The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040900	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP18-6199 chromosome, complete genome	4813658	1192283	1268130	4813658	transposase,head,integrase,holin,tRNA,capsid,lysis,terminase,portal,protease,tail	Salmonella_phage(34.43%)	91	1184364:1184380	1273977:1273993
1184364:1184380	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1192283_1193321_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1193436_1194126_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1194444_1194828_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_140231990.1|1194889_1195477_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1195579_1196479_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1196496_1197831_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1197961_1198699_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1198683_1200306_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001521719.1|1200390_1200570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014344135.1|1200569_1200734_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1200730_1201306_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1201337_1201988_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1201987_1202944_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1202940_1203420_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007940.1|1203917_1205147_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	93.6	5.4e-232
WP_016716136.1|1205124_1205409_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	88.3	1.7e-43
WP_001237033.1|1205449_1205689_-	DUF4060 family protein	NA	H6WRW9	Salmonella_phage	96.2	1.8e-35
WP_077906754.1|1205731_1206889_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	97.9	1.2e-212
WP_053296508.1|1206851_1210052_-	DNA breaking-rejoining protein	NA	H6WRX1	Salmonella_phage	70.6	0.0e+00
WP_000373340.1|1210762_1210969_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	7.4e-17
WP_000368620.1|1211076_1212162_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	38.0	1.5e-60
WP_063325262.1|1212313_1212781_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	86.3	1.2e-67
WP_000145711.1|1212794_1213022_+	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_072143007.1|1212987_1213362_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	97.6	2.8e-62
WP_000024048.1|1213453_1214359_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	96.3	4.4e-170
WP_000788827.1|1214355_1215048_+	Replication protein 14	NA	G8C7U6	Escherichia_phage	60.2	1.8e-78
WP_000065092.1|1215062_1215728_+	ead/Ea22-like family protein	NA	A0A1V0E5L5	Salmonella_phage	44.9	2.8e-25
WP_000852188.1|1215729_1216200_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.1e-68
WP_000208067.1|1216202_1216856_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	52.0	6.3e-62
WP_000002116.1|1216848_1217130_+	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	95.7	3.2e-47
WP_014344025.1|1217241_1217433_+	hypothetical protein	NA	G8C7S2	Escherichia_phage	68.9	1.1e-17
WP_001217669.1|1217691_1217925_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1218041_1218290_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_063325263.1|1218324_1218936_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	5.8e-110
WP_001241021.1|1218926_1219133_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	6.0e-35
WP_001096550.1|1219135_1219747_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1219743_1219884_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1219880_1220558_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_072095218.1|1220554_1220740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|1220830_1221394_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1221900_1222089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1222303_1222990_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1223265_1223595_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|1223578_1224031_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|1224048_1224501_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1224736_1225138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1225424_1225970_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1225941_1227873_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1227856_1228060_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1228056_1229637_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1229626_1231123_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1231135_1231483_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1231537_1232566_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1232623_1232983_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1232993_1233377_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1233404_1233983_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1234031_1235162_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1235270_1235672_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1235679_1236426_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1236476_1236872_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1236868_1237207_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|1237178_1240274_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|1240276_1240606_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1240615_1241314_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1241320_1242058_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1241955_1242603_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1242664_1246027_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1246065_1246308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1246361_1248734_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1248730_1249555_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1249544_1250123_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1250219_1250447_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1250553_1250766_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_015701342.1|1250828_1250894_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_071925522.1|1251655_1253146_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	98.4	4.7e-254
