The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040886	Escherichia coli strain K71-77 chromosome, complete genome	4934660	180920	191698	4934660	integrase	Enterobacteria_phage(40.0%)	11	178893:178916	190401:190424
178893:178916	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
WP_000379042.1|180920_182876_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
WP_001753331.1|185240_185780_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_072163463.1|185962_186274_+	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
WP_001372461.1|186270_186951_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
WP_000149533.1|186947_187106_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_001678641.1|187102_188167_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
WP_001678640.1|188320_188539_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
WP_000488406.1|188586_188826_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|188965_189202_+	excisionase	NA	NA	NA	NA	NA
WP_000741339.1|189191_190334_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	99.7	8.1e-206
WP_000444487.1|190447_191698_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
190401:190424	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 2
NZ_CP040886	Escherichia coli strain K71-77 chromosome, complete genome	4934660	506073	514843	4934660	integrase	Salmonella_phage(90.0%)	12	505743:505756	514885:514898
505743:505756	attL	AAAACAATAAGTTA	NA	NA	NA	NA
WP_001376441.1|506073_506262_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
WP_001376443.1|506420_508814_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.7	0.0e+00
WP_001544405.1|508810_509668_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
WP_000752610.1|509664_509892_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001244224.1|509891_510125_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000996717.1|510192_510534_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956192.1|510651_510948_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000460892.1|510955_511465_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|511497_511719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680871.1|511864_512743_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.7e-30
WP_001678408.1|512754_513699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372563.1|513790_514843_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
514885:514898	attR	TAACTTATTGTTTT	NA	NA	NA	NA
>prophage 3
NZ_CP040886	Escherichia coli strain K71-77 chromosome, complete genome	4934660	594426	621630	4934660	capsid,lysis,integrase,tail	Enterobacteria_phage(47.06%)	46	596342:596356	621704:621718
WP_001356070.1|594426_595716_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
WP_000767389.1|595774_596251_+	kinase inhibitor	NA	NA	NA	NA	NA
596342:596356	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001753290.1|596996_598328_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_072163407.1|598401_598578_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.5	9.4e-21
WP_000239881.1|598727_599396_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_072035100.1|599340_599478_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
WP_001372490.1|600286_600847_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
WP_000105084.1|601235_601469_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|601525_601936_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|602287_602440_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001228702.1|602468_602675_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001372488.1|602891_603389_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
WP_000839582.1|603388_603604_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_000592543.1|604873_605833_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|606025_606550_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|606705_607083_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971068.1|607168_607309_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001372483.1|607305_607668_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
WP_001372487.1|607664_607955_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
WP_000224914.1|607947_608118_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001372486.1|608117_608573_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072157016.1|608569_608671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|608763_609216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720581.1|609212_609773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001403556.1|610029_610221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000145917.1|610257_610551_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001372464.1|610547_611249_-	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_001415152.1|611245_612175_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.2e-109
WP_001182899.1|612261_612801_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067458.1|612870_613101_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|613205_613895_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000389051.1|614017_614767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210934.1|614763_615591_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000233576.1|616099_616306_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|616381_616678_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|616683_617469_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_001372450.1|617465_618146_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_072126246.1|618142_618325_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_023148020.1|618297_618489_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_001395510.1|618499_618781_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763365.1|618879_619101_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_000120065.1|619311_619914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525073.1|620038_620224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|620156_620324_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|620363_620582_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|620559_621630_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
