The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040924	Clostridium sp. SYSU GA15002T chromosome, complete genome	3805212	455464	474930	3805212	transposase	Organic_Lake_phycodnavirus(33.33%)	20	NA	NA
WP_139902806.1|455464_456223_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_139902809.1|456326_457574_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_139902812.1|457695_461109_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_139902814.1|461111_462806_+	Hsp70 family protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	35.8	4.3e-78
WP_139902817.1|462800_463187_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_139902818.1|463326_464004_-	DUF1080 domain-containing protein	NA	NA	NA	NA	NA
WP_139902821.1|464240_464549_+	glutaredoxin	NA	NA	NA	NA	NA
WP_139902823.1|465069_465798_+	DUF1361 domain-containing protein	NA	NA	NA	NA	NA
WP_139902824.1|465813_466992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139902826.1|467077_467302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139902828.1|467453_467633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139902829.1|467874_469101_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	54.3	1.3e-55
WP_139902831.1|469288_469441_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	51.2	2.5e-06
WP_139902833.1|469493_469946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139902835.1|470065_470929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139902837.1|470889_471441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139902839.1|471679_472054_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_139902841.1|472156_472639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139902842.1|472654_473338_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_139902844.1|473700_474930_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP040924	Clostridium sp. SYSU GA15002T chromosome, complete genome	3805212	878782	931999	3805212	tRNA,transposase,bacteriocin,integrase	Burkholderia_phage(12.5%)	45	877574:877590	901417:901433
877574:877590	attL	GGAACATTAACAATGAA	NA	NA	NA	NA
WP_139903600.1|878782_879157_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_139903602.1|879259_879742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139902842.1|879757_880441_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_139906280.1|882616_882943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139903604.1|882944_883742_+	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	25.0	7.8e-06
WP_139903606.1|884220_884400_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_139903607.1|884422_884608_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_139903609.1|884834_885305_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_139903611.1|885500_887717_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	29.5	2.9e-50
WP_139903613.1|887719_889255_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_139903614.1|889283_890372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139903616.1|890260_891460_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_139903617.1|891597_892089_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_139903618.1|892096_893002_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_139903619.1|893572_894112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139903620.1|894371_895307_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	61.6	8.7e-97
WP_139903621.1|895502_896327_+	ATP-dependent sacrificial sulfur transferase LarE	NA	NA	NA	NA	NA
WP_139903623.1|896378_897512_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7C038	Faustovirus	29.1	1.6e-36
WP_139903625.1|897513_898659_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_139903626.1|898905_899967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139903628.1|900783_902031_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
901417:901433	attR	GGAACATTAACAATGAA	NA	NA	NA	NA
WP_139903630.1|902130_903543_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_139903632.1|903539_904439_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_139903634.1|904463_906056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139903635.1|906219_907131_+	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
WP_139903637.1|907132_907696_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_139903639.1|907799_909152_+	citrate synthase	NA	NA	NA	NA	NA
WP_139906281.1|909389_910685_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_139903641.1|910895_911609_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_139903643.1|911775_913269_+	repressor LexA	NA	R9VW28	Paenibacillus_phage	33.3	9.8e-10
WP_139903645.1|913321_915475_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.2	7.3e-14
WP_139903646.1|915721_916789_+	NTP transferase domain-containing protein	NA	A0A1V0SH58	Hokovirus	33.1	2.2e-35
WP_139903648.1|916971_917931_+	DUF4349 domain-containing protein	NA	NA	NA	NA	NA
WP_139903650.1|918074_919268_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_139903651.1|919404_920403_+	serine hydrolase	NA	NA	NA	NA	NA
WP_139903653.1|920590_920797_+	small, acid-soluble spore protein, alpha/beta type	NA	G3MAF8	Bacillus_virus	44.3	2.8e-08