WP_000790154.1|1253550_1255350_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1255366_1256341_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1256614_1257295_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1257291_1258197_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1258208_1258937_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1258948_1259680_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1259679_1260060_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1260171_1260432_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1260469_1261396_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276365.1|1261511_1262708_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684022.1|1262729_1263647_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1263685_1264534_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1264649_1265543_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1265553_1266915_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1266918_1267554_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1267578_1268130_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1273977:1273993	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP040900	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP18-6199 chromosome, complete genome	4813658	1621579	1651172	4813658	holin,protease,tail	Salmonella_phage(38.46%)	32	NA	NA
WP_000781589.1|1621579_1622074_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1622487_1622979_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1622968_1623232_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1623228_1625715_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1625721_1626417_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1626403_1627273_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1627388_1627838_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1627847_1628450_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888528.1|1628470_1629088_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	3.1e-10
WP_000990028.1|1629084_1629744_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1629795_1630533_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1630529_1630742_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1630738_1631218_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1631214_1633146_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1633142_1633700_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_140231994.1|1633696_1634740_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001115498.1|1634783_1635431_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1636160_1636724_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1636915_1637119_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1637421_1638213_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1638509_1638713_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1638881_1641248_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1641576_1642566_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1642580_1642949_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1642977_1644309_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1644605_1644935_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1645527_1646769_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1646771_1647299_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1647676_1648120_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1648173_1650003_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1650350_1650641_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1650668_1651172_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 3
NZ_CP040900	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP18-6199 chromosome, complete genome	4813658	1723935	1733106	4813658	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1723935_1724883_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1724866_1725598_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1725578_1725686_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1725745_1726477_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1726699_1728385_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1728381_1729101_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1729147_1729615_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1729671_1730202_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1730373_1730832_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1731072_1733106_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP040900	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP18-6199 chromosome, complete genome	4813658	1801413	1811919	4813658		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1801413_1802817_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1802994_1803888_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1804264_1805350_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1805349_1806249_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1806296_1807175_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1807175_1807727_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1807732_1808725_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1808721_1809495_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1809499_1810579_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1810605_1811919_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_CP040900	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP18-6199 chromosome, complete genome	4813658	1897913	1949257	4813658	head,integrase,holin,plate,capsid,terminase,portal,protease,tail	Salmonella_phage(79.1%)	74	1893713:1893728	1912767:1912782
1893713:1893728	attL	TAAAAATTCCTCGCGT	NA	NA	NA	NA
WP_001219015.1|1897913_1898387_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001738920.1|1899034_1899325_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_000598920.1|1899696_1900494_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|1900785_1901775_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|1901776_1902019_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_001061334.1|1902043_1902613_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_024148319.1|1902616_1903318_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	59.9	3.6e-79
WP_020898896.1|1903322_1903682_-	hypothetical protein	NA	A0A1L7N114	Ralstonia_phage	49.1	2.1e-22
WP_023228391.1|1903681_1904221_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	71.3	1.5e-64
WP_000008351.1|1904291_1904831_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_053299710.1|1904967_1905795_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	98.5	7.1e-151
WP_000997190.1|1905851_1906223_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000141752.1|1906759_1907005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001752499.1|1906922_1907219_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	98.0	1.1e-50