621704:621718	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 4
NZ_CP040886	Escherichia coli strain K71-77 chromosome, complete genome	4934660	1406072	1421944	4934660	capsid,integrase,tail	Escherichia_phage(35.29%)	19	1407598:1407617	1422175:1422194
WP_000202566.1|1406072_1407659_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
1407598:1407617	attL	GGGTGAGAAATAATGGCAAA	NA	NA	NA	NA
WP_001378647.1|1408211_1408508_+	hypothetical protein	NA	A0A291AWW6	Escherichia_phage	99.0	6.8e-48
WP_001378643.1|1408843_1409347_-	hypothetical protein	NA	A0A291AWW1	Escherichia_phage	100.0	1.1e-90
WP_071594465.1|1409776_1409899_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
WP_001171282.1|1410302_1411265_+	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	91.1	4.0e-174
WP_001681074.1|1411268_1411796_+|tail	tail fiber assembly protein	tail	A0A077SK10	Escherichia_phage	98.3	1.9e-93
WP_000972143.1|1411824_1412358_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	99.4	6.4e-97
WP_000521508.1|1413213_1413765_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_000649477.1|1413808_1414009_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|1414099_1414774_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_071587686.1|1415225_1415426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|1415440_1415803_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_001763729.1|1415868_1416693_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
WP_001401560.1|1416821_1417358_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	99.4	2.2e-100
WP_001242749.1|1417348_1417711_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_001377405.1|1417710_1418331_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.7	1.2e-113
WP_001061361.1|1418330_1418525_+	helix-turn-helix domain-containing protein	NA	A5LH59	Enterobacteria_phage	96.9	1.3e-31
WP_001419254.1|1418763_1420464_-	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	27.6	4.0e-07
WP_001680166.1|1420720_1421944_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.8	7.6e-234
1422175:1422194	attR	GGGTGAGAAATAATGGCAAA	NA	NA	NA	NA
>prophage 5
NZ_CP040886	Escherichia coli strain K71-77 chromosome, complete genome	4934660	1510249	1516808	4934660	transposase	uncultured_Caudovirales_phage(16.67%)	7	NA	NA
WP_000684856.1|1510249_1511206_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|1511206_1511974_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|1512531_1512789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254876.1|1513840_1514992_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000747102.1|1514911_1515262_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_000227281.1|1515362_1515935_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|1515983_1516808_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
>prophage 6
NZ_CP040886	Escherichia coli strain K71-77 chromosome, complete genome	4934660	1858480	1878526	4934660	lysis,integrase	Shigella_phage(37.5%)	29	1849745:1849758	1865092:1865105
1849745:1849758	attL	GTTACCAGATGAAA	NA	NA	NA	NA
WP_000332259.1|1858480_1859578_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	1.8e-210
WP_001217553.1|1859638_1859887_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000543834.1|1860109_1860661_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_001678535.1|1860638_1862009_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_000839596.1|1862479_1862695_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|1862762_1863815_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_001355891.1|1863964_1864159_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	100.0	1.8e-28
WP_046657263.1|1864405_1865572_+	nucleoid-associated protein	NA	A0A291AUQ0	Sinorhizobium_phage	25.3	1.7e-12
1865092:1865105	attR	GTTACCAGATGAAA	NA	NA	NA	NA
WP_046657265.1|1865568_1866795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016159280.1|1866787_1867132_-	hypothetical protein	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	3.3e-54
WP_001360050.1|1867149_1868139_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061404.1|1868146_1868944_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	100.0	5.2e-151
WP_000767133.1|1868963_1869353_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	1.6e-68
WP_032235543.1|1869349_1869676_-	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	98.1	6.6e-52
WP_000066917.1|1869672_1870326_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_072165319.1|1870325_1870820_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.6	1.9e-87
WP_021527492.1|1870816_1871635_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	3.1e-122
WP_001446924.1|1871631_1871856_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	98.6	7.0e-37
WP_032181493.1|1871860_1872697_-	ash family protein	NA	Q8SBF3	Shigella_phage	91.7	2.6e-137
WP_000515860.1|1872693_1873245_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_000649477.1|1873288_1873489_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859462.1|1873579_1874254_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_071587686.1|1874705_1874906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|1874920_1875283_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_001753751.1|1875348_1876173_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	6.6e-149
WP_000610754.1|1876359_1877142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093912.1|1877178_1877448_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	97.8	2.5e-41
WP_000019186.1|1877481_1878030_-	hypothetical protein	NA	S5M7T3	Escherichia_phage	89.6	2.7e-82
WP_000287252.1|1878052_1878526_-	SocA family protein	NA	K4NZT7	Burkholderia_phage	31.8	2.4e-18
>prophage 7
