_3373197_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_038435237.1|3373992_3374211_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	3.0e-08
WP_071562415.1|3374210_3374483_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	40.4	4.4e-09
WP_000089156.1|3374511_3374748_+	excisionase	NA	NA	NA	NA	NA
WP_000741346.1|3374737_3375880_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	82.2	9.1e-173
WP_094818773.1|3375993_3377244_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_004150801.1|3377484_3378135_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3377584:3377598	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
WP_004150802.1|3378151_3378610_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3378666_3379773_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP032163	Klebsiella pneumoniae strain XJ-K1 chromosome, complete genome	5454121	3596110	3691037	5454121	terminase,integrase,plate,portal,tRNA,tail,capsid,lysis,protease,head,transposase	Salmonella_phage(56.14%)	94	3651636:3651654	3691112:3691130
WP_002898139.1|3596110_3597403_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3597493_3598837_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3598845_3599457_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3599579_3603833_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3603968_3604463_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002898019.1|3604995_3605964_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3606078_3607845_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3607845_3609567_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3609611_3610313_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3610666_3610885_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3611005_3613285_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3613315_3613633_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3613958_3614180_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3614256_3616197_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3616193_3617309_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3617455_3619114_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3619533_3620229_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3620344_3621244_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3621387_3623040_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3623050_3624019_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3624230_3624665_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3624816_3626535_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3626573_3627575_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3627585_3629028_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3629115_3630129_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3630125_3630956_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3630987_3632127_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3633004_3633520_+	lipoprotein	NA	NA	NA	NA	NA
WP_032419144.1|3633746_3634475_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3634495_3635227_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3635233_3635950_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3635949_3636618_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3636801_3637533_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3637575_3639048_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3639044_3639761_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3639839_3640967_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3641008_3641497_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3641554_3642400_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3642396_3643350_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3643360_3644494_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3644657_3645770_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3646118_3646598_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3646686_3647589_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3648410_3648698_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3648900_3649164_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3649170_3649554_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3649820_3651506_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3651636:3651654	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3651725_3651944_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3652035_3653136_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896222.1|3654391_3657019_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3657011_3657131_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3657145_3657445_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3657497_3658013_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3658022_3659195_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3659333_3660410_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3660439_3660643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3660639_3661371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019724930.1|3661374_3662109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150856.1|3664326_3664926_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3664918_3665827_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_032441567.1|3665813_3666176_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896177.1|3666172_3666745_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3666839_3667532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3667528_3667975_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3667967_3668399_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|3668494_3668923_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3668919_3669303_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3669307_3669817_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3669797_3670013_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3670016_3670220_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3670219_3670684_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3670779_3671430_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3671433_3672492_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3672508_3673342_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3673484_3675251_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3675250_3676276_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3676337_3678080_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000019473.1|3678506_3679487_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_000700647.1|3679555_3680233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001316229.1|3680347_3680653_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3680591_3680780_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3680933_3683348_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3683344_3684202_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3684198_3684426_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3684425_3684659_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3684726_3685068_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3685031_3685232_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3685239_3685749_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3685781_3686003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3686148_3687027_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3687038_3687983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|3688081_3689566_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3689565_3689817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151720.1|3689984_3691037_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3691112:3691130	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 10
NZ_CP032163	Klebsiella pneumoniae strain XJ-K1 chromosome, complete genome	5454121	4344780	4356432	5454121	integrase	Enterobacteria_phage(70.0%)	13	4345230:4345244	4368285:4368299
WP_004144574.1|4344780_4345884_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4345230:4345244	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4345894_4347148_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4347500_4348691_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4348678_4349629_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4349628_4350054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152202.1|4350620_4351187_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|4351204_4351450_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_062956184.1|4351446_4352184_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
WP_002889915.1|4352725_4352992_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4352988_4353546_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4353542_4353770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4353766_4354087_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4354098_4356432_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4368285:4368299	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 11
NZ_CP032163	Klebsiella pneumoniae strain XJ-K1 chromosome, complete genome	5454121	4824670	4834195	5454121	transposase	Enterobacteria_phage(83.33%)	10	NA	NA