WP_001574551.1|1907199_1907451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070794471.1|1907378_1907564_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	71.1	5.8e-13
WP_053299709.1|1907768_1908464_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.1	4.6e-127
WP_071529734.1|1908437_1908623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001191666.1|1908561_1908786_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|1908814_1909369_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_000281065.1|1909514_1909691_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	78.6	4.2e-21
WP_000147078.1|1909709_1910018_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	93.1	2.5e-45
WP_097361745.1|1910016_1911216_+	peptidase	NA	Q8HA97	Salmonella_phage	76.7	9.9e-154
WP_000620702.1|1911212_1911437_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000096529.1|1911433_1912408_+	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	97.8	1.2e-165
WP_000054227.1|1912404_1912878_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	94.6	3.9e-53
1912767:1912782	attR	ACGCGAGGAATTTTTA	NA	NA	NA	NA
WP_000200166.1|1912874_1913756_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	96.2	8.3e-166
WP_000779149.1|1913764_1914154_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	99.2	1.9e-69
WP_140231997.1|1914170_1915031_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.6	1.7e-160
WP_096753347.1|1915038_1916028_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	99.7	3.6e-194
WP_020899401.1|1916041_1916794_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_001624505.1|1916944_1917202_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|1917347_1917734_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|1917720_1918002_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|1918001_1918616_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_140231998.1|1918612_1919005_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	98.5	3.1e-64
WP_140231999.1|1918889_1919168_+	peptidase	NA	Q8SBD8	Shigella_phage	73.1	2.9e-24
WP_001379492.1|1919467_1919800_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001135098.1|1919850_1920201_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_000929191.1|1920326_1920821_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_000088185.1|1920817_1922551_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.8	0.0e+00
WP_000605609.1|1922562_1922745_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466254.1|1922744_1923986_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_001193639.1|1923963_1924614_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000257528.1|1924628_1925834_+|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_000601353.1|1925884_1926085_+	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000927378.1|1926087_1926411_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000702409.1|1926407_1926812_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	99.3	5.4e-72
WP_001135697.1|1926783_1927296_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000779217.1|1927292_1927853_+	hypothetical protein	NA	Q8HAC7	Salmonella_phage	99.5	8.8e-105
WP_000497739.1|1927856_1928021_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_001007995.1|1928010_1929507_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.8	6.1e-278
WP_000515952.1|1929506_1929863_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|1929859_1930186_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785385.1|1930270_1932199_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000863818.1|1932232_1933573_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_001066636.1|1933569_1934628_+	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_001273649.1|1934627_1935161_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605050.1|1935165_1935579_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_000785580.1|1935571_1936651_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.7	2.5e-204
WP_001207832.1|1936653_1937241_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554737.1|1937227_1938790_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_000760554.1|1938789_1939359_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
WP_000492926.1|1939643_1940651_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_001526483.1|1940863_1941085_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000500831.1|1941715_1941877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|1942003_1942423_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|1942425_1943694_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|1944148_1944361_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1944371_1944560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|1944820_1946017_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|1946666_1946966_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|1947057_1947753_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|1947826_1949257_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP040900	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP18-6199 chromosome, complete genome	4813658	2053299	2060105	4813658	tail,integrase	Salmonella_phage(33.33%)	11	2055509:2055531	2065221:2065243
WP_000856224.1|2053299_2053530_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2053667_2054042_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2054042_2054918_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2054934_2055288_+	YebY family protein	NA	NA	NA	NA	NA
2055509:2055531	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|2055661_2056516_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2056575_2057070_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2057259_2057490_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2057543_2058077_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2058333_2058501_-	lytic enzyme	NA	NA	NA	NA	NA
WP_053871265.1|2058565_2058751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2059223_2060105_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2065221:2065243	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP040900	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP18-6199 chromosome, complete genome	4813658	2819921	2904661	4813658	integrase,holin,tRNA,terminase,portal,lysis,tail,protease	Salmonella_phage(44.64%)	94	2844015:2844034	2915807:2915826