NZ_CP040886	Escherichia coli strain K71-77 chromosome, complete genome	4934660	2328224	2364590	4934660	integrase,transposase	Stx2-converting_phage(45.45%)	30	2323647:2323670	2364890:2364913
2323647:2323670	attL	TGGCGGAAGATCACAGGAGTCGAA	NA	NA	NA	NA
WP_001298859.1|2328224_2329766_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_053906593.1|2329780_2330527_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	6.0e-24
WP_053909994.1|2330584_2331397_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.8	5.1e-45
WP_071596305.1|2331417_2331552_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_001323397.1|2331551_2331710_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_060503901.1|2331780_2334627_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_032179701.1|2334998_2335871_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000241617.1|2335969_2336842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2338795_2339176_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2339172_2339520_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998068.1|2339569_2341108_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	97.3	3.1e-293
WP_014966159.1|2342555_2342753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001387788.1|2342655_2343258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072153745.1|2343352_2343631_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_072153746.1|2344454_2344640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001545803.1|2344820_2345018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148641.1|2345221_2345791_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271020.1|2345956_2346340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032181455.1|2346336_2346762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080195.1|2347241_2348855_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624711.1|2348885_2349236_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.0e-39
WP_001322394.1|2349599_2350616_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	1.1e-185
WP_001618954.1|2351660_2353691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001618955.1|2353696_2354887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001618956.1|2354907_2357025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001618957.1|2357029_2358439_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_024190230.1|2358428_2359241_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001618959.1|2359246_2360392_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_086937185.1|2360620_2361425_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	38.4	1.9e-31
WP_001218908.1|2363405_2364590_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	3.4e-162
2364890:2364913	attR	TGGCGGAAGATCACAGGAGTCGAA	NA	NA	NA	NA
>prophage 8
NZ_CP040886	Escherichia coli strain K71-77 chromosome, complete genome	4934660	3375036	3388219	4934660		Escherichia_phage(50.0%)	12	NA	NA
WP_001374723.1|3375036_3375798_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
WP_000254708.1|3375791_3376418_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|3376557_3377697_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|3377759_3378752_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104456.1|3378845_3380210_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|3380298_3381075_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|3381079_3381718_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|3381714_3382977_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|3382973_3383882_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|3384077_3384845_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141340.1|3384895_3385552_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|3385657_3388219_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 9
NZ_CP040886	Escherichia coli strain K71-77 chromosome, complete genome	4934660	3746219	3790394	4934660	holin,integrase,lysis,terminase,portal,head	Enterobacteria_phage(47.46%)	63	3743739:3743755	3793649:3793665
3743739:3743755	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000194515.1|3746219_3747653_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
WP_001274871.1|3747868_3748783_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001163428.1|3750630_3750831_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001281201.1|3750954_3751299_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	97.4	1.1e-57
WP_001277766.1|3751399_3751579_-	Eag protein	NA	K7PL40	Enterobacteria_phage	96.6	2.8e-28
WP_060503998.1|3751675_3752245_-	DUF551 domain-containing protein	NA	K7PK20	Enterobacteria_phage	95.5	3.1e-33
WP_060504002.1|3752241_3752679_-	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	47.6	5.9e-40
WP_060504005.1|3752675_3752843_-	DUF2737 family protein	NA	K7PJV9	Enterobacteria_phage	96.4	4.3e-23
WP_060504006.1|3752853_3753150_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	87.8	4.7e-41
WP_001016186.1|3753166_3753715_-	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	98.9	9.5e-104
WP_023277046.1|3753723_3754203_-	hypothetical protein	NA	Q716E9	Shigella_phage	99.4	4.6e-94
WP_024167014.1|3754212_3754686_-	single-stranded DNA-binding protein	NA	Q716E8	Shigella_phage	99.4	1.2e-59
WP_060504008.1|3754686_3755394_-	recombinase	NA	K7PKU3	Enterobacteria_phage	97.9	1.3e-134
WP_001243355.1|3755648_3755801_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|3755785_3755920_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001609782.1|3755995_3756307_-	superinfection exclusion protein	NA	A0A0N7BTN9	Escherichia_phage	97.1	1.0e-54
WP_000167595.1|3756450_3756921_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_060504010.1|3756929_3757229_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	97.0	6.5e-30
WP_000856967.1|3757631_3758282_-	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_000276886.1|3758362_3758548_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_001177653.1|3758656_3758935_+	transcriptional regulator	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