WP_004152207.1|4824670_4827004_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4827018_4827339_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4827335_4827563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153681.1|4827559_4828108_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152204.1|4828931_4829669_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4829665_4829911_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4829928_4830495_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152201.1|4831235_4832315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152200.1|4832315_4832852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|4833214_4834195_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 1
NZ_CP032164	Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence	207409	40535	94140	207409	transposase	Enterobacteria_phage(33.33%)	49	NA	NA
WP_004213850.1|40535_41459_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
WP_094818822.1|41570_42137_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_011251259.1|44752_45406_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_139608490.1|46177_47158_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.2	1.7e-183
WP_000427619.1|47558_48563_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004212797.1|48756_49596_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	35.7	3.7e-46
WP_004212799.1|49592_50072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045145446.1|50068_50254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011154571.1|50656_50887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004212803.1|51072_52848_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004212804.1|52866_54393_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004212807.1|54403_55648_-	MFS transporter	NA	NA	NA	NA	NA
WP_004212808.1|55674_56508_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.0	1.1e-10
WP_004212810.1|56504_57350_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	26.0	1.9e-10
WP_071591905.1|57443_57629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004212814.1|57542_58217_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_011154565.1|58927_59413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004212823.1|60871_61372_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_004212825.1|61516_61918_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_004212827.1|61954_63175_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_004212829.1|63234_63441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004212831.1|63443_65093_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_094818814.1|65103_66234_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011251268.1|67765_68218_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_014599314.1|68315_69515_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
WP_004214547.1|69585_70008_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_011251270.1|70071_71007_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_004214543.1|70996_71557_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_004214541.1|71623_72553_+	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	25.2	1.5e-11
WP_004214540.1|72569_73394_-	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
WP_011251272.1|73823_74825_+	TGS domain-containing protein	NA	A0A2K9L6B6	Tupanvirus	41.5	9.7e-54
WP_004214538.1|74817_75669_+	M14 family metallocarboxypeptidase	NA	NA	NA	NA	NA
WP_011154555.1|75665_77012_+	dihydroorotase	NA	NA	NA	NA	NA
WP_004214536.1|77075_78098_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_011251273.1|80260_80575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011251275.1|81083_81524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011251280.1|81948_82905_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_011251281.1|82964_83306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011251282.1|83319_83631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011251285.1|85572_85884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011251286.1|85880_86300_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_108970991.1|86245_86488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048333456.1|86491_87415_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.5	7.3e-165
WP_040217257.1|87865_88654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048333569.1|88674_89118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048333570.1|90661_91132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213850.1|91198_92122_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
WP_004213594.1|92355_92850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427619.1|93135_94140_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP032164	Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence	207409	134340	200746	207409	transposase,protease,integrase	Caulobacter_phage(13.64%)	62	140049:140064	194984:194999
WP_004225018.1|134340_135336_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
WP_004210218.1|135541_136555_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
WP_004210220.1|136667_137195_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_077250518.1|137208_140166_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.8	2.3e-50
140049:140064	attL	GCAGCAGAGAATGACA	NA	NA	NA	NA
WP_004144375.1|141007_141868_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
WP_011251321.1|143599_144235_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_011251320.1|144571_145813_-	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	27.2	2.2e-10
WP_000301240.1|145897_146473_-	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	9.6e-30
WP_004026609.1|146559_147138_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_004026607.1|147176_148217_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
WP_004026604.1|148240_148696_-	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_011251319.1|148718_149870_-	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_004196925.1|149866_150451_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.4	2.0e-11
WP_011251317.1|150761_151820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181731.1|151831_152974_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.5	3.7e-33
WP_004181732.1|152966_153740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026596.1|153741_154821_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	1.7e-40
WP_011251315.1|154820_155777_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_011251314.1|155787_157011_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_004196888.1|157013_157472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011251313.1|157951_158590_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026586.1|158614_159256_+	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
WP_004210266.1|159256_159895_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026583.1|159987_161028_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011251311.1|161027_162761_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_004196935.1|162788_164288_+	kinase	NA	NA	NA	NA	NA
WP_032720951.1|164666_165149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118061.1|165424_165829_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_004118062.1|166376_166655_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004181742.1|166748_166961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011251308.1|167427_167754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011251307.1|167991_169491_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	31.1	1.8e-35
WP_004210292.1|169471_170737_-	MSMEG_0569 family flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011154627.1|170754_171045_-	MSMEG_0570 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_004210297.1|171056_172019_-	sll0787 family AIR synthase-like protein	NA	NA	NA	NA	NA
WP_004210298.1|172015_172579_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004210300.1|172589_173699_-	MSMEG_0568 family radical SAM protein	NA	NA	NA	NA	NA
WP_004902273.1|173658_174660_-	Nit6803 family nitriliase	NA	NA	NA	NA	NA
WP_004210304.1|174673_175156_-	MSMEG_0572 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_004210305.1|175522_176923_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004118067.1|177298_177502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186895.1|177531_177846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026565.1|178088_178541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|179697_180678_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_029884537.1|183055_184132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213836.1|185274_185529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213833.1|185706_186843_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004213829.1|186908_187226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|187377_187701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011251302.1|188452_189412_-	DNA replication protein	NA	NA	NA	NA	NA
WP_004186937.1|189454_189862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213821.1|189871_190315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213807.1|191577_192546_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