WP_000938191.1|2819921_2820602_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2821222_2821882_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2821968_2822298_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2822294_2822576_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2822624_2823404_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2823429_2823978_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2824192_2825404_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2825461_2825779_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2825823_2826240_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2826410_2827073_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2827167_2827626_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2827661_2829716_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2829839_2830286_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2830304_2832458_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2832444_2833050_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2833266_2833776_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2834132_2835185_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2835256_2835709_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2835894_2837655_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2837723_2838242_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2838341_2838509_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2838764_2839328_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2839324_2840965_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2840969_2842223_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2842237_2844145_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2844015:2844034	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2844157_2846266_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2846364_2847474_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2847470_2848013_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2848178_2849189_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2849396_2852009_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2852435_2852627_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_010989011.1|2853573_2853873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2853941_2854568_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001533476.1|2855215_2856184_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000143167.1|2856659_2857241_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001144679.1|2857240_2859679_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000178849.1|2859732_2859975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031615525.1|2860013_2860937_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	76.9	5.6e-56
WP_001541992.1|2860915_2863363_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	68.0	0.0e+00
WP_000246065.1|2863434_2864139_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2864036_2864774_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2864783_2865479_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2865568_2866102_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2866218_2866716_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|2866814_2867147_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|2867143_2870131_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|2870210_2870540_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|2870536_2870935_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|2870980_2871730_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|2871741_2872143_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|2872139_2872706_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|2872686_2872986_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2872978_2873302_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|2873392_2875474_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_077679777.1|2875397_2876915_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_000196190.1|2876941_2877148_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|2877144_2879283_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|2879239_2879773_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|2879980_2880460_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2880477_2880930_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2880913_2881243_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|2881518_2882205_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2882565_2883015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2883150_2883276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|2883449_2883767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|2883833_2884631_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|2884620_2884767_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|2884763_2885375_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001241019.1|2885377_2885584_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_000929805.1|2885583_2886186_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|2886268_2886490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2886601_2886835_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_010989003.1|2887126_2887417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2887494_2887806_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|2887802_2888150_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|2888160_2888910_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_031235175.1|2888912_2889896_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2889980_2890355_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2890320_2890560_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2890679_2891090_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_010989002.1|2891139_2891400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|2891392_2891551_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|2891572_2891872_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000017133.1|2891998_2894884_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001539618.1|2894846_2896004_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2896046_2896286_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2896326_2896575_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|2896619_2897912_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|2898106_2899309_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|2899386_2900823_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|2901067_2902282_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000301921.1|2902368_2902602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762342.1|2902598_2903060_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2903260_2904661_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
2915807:2915826	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 8