WP_000539336.1|3759117_3760008_+	hypothetical protein	NA	G5DA89	Enterobacteria_phage	99.7	3.4e-159
WP_001549089.1|3759997_3761434_+	AAA family ATPase	NA	K7PGR8	Enterobacteria_phage	100.0	7.9e-275
WP_000796282.1|3761509_3761836_+	hypothetical protein	NA	Q716D0	Shigella_phage	100.0	3.3e-59
WP_000049638.1|3761832_3762033_+	hypothetical protein	NA	Q716C9	Shigella_phage	100.0	4.6e-32
WP_060504012.1|3762044_3762311_+	hypothetical protein	NA	Q716C8	Shigella_phage	63.1	4.3e-25
WP_001515066.1|3762313_3762520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060504015.1|3762528_3762939_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.1	1.5e-69
WP_001254255.1|3762935_3763112_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_060504017.1|3763108_3764059_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	47.3	2.6e-96
WP_000950963.1|3764051_3764228_+	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_060504019.1|3764220_3764832_+	recombination protein NinG	NA	A0A088CQ20	Enterobacteria_phage	98.0	3.9e-98
WP_000144614.1|3764828_3765035_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_060504021.1|3765012_3765678_+	serine/threonine protein phosphatase	NA	A0A088CPU5	Enterobacteria_phage	97.3	6.1e-129
WP_060504023.1|3765674_3766298_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.0	9.8e-113
WP_000839574.1|3766845_3767061_+|holin	holin	holin	M1FN85	Enterobacteria_phage	100.0	2.4e-34
WP_060504025.1|3767060_3767558_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.8	1.7e-91
WP_060504028.1|3767554_3767998_+|lysis	lysis protein	lysis	Q9MCN3	Enterobacteria_phage	94.4	1.2e-67
WP_032181221.1|3767985_3768138_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	94.0	1.5e-19
WP_000877024.1|3768343_3768874_+	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	95.5	3.4e-90
WP_000807785.1|3769130_3769373_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_000179915.1|3769452_3769878_+	hypothetical protein	NA	Q716H4	Shigella_phage	90.8	1.9e-67
WP_060504031.1|3769874_3771287_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.4	1.4e-276
WP_060504033.1|3771289_3773416_+|portal	portal protein	portal	Q716H2	Shigella_phage	99.9	0.0e+00
WP_000426736.1|3773429_3774314_+	hypothetical protein	NA	Q716H1	Shigella_phage	100.0	4.7e-145
WP_060504035.1|3774325_3775597_+|head	head protein	head	Q716H0	Shigella_phage	99.8	3.0e-241
WP_000375639.1|3775639_3775825_+	hypothetical protein	NA	Q716G9	Shigella_phage	98.4	4.6e-26
WP_050484735.1|3775799_3776231_+	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	99.3	1.7e-76
WP_060504038.1|3776290_3777709_+	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	99.6	5.4e-276
WP_060504040.1|3777708_3778662_+	hypothetical protein	NA	Q716G6	Shigella_phage	84.9	5.4e-94
WP_000614037.1|3778661_3779117_+	DUF2824 family protein	NA	A0A088CQ57	Enterobacteria_phage	99.3	8.8e-87
WP_032191772.1|3779119_3779812_+	hypothetical protein	NA	A5VW66	Enterobacteria_phage	97.4	2.2e-113
WP_060504042.1|3779822_3781238_+	DNA transfer protein	NA	I6RSG0	Salmonella_phage	80.0	3.1e-199
WP_060504043.1|3781237_3783241_+	hypothetical protein	NA	A0A2I7QW93	Vibrio_phage	36.8	1.4e-96
WP_000275950.1|3783249_3783570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000757526.1|3783600_3783966_+	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	100.0	2.1e-67
WP_000151196.1|3784229_3784415_+	hypothetical protein	NA	I6RSG3	Salmonella_phage	100.0	1.1e-08
WP_001036007.1|3784389_3784599_-	hypothetical protein	NA	I6R975	Salmonella_phage	98.6	5.9e-30
WP_001549440.1|3784595_3784832_-	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	59.2	2.2e-17
WP_001549438.1|3784920_3785094_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_060504045.1|3785156_3786035_+	antirepressor	NA	I6R977	Salmonella_phage	78.5	4.0e-96
WP_072156916.1|3786145_3786640_-	hypothetical protein	NA	A0A173GC65	Salmonella_phage	41.6	2.0e-28
WP_060504054.1|3789236_3790394_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	1.4e-221
3793649:3793665	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 10
NZ_CP040886	Escherichia coli strain K71-77 chromosome, complete genome	4934660	4038034	4047476	4934660		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569361.1|4038034_4038961_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
WP_000783120.1|4038965_4039697_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4039677_4039785_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|4039844_4040576_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|4040797_4042483_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4042479_4043199_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4043245_4043716_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|4043756_4044218_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001374182.1|4044342_4046343_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001292773.1|4046339_4047476_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 11
NZ_CP040886	Escherichia coli strain K71-77 chromosome, complete genome	4934660	4692223	4716004	4934660	lysis,integrase,tail	Enterobacteria_phage(26.32%)	27	4687689:4687703	4712244:4712258
4687689:4687703	attL	CGCCGTCGCGGATTG	NA	NA	NA	NA
WP_000598292.1|4692223_4692550_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|4692755_4693970_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836058.1|4693981_4695001_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|4695058_4695169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877001.1|4695188_4696469_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001296941.1|4696503_4696740_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001372999.1|4696827_4699299_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
WP_001083281.1|4699392_4699584_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|4699580_4699769_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_072163420.1|4699852_4700095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054501.1|4700075_4701041_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_001373616.1|4701081_4701504_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