WP_139903655.1|920951_921917_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_139903657.1|922111_924859_+	cellobiose phosphorylase	NA	NA	NA	NA	NA
WP_139903659.1|924874_925291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139903660.1|925360_925558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139903662.1|925639_926170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139903663.1|926182_927352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139903665.1|927844_930214_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_139903667.1|930279_930813_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_139903669.1|931057_931999_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP040924	Clostridium sp. SYSU GA15002T chromosome, complete genome	3805212	946897	1003549	3805212	holin,transposase	Leptospira_phage(17.65%)	46	NA	NA
WP_139903690.1|946897_947836_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_139903692.1|948007_951145_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	34.7	2.5e-164
WP_139903694.1|951182_951938_-	glycerophosphodiester phosphodiesterase	NA	A0A2H4PGQ5	Escherichia_phage	29.8	2.0e-19
WP_139903696.1|952102_954136_-	helicase	NA	A0A248SJQ0	Salicola_phage	32.8	1.7e-49
WP_139903697.1|954332_954782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139903699.1|955019_955394_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_139903701.1|955442_956321_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.8	2.6e-26
WP_139903702.1|956313_956970_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_139903704.1|957205_957838_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_139903706.1|958075_959203_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	44.2	1.7e-17
WP_139906283.1|959211_960819_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_139903707.1|961218_963444_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	31.4	3.5e-27
WP_139903708.1|963687_964476_+	5'/3'-nucleotidase SurE	NA	NA	NA	NA	NA
WP_139903710.1|964637_965585_+	diguanylate cyclase	NA	W8CYM9	Bacillus_phage	35.8	9.0e-17
WP_139903712.1|965690_966404_+	hypothetical protein	NA	A0A1W6JQM0	Staphylococcus_phage	36.6	1.0e-12
WP_139903714.1|966667_968080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139903716.1|968163_970833_+	family 10 glycosylhydrolase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	41.1	4.8e-31
WP_139903718.1|970868_971969_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_139903720.1|972161_972734_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_139903722.1|973098_973776_+	exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase	NA	NA	NA	NA	NA
WP_139903724.1|975258_976341_+	GDP-mannose 4,6-dehydratase	NA	A0A0E3G468	Synechococcus_phage	64.1	9.0e-122
WP_139903726.1|976855_978061_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_139906284.1|978204_979143_+	NAD-dependent epimerase/dehydratase family protein	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	58.3	1.2e-106
WP_139903728.1|979159_980614_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_139903730.1|980618_981377_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_139903731.1|981363_982305_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_139903733.1|982323_983547_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_139903735.1|984714_985941_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_139903737.1|986064_986595_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_139903738.1|986775_987963_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_139903740.1|988846_989296_+	UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_139903742.1|989292_989781_+	glycosyl transferase family 28	NA	NA	NA	NA	NA
WP_139903743.1|989799_990945_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_139903745.1|990922_991282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139903747.1|991309_991990_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_139903749.1|992101_993172_+	NTP transferase domain-containing protein	NA	A0A1V0SH58	Hokovirus	32.7	9.8e-36
WP_139903751.1|993561_993897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139903753.1|993890_994241_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_139903755.1|994332_995946_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	30.9	2.2e-55
WP_139906285.1|996328_997876_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.8	1.7e-17
WP_139903756.1|997863_998469_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	39.8	7.2e-36
WP_139903758.1|998584_999325_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_139902291.1|999688_999997_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_139902289.1|999990_1000347_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	48.4	1.7e-21
WP_139902287.1|1000487_1002122_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.5	3.9e-60
WP_139903760.1|1002241_1003549_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP040924	Clostridium sp. SYSU GA15002T chromosome, complete genome	3805212	1080385	1140805	3805212	transposase,integrase	Streptococcus_phage(16.67%)	49	1124880:1124896	1140562:1140578