WP_004902302.1|192873_194466_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_004189161.1|194496_194847_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004215130.1|194843_195284_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
194984:194999	attR	TGTCATTCTCTGCTGC	NA	NA	NA	NA
WP_004902307.1|195480_195663_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
WP_004117790.1|196868_197840_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_004211841.1|197839_199006_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
WP_071591903.1|198961_199210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073558148.1|199424_199706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004211839.1|199735_200746_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
>prophage 1
NZ_CP032165	Klebsiella pneumoniae strain XJ-K1 plasmid unnamed2, complete sequence	130628	49767	68089	130628	integrase,transposase	Escherichia_phage(42.86%)	23	49715:49729	63619:63633
49715:49729	attL	GGGCACTGTTGCAAA	NA	NA	NA	NA
WP_001067834.1|49767_50472_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_122997045.1|50508_51033_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|51001_52015_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|52159_52657_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|52768_53059_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|53064_53856_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|54019_54367_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|54360_55200_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|55129_55309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004883563.1|55327_55600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427619.1|55781_56786_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_065726122.1|57013_58219_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|58229_58535_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024143553.1|58550_58733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|58761_59526_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001336397.1|59716_60073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|60018_60603_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|60602_61841_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|61837_62743_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|62864_63569_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000243157.1|65547_65970_+	hypothetical protein	NA	NA	NA	NA	NA
63619:63633	attR	TTTGCAACAGTGCCC	NA	NA	NA	NA
WP_001545321.1|66077_66563_+	Dr family adhesin structural subunit	NA	NA	NA	NA	NA
WP_106378881.1|66860_68089_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.7	1.9e-168
>prophage 1
NZ_CP032166	Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence	99048	14216	40953	99048	integrase,transposase,protease	Escherichia_phage(61.54%)	34	17425:17476	40954:41005
WP_013609528.1|14216_15290_-|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_014343509.1|15361_15520_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_014343507.1|15829_16165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040245921.1|16212_16485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139608496.1|16481_16673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|16719_17424_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
17425:17476	attL	GGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
WP_012372818.1|17873_18629_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_000027057.1|18798_19659_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_064441864.1|19841_20378_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
WP_000957857.1|20469_20658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|21335_22040_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839980.1|22425_22842_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_014839979.1|22846_23365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|23430_24135_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|25245_25950_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012579081.1|27700_28624_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_013188475.1|28703_29579_-	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_001067855.1|30089_30794_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000439434.1|32104_32437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557619.1|32438_32696_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|32788_33442_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012311408.1|33631_34018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032495102.1|34380_35238_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001375168.1|35230_35305_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_064765370.1|35339_35549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083837.1|35549_35798_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001312851.1|36081_36231_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001736714.1|36535_36766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032083981.1|36929_37529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015059022.1|37914_38115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139328.1|38246_38807_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000205770.1|38861_39608_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	4.2e-09
WP_001067855.1|39852_40557_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_109491564.1|40566_40953_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	99.1	7.8e-60
40954:41005	attR	GGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 2
NZ_CP032166	Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence	99048	49786	87684	99048	integrase,transposase	Escherichia_phage(52.94%)	44	73138:73152	89307:89321
WP_001067858.1|49786_50491_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_071557810.1|50481_50622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333089.1|52432_52714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361389.1|52836_53187_-	protein stbB	NA	NA	NA	NA	NA
WP_000959884.1|53189_54152_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_032146011.1|54298_54592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|54703_55408_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004151607.1|56076_57003_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002903916.1|57029_58394_-	GntP family transporter	NA	NA	NA	NA	NA
WP_004160175.1|58451_59234_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_002210516.1|59238_59859_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|59851_61117_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|61128_62031_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_023148136.1|62068_62302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210513.1|62292_63054_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|63074_63935_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_099093179.1|63855_64095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138014.1|64175_67142_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|67145_67706_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_013213990.1|69248_69527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013213989.1|69637_70063_+	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
WP_013213987.1|70391_70688_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_004199234.1|71922_72804_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_013213985.1|73079_74060_-|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
73138:73152	attL	TCATGCCATTCCTTG	NA	NA	NA	NA
WP_014343468.1|74182_74656_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
WP_001067855.1|74695_75400_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_139608459.1|75826_76108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042061333.1|76120_76369_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_113248400.1|76368_76911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113248399.1|76919_77177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102765725.1|77166_77493_+	endoribonuclease MazF	NA	A0A1S5SAB3	Streptococcus_phage	40.0	2.4e-09
WP_113248398.1|77501_77939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102765728.1|77965_78148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361404.1|79620_80643_-	helicase UvrD	NA	NA	NA	NA	NA
WP_004206609.1|80627_82190_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044770.1|82263_82680_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|82676_82907_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015493090.1|82890_83325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977810.1|83485_84430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032738650.1|84508_84859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013214008.1|84916_85438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977813.1|85483_85687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977814.1|85716_86721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013214009.1|86904_87684_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
89307:89321	attR	TCATGCCATTCCTTG	NA	NA	NA	NA