WP_001678528.1|4701633_4702578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001678529.1|4703125_4704475_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
WP_023147793.1|4704792_4705395_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
WP_023147794.1|4705754_4706735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032181055.1|4706939_4707248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|4707254_4707362_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013632.1|4707406_4707619_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
WP_000980999.1|4707834_4708086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|4708152_4708431_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_001373319.1|4708432_4709482_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.2e-108
WP_000904112.1|4709494_4709869_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762889.1|4709865_4710687_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.7e-78
WP_001373320.1|4711432_4713595_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	96.6	0.0e+00
4712244:4712258	attR	CGCCGTCGCGGATTG	NA	NA	NA	NA
WP_032181053.1|4714426_4715824_+	chaperone of endosialidase	NA	K7PGT9	Enterobacteria_phage	85.2	1.4e-204
WP_072163404.1|4715878_4716004_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	82.5	1.5e-12
>prophage 1
NZ_CP040884	Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence	145272	0	13836	145272		Lactococcus_phage(16.67%)	19	NA	NA
WP_001053910.1|696_1146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000380893.1|1127_1439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001151305.1|1612_2398_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	1.0e-10
WP_001207227.1|2401_3583_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_000703827.1|3631_3904_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000074431.1|3956_4592_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_001125904.1|5153_5531_+	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	1.7e-22
WP_000044823.1|5523_5805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000344149.1|5779_6454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326170.1|6521_6953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000348669.1|6937_7270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000647188.1|7278_7779_+	hypothetical protein	NA	I3UMJ0	Colwellia_phage	38.4	9.5e-18
WP_000936897.1|7782_9210_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000268552.1|9209_9866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000464630.1|9921_10539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000505706.1|10539_10746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326171.1|10750_11050_+	hypothetical protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	3.6e-20
WP_004201072.1|11140_11629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366823.1|11643_13836_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.4	9.9e-43
>prophage 2
NZ_CP040884	Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence	145272	27575	30934	145272	transposase	Salmonella_phage(50.0%)	3	NA	NA
WP_000608644.1|27575_28838_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_015058212.1|29161_30307_+	class C beta-lactamase CMY-6	NA	NA	NA	NA	NA
WP_001221666.1|30400_30934_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
>prophage 3
NZ_CP040884	Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence	145272	50418	55054	145272		Rhizobium_phage(25.0%)	5	NA	NA
WP_000085160.1|50418_51387_+	AAA domain-containing protein	NA	L7TKP0	Rhizobium_phage	32.6	1.2e-29
WP_000739139.1|51397_52306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000987165.1|52366_52897_+	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	71.8	2.6e-42
WP_001282585.1|52991_53981_+	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	39.6	1.1e-52
WP_000706865.1|54043_55054_+	YqaJ viral recombinase family protein	NA	E0YQ48	Mycobacterium_phage	28.7	5.6e-09
>prophage 4
NZ_CP040884	Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence	145272	61642	74053	145272	integrase,transposase	Salmonella_phage(33.33%)	13	70076:70089	75775:75788
WP_000595210.1|61642_62494_+	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
WP_001077336.1|62952_63339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000122922.1|63516_65244_+	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_000268337.1|65230_65509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000714163.1|65581_65803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427620.1|65984_66989_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|67067_70040_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|70042_70600_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
70076:70089	attL	GCGGCTGATGCCGA	NA	NA	NA	NA
WP_001447826.1|70637_70961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845039.1|70905_71919_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_015058213.1|72125_72704_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_000679427.1|72872_73220_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|73213_74053_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
75775:75788	attR	GCGGCTGATGCCGA	NA	NA	NA	NA
>prophage 5
NZ_CP040884	Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence	145272	90230	92217	145272		uncultured_virus(100.0%)	2	NA	NA
WP_004201172.1|90230_90521_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201176.1|90576_92217_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
>prophage 6
NZ_CP040884	Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence	145272	98519	100404	145272	integrase	Gordonia_phage(50.0%)	2	94737:94749	102594:102606
94737:94749	attL	CAGCCCGTTCGGT	NA	NA	NA	NA