WP_139903870.1|1080385_1081549_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	30.9	2.9e-33
WP_139903872.1|1081799_1082120_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_139903884.1|1082079_1082430_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5RCS0	Lactobacillus_phage	37.7	2.0e-14
WP_139903885.1|1082621_1083101_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_139903887.1|1083181_1084033_+	DUF2179 domain-containing protein	NA	M1Q1P6	Streptococcus_phage	33.5	2.9e-30
WP_139903889.1|1084181_1084868_+	cell division ATP-binding protein FtsE	NA	G3M9Y6	Bacillus_virus	28.3	6.7e-22
WP_139903891.1|1084857_1085754_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_139903892.1|1085790_1086912_+	peptidoglycan DD-metalloendopeptidase family protein	NA	E5G070	Clostridium_phage	57.0	4.2e-21
WP_139906287.1|1087165_1088506_+	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	25.9	1.8e-18
WP_139903894.1|1088522_1089857_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_139903760.1|1089985_1091293_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_139903896.1|1091474_1092170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139903898.1|1093070_1095065_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_139906288.1|1095091_1097914_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.9	0.0e+00
WP_139903900.1|1097980_1098418_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_139903902.1|1098471_1099671_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_139903904.1|1099695_1101114_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_139903905.1|1101142_1103020_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_139903907.1|1103142_1104066_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_139903908.1|1104503_1105928_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.5	1.2e-52
WP_139903911.1|1106339_1107224_+	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_139903913.1|1107220_1108558_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	34.0	2.6e-46
WP_139903914.1|1108563_1109517_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	35.8	3.2e-46
WP_139903916.1|1109527_1110832_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_139903918.1|1110904_1111189_+	Dabb family protein	NA	NA	NA	NA	NA
WP_139903920.1|1111421_1112396_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_139903921.1|1112538_1113849_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_139906289.1|1114271_1117913_+	DNA polymerase III subunit alpha	NA	A0A291AVG1	Streptomyces_phage	36.2	8.3e-212
WP_139903923.1|1118306_1119266_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_139903925.1|1119293_1121048_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_139903927.1|1121102_1122221_+	anion transporter	NA	NA	NA	NA	NA
WP_139903929.1|1122478_1123549_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_139903932.1|1123769_1124129_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_139903933.1|1124322_1125684_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	45.8	3.3e-113
1124880:1124896	attL	TTATGATGAAGAGTCTG	NA	NA	NA	NA
WP_139903936.1|1125969_1126575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139903937.1|1126574_1127468_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_139903939.1|1127559_1128420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139903940.1|1128730_1129471_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_139902291.1|1129610_1129919_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_139902289.1|1129912_1130269_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	48.4	1.7e-21
WP_139903941.1|1130409_1132044_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.5	5.1e-60
WP_139903942.1|1132987_1134088_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_139903943.1|1134818_1135046_+	helix-turn-helix domain-containing protein	NA	A0A1P8BML9	Lactococcus_phage	42.9	3.9e-11
WP_139903944.1|1135038_1135632_+	site-specific DNA-methyltransferase	NA	I7KLR2	Campylobacter_virus	48.8	4.5e-14
WP_139903945.1|1135662_1136460_-	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	25.0	4.6e-06
WP_139903946.1|1136461_1137838_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_139903947.1|1137930_1138560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139903948.1|1138606_1139134_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_139906290.1|1139257_1140805_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.8	1.7e-17
1140562:1140578	attR	TTATGATGAAGAGTCTG	NA	NA	NA	NA
>prophage 5
NZ_CP040924	Clostridium sp. SYSU GA15002T chromosome, complete genome	3805212	1144119	1194415	3805212	terminase,transposase,tail,holin,head,protease,capsid,portal	Erysipelothrix_phage(69.05%)	58	NA	NA
WP_139903953.1|1144119_1144449_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_139903954.1|1144421_1145375_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	30.0	4.2e-14
WP_139903955.1|1145451_1145739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139903956.1|1146052_1146973_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	34.7	2.9e-44