NZ_CP040900	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP18-6199 chromosome, complete genome	4813658	2968797	2977529	4813658	transposase,protease	Enterobacteria_phage(14.29%)	8	NA	NA
WP_085983316.1|2968797_2970052_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_119920232.1|2970067_2970343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|2970515_2970974_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|2971165_2973442_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2973472_2973793_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2974116_2974338_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|2974467_2976414_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|2976410_2977529_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 9
NZ_CP040900	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP18-6199 chromosome, complete genome	4813658	3585560	3636143	4813658	integrase,holin,lysis,terminase,protease,tail	Enterobacteria_phage(52.05%)	75	3589481:3589497	3639188:3639204
WP_058685116.1|3585560_3586697_-|tail	tail fiber domain-containing protein	tail	Q5G8V6	Enterobacteria_phage	99.5	4.6e-209
WP_015976802.1|3586816_3587059_+	hypothetical protein	NA	Q5G8V7	Enterobacteria_phage	100.0	1.6e-39
WP_015976801.1|3587240_3587894_-	hypothetical protein	NA	Q5G8V8	Enterobacteria_phage	100.0	8.7e-120
WP_058685117.1|3587893_3588205_-	hypothetical protein	NA	Q5G8V9	Enterobacteria_phage	100.0	4.3e-53
WP_140232017.1|3588204_3591360_-	DUF1983 domain-containing protein	NA	Q5G8W0	Enterobacteria_phage	99.9	0.0e+00
3589481:3589497	attL	TCAGAGTCGGTGTTGAT	NA	NA	NA	NA
WP_001747796.1|3591369_3591897_-|tail	tail assembly protein	tail	I6RSM0	Salmonella_phage	95.2	6.4e-65
WP_015976798.1|3591839_3592559_-	C40 family peptidase	NA	Q5G8W2	Enterobacteria_phage	100.0	2.0e-146
WP_015976797.1|3592558_3593263_-|tail	phage minor tail protein L	tail	Q5G8W3	Enterobacteria_phage	100.0	6.4e-137
WP_015976796.1|3593426_3593714_+	hypothetical protein	NA	Q5G8W4	Enterobacteria_phage	100.0	9.5e-47
WP_058656178.1|3593718_3593979_-	DUF1327 domain-containing protein	NA	A0A1V0E5N5	Salmonella_phage	98.8	1.3e-37
WP_015976794.1|3593990_3594338_-|tail	phage tail protein	tail	Q5G8W6	Enterobacteria_phage	100.0	1.5e-62
WP_015976793.1|3594430_3594829_+	hypothetical protein	NA	Q5G8W7	Enterobacteria_phage	100.0	2.7e-71
WP_140232018.1|3594829_3598204_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	99.8	0.0e+00
WP_102136173.1|3598265_3598736_-	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	100.0	1.7e-80
WP_015976790.1|3598833_3600363_-	DUF4041 domain-containing protein	NA	Q5G8X0	Enterobacteria_phage	100.0	7.6e-167
WP_140232019.1|3600720_3601374_-	hypothetical protein	NA	H6WRU2	Salmonella_phage	98.2	6.2e-118
WP_140232020.1|3601419_3602160_-	hypothetical protein	NA	H6WRU1	Salmonella_phage	98.8	5.6e-131
WP_140232021.1|3602177_3602564_-	hypothetical protein	NA	I6R9A6	Salmonella_phage	96.9	4.3e-66
WP_140232022.1|3602560_3602998_-	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	97.2	2.5e-75
WP_052938570.1|3603005_3603368_-	hypothetical protein	NA	H6WRT8	Salmonella_phage	96.7	5.2e-66
WP_001650231.1|3603360_3603540_-	DUF551 domain-containing protein	NA	Q5G8X7	Enterobacteria_phage	98.3	2.5e-29
WP_000633370.1|3603539_3603941_-	hypothetical protein	NA	Q5G8X8	Enterobacteria_phage	100.0	1.4e-72
WP_001151796.1|3603992_3604181_-	hypothetical protein	NA	Q5G8X9	Enterobacteria_phage	100.0	2.9e-28
WP_000273924.1|3604190_3605267_-	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	100.0	1.4e-207
WP_001650234.1|3605284_3605731_-	hypothetical protein	NA	H6WRT3	Salmonella_phage	100.0	3.1e-76
WP_023205066.1|3605743_3607006_-	hypothetical protein	NA	H6WRT2	Salmonella_phage	99.8	8.0e-239
WP_020838512.1|3607021_3607981_-	hypothetical protein	NA	H6WRT1	Salmonella_phage	99.7	4.6e-178
WP_140232023.1|3607934_3609287_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	99.3	1.7e-258
WP_023230826.1|3609419_3610739_-|terminase	PBSX family phage terminase large subunit	terminase	H6WRS9	Salmonella_phage	98.9	5.1e-260
WP_000147265.1|3610722_3611154_-|terminase	terminase small subunit	terminase	Q5G8Y8	Enterobacteria_phage	100.0	5.8e-72
WP_079839818.1|3611588_3612278_-	hypothetical protein	NA	Q5G8R0	Enterobacteria_phage	99.1	1.2e-124
WP_140232024.1|3612477_3612915_-|lysis	lysis protein	lysis	A0A0N6WGE8	Salmonella_phage	95.2	3.2e-70
WP_094158760.1|3612911_3613349_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	98.6	2.2e-74
WP_000738703.1|3613332_3613659_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_140232025.1|3613794_3614001_-	hypothetical protein	NA	M1E3N9	Enterobacteria_phage	82.4	2.8e-24
WP_065348422.1|3614090_3614714_-	antitermination protein	NA	C6ZR62	Salmonella_phage	99.5	8.9e-114
WP_140232026.1|3614710_3614890_-	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	96.6	2.1e-23
WP_140232027.1|3614870_3615074_-	protein ninH	NA	A0A1V0E5I5	Salmonella_phage	89.6	5.7e-30
WP_023213388.1|3615070_3615676_-	recombination protein NinG	NA	G9L693	Escherichia_phage	95.5	2.0e-94
WP_023167624.1|3615676_3615895_-	hypothetical protein	NA	Q5G8S1	Enterobacteria_phage	98.6	7.0e-34
WP_140232028.1|3615875_3616058_-	NinF family protein	NA	Q5G8S2	Enterobacteria_phage	93.3	3.1e-27
WP_000113769.1|3616054_3616231_-	NinE family protein	NA	Q5G8S3	Enterobacteria_phage	100.0	3.0e-27
WP_024136726.1|3616197_3616371_-	hypothetical protein	NA	Q8HAF7	Salmonella_phage	96.5	1.7e-30
WP_114060541.1|3616367_3616814_-	recombination protein NinB	NA	I6R0N7	Salmonella_phage	98.0	3.9e-79
WP_023217805.1|3616770_3617067_-	hypothetical protein	NA	E7C9R7	Salmonella_phage	89.8	1.1e-42
WP_140232029.1|3617069_3617342_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	89.9	8.8e-42
WP_000158322.1|3617412_3617691_-	hypothetical protein	NA	Q5G8S7	Enterobacteria_phage	96.6	8.7e-45
WP_140232030.1|3617687_3619064_-	AAA family ATPase	NA	I6R0N4	Salmonella_phage	98.3	2.9e-250
WP_140232031.1|3619060_3619876_-	replication protein	NA	A0A075B8J2	Enterobacteria_phage	97.4	5.3e-143
WP_001125981.1|3619868_3620015_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000424166.1|3620049_3620328_-	transcriptional regulator	NA	A0A220NRS4	Escherichia_phage	93.5	2.2e-40
WP_000182204.1|3620435_3620651_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3620761_3621451_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_000680396.1|3621810_3622056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000834175.1|3622096_3622300_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_023167634.1|3622678_3622981_+	hypothetical protein	NA	B8K1E6	Salmonella_phage	99.0	9.7e-50