WP_000543934.1|98519_99530_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_004201184.1|99534_100404_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
102594:102606	attR	ACCGAACGGGCTG	NA	NA	NA	NA
>prophage 7
NZ_CP040884	Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence	145272	103563	105075	145272		Pseudoalteromonas_phage(100.0%)	1	NA	NA
WP_000811656.1|103563_105075_+	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
>prophage 8
NZ_CP040884	Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence	145272	112403	116150	145272		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_000356489.1|112403_112676_+	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
WP_000790610.1|112675_113209_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000891157.1|113219_113828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001020646.1|113824_114376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000651490.1|114435_114855_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000919078.1|114856_115150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000077457.1|115166_116150_-	ParM/StbA family protein	NA	A7KUY1	Bacillus_phage	24.4	2.1e-08
>prophage 9
NZ_CP040884	Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence	145272	120053	121169	145272		unidentified_phage(100.0%)	1	NA	NA
WP_000946104.1|120053_121169_-	phosphoadenosine phosphosulfate reductase family protein	NA	H7BVI4	unidentified_phage	28.9	8.3e-46
>prophage 10
NZ_CP040884	Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence	145272	124809	130654	145272		Wolbachia_phage(25.0%)	11	NA	NA
WP_001348528.1|124809_125787_+	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	30.5	1.6e-16
WP_004201087.1|125802_126663_+	DsbA family protein	NA	NA	NA	NA	NA
WP_000591076.1|126696_127125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422769.1|127182_127542_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	49.4	5.6e-20
WP_000919343.1|127541_127988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210757.1|127984_128503_+	nitrite reductase	NA	NA	NA	NA	NA
WP_000972665.1|128502_128733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001167036.1|128719_129577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001270409.1|129602_129794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201083.1|129796_130324_+	thermonuclease family protein	NA	A0A1W6JQ32	Staphylococcus_phage	32.4	2.0e-05
WP_001043046.1|130381_130654_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	58.4	1.6e-19
>prophage 11
NZ_CP040884	Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence	145272	134284	138277	145272		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000286591.1|134284_134746_+	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	60.5	1.5e-46
WP_000062185.1|134748_135246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000954380.1|135349_135613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000434070.1|135807_136740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201081.1|136813_138277_+	AAA family ATPase	NA	U5XGM6	Phormidium_phage	38.2	2.4e-45
>prophage 12
NZ_CP040884	Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence	145272	142737	143676	145272		Yersinia_phage(100.0%)	1	NA	NA
WP_000268394.1|142737_143676_+	chromosome partitioning protein ParB	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.2e-69
>prophage 1
NZ_CP040885	Escherichia coli strain K71-77 plasmid pK71-77-2, complete sequence	117590	86975	114977	117590	transposase,protease	Stx2-converting_phage(42.86%)	33	NA	NA
WP_023149734.1|86975_88547_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_072142979.1|89250_89484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023149666.1|89429_89672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312851.1|89727_89877_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083833.1|90160_90418_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_071586949.1|90453_90570_-	replication protein RepA	NA	NA	NA	NA	NA
WP_032336874.1|90653_90728_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000410951.1|92487_93708_+	arginine deiminase	NA	NA	NA	NA	NA
WP_000440183.1|93718_94630_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000154545.1|94714_95719_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000514417.1|95766_97170_+	YfcC family protein	NA	NA	NA	NA	NA
WP_001496175.1|97250_97730_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000080227.1|98086_98308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000624725.1|98338_98689_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_059330006.1|98685_99048_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.5	9.0e-34
WP_032152936.1|99875_100454_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000005489.1|100866_101220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000156883.1|101691_102714_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_071529016.1|102900_103152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000083821.1|103118_103376_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_072163418.1|103416_103527_-	replication protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|103610_103685_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_032152935.1|103677_104535_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_071940974.1|104897_105284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000616807.1|105473_106127_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|106219_106477_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000439434.1|106478_106811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|108776_109481_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|109624_110179_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|110309_111140_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|111771_112476_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_024193849.1|112500_112875_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	9.8e-60
WP_000255956.1|113954_114977_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