WP_140232032.1|3623001_3623580_-	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	89.1	4.2e-86
WP_140232033.1|3623772_3624378_+	hypothetical protein	NA	A0A2H4FRY7	Salmonella_phage	77.6	2.1e-80
WP_001539176.1|3624571_3624745_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.6e-23
WP_000156731.1|3624725_3624914_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_140232034.1|3625043_3625751_+	recombinase	NA	I6R0N0	Salmonella_phage	98.3	3.2e-136
WP_000168279.1|3625751_3626258_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	99.4	2.3e-91
WP_140232035.1|3626266_3626815_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	99.5	2.3e-105
WP_058108948.1|3626830_3627124_+	DUF2856 family protein	NA	Q5G8U3	Enterobacteria_phage	90.7	3.5e-44
WP_000773122.1|3627134_3627422_+	hypothetical protein	NA	Q5G8U4	Enterobacteria_phage	96.8	3.4e-44
WP_001215095.1|3627418_3627589_+	DUF2737 family protein	NA	Q5G8U5	Enterobacteria_phage	92.9	5.7e-23
WP_075584470.1|3627576_3628194_+	Eae-like protein	NA	Q5G8U6	Enterobacteria_phage	72.1	6.1e-75
WP_140232036.1|3628302_3628662_+	DUF5448 family protein	NA	T1SA95	Salmonella_phage	98.3	3.3e-65
WP_140232037.1|3628658_3629540_+	hypothetical protein	NA	Q8HAA6	Salmonella_phage	89.8	1.6e-39
WP_140232038.1|3629541_3629733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140232053.1|3630267_3630636_+	DUF551 domain-containing protein	NA	A0A2H4FNA9	Salmonella_phage	61.6	1.8e-34
WP_140232039.1|3631073_3632237_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H5BFK7	Salmonella_phage	98.7	5.9e-228
WP_000893231.1|3632442_3633693_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|3633704_3634808_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|3635090_3636143_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
3639188:3639204	attR	ATCAACACCGACTCTGA	NA	NA	NA	NA
>prophage 10
NZ_CP040900	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP18-6199 chromosome, complete genome	4813658	4393585	4440629	4813658	tRNA,plate,tail	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4393585_4394584_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4394671_4395982_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4396228_4396744_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4396842_4397052_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4397073_4397187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4397183_4398509_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4398687_4399296_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4399404_4399773_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4399943_4402364_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4402462_4403335_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4403348_4403846_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4404026_4404944_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4405107_4406466_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4406554_4407664_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4408025_4409216_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4409347_4410892_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4410906_4411797_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4411962_4412373_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4412515_4414612_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4414611_4415349_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_022742863.1|4415345_4416014_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4416047_4416290_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4416733_4418383_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4418727_4420077_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4420209_4420557_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4421132_4421420_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4421422_4422028_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_023893165.1|4422040_4422355_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	1.4e-19
WP_000449433.1|4422514_4422970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4422966_4423164_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4423153_4424581_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4424580_4425105_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_023893164.1|4425156_4425474_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4425433_4425562_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4425658_4428013_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4428012_4428966_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4428965_4429175_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4429162_4430206_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4430215_4430938_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4431265_4431628_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4431624_4432554_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4432553_4434101_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4434264_4434624_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4434614_4435730_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4435722_4436355_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4436357_4438103_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4438107_4438713_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4438709_4439165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4439413_4439704_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4439900_4440629_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP040901	Salmonella enterica subsp. enterica serovar Typhimurium strain SAP18-6199 plasmid pCFSAN074387, complete sequence	93930	35260	44556	93930	transposase	Escherichia_phage(28.57%)	12	NA	NA
WP_001541564.1|35260_35677_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|35860_36196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541562.1|36252_36819_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728917.1|36850_37792_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_000427676.1|38206_39412_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_001541561.1|39408_40386_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
WP_000457541.1|40467_41742_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_000925627.1|41741_42164_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000490265.1|42674_43145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|43137_43494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000091632.1|43542_43731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088645.1|43875_44556_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