WP_139903957.1|1147000_1147420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011838176.1|1148206_1148860_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_139903958.1|1148870_1150223_-	Trk family potassium uptake protein	NA	NA	NA	NA	NA
WP_139903959.1|1150499_1150706_-	helix-turn-helix domain-containing protein	NA	A0A2K5B261	Erysipelothrix_phage	75.0	3.2e-20
WP_139903960.1|1150865_1152785_+	hypothetical protein	NA	E4ZFJ9	Streptococcus_phage	35.1	1.2e-105
WP_139903961.1|1153006_1153189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139903962.1|1153155_1154514_+	DEAD/DEAH box helicase family protein	NA	I3VYY6	Thermoanaerobacterium_phage	50.1	7.4e-113
WP_139903963.1|1154479_1154920_+	hypothetical protein	NA	I3VYY4	Thermoanaerobacterium_phage	53.1	2.7e-32
WP_139903964.1|1155027_1155780_+	hypothetical protein	NA	I3VYY1	Thermoanaerobacterium_phage	42.8	1.7e-47
WP_139903965.1|1155837_1157760_+	bifunctional 3'-5' exonuclease/DNA polymerase	NA	A0A142F1Q9	Bacillus_phage	28.7	2.8e-49
WP_139903966.1|1157764_1158553_+	BRO family protein	NA	A0A1Q1PVZ8	Staphylococcus_phage	50.8	2.4e-71
WP_139903967.1|1158568_1158994_+	DUF4406 domain-containing protein	NA	A0A2K5B270	Erysipelothrix_phage	62.4	2.9e-47
WP_139903968.1|1158990_1161546_+	DNA primase	NA	Q9T0Y1	Lactobacillus_phage	37.6	6.5e-46
WP_139903969.1|1161846_1162146_+	VRR-NUC domain-containing protein	NA	I3VYX6	Thermoanaerobacterium_phage	61.8	7.4e-26
WP_139903970.1|1162239_1162695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139903971.1|1162913_1163324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139903972.1|1163355_1164354_+	DUF4065 domain-containing protein	NA	A0A0N9SGM1	Paenibacillus_phage	37.1	4.7e-16
WP_139903973.1|1164497_1164728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139903974.1|1164861_1165221_+	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	61.2	2.3e-37
WP_003515999.1|1165341_1165893_+|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	68.1	3.1e-70
WP_015051383.1|1165892_1166075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139903975.1|1166049_1167348_+	ParB N-terminal domain-containing protein	NA	A0A2I4R670	Erysipelothrix_phage	40.5	3.6e-77
WP_139903976.1|1167353_1168607_+	ParB N-terminal domain-containing protein	NA	A0A2I4R670	Erysipelothrix_phage	46.3	5.0e-100
WP_013782364.1|1168723_1169416_+	virulence factor	NA	A0A2K5B280	Erysipelothrix_phage	35.2	6.3e-28
WP_013782363.1|1169408_1169744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013782362.1|1169740_1169971_+	DUF4314 domain-containing protein	NA	NA	NA	NA	NA
WP_139903977.1|1170112_1171012_+	amidoligase	NA	A0A2K9V489	Faecalibacterium_phage	41.1	1.1e-53
WP_023062547.1|1171073_1171541_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_093751262.1|1171557_1171707_+	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_139903978.1|1171761_1173414_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	76.8	2.5e-248
WP_013782358.1|1173410_1174733_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	75.2	1.4e-188
WP_013782357.1|1174671_1175397_+|protease	Clp protease ClpP	protease	A0A2K5B288	Erysipelothrix_phage	64.1	1.1e-75
WP_028992638.1|1175410_1176613_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	78.2	4.9e-177
WP_004400079.1|1176634_1176943_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	75.5	3.0e-38
WP_028992640.1|1176945_1177281_+|head,tail	head-tail adaptor protein	head,tail	A0A2K5B291	Erysipelothrix_phage	56.9	1.8e-28
WP_074665367.1|1177297_1177729_+	HK97 gp10 family phage protein	NA	A0A2K5B292	Erysipelothrix_phage	61.5	4.6e-45
WP_003516028.1|1177725_1178070_+	hypothetical protein	NA	A0A2K5B293	Erysipelothrix_phage	55.9	2.0e-30
WP_013782353.1|1178075_1178675_+|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	74.2	6.8e-79
WP_003516030.1|1178674_1179058_+	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	68.8	8.9e-40
WP_003520671.1|1179054_1179246_+	hypothetical protein	NA	A0A2K5B296	Erysipelothrix_phage	75.6	3.9e-12
WP_013782352.1|1179273_1181460_+	hypothetical protein	NA	A0A2K5B297	Erysipelothrix_phage	41.2	1.1e-12
WP_013782351.1|1181473_1182247_+|tail	phage tail family protein	tail	A0A2I4R672	Erysipelothrix_phage	51.2	7.2e-73
WP_013782350.1|1182251_1184774_+	hypothetical protein	NA	A0A2K5B298	Erysipelothrix_phage	63.5	0.0e+00
WP_003520677.1|1184784_1184979_+	hypothetical protein	NA	A0A2K5B299	Erysipelothrix_phage	66.2	2.2e-18
WP_003868535.1|1184988_1185564_+	hypothetical protein	NA	A0A2K5B2A0	Erysipelothrix_phage	53.4	3.6e-53
WP_013782349.1|1185560_1188029_+	glycosyl hydrolase	NA	A0A2K5B2A1	Erysipelothrix_phage	68.6	0.0e+00
WP_004400092.1|1188115_1188535_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	69.1	4.6e-50
WP_139903979.1|1188531_1189536_+	LysM peptidoglycan-binding domain-containing protein	NA	H7BV89	unidentified_phage	66.0	1.0e-10
WP_013782347.1|1189589_1189808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013782346.1|1189869_1191438_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	52.9	2.4e-152
WP_083809929.1|1191401_1191893_+	recombinase	NA	A0A2K5B2B3	Erysipelothrix_phage	40.9	1.2e-20
WP_013782344.1|1191855_1193424_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	57.7	5.8e-170
WP_028306869.1|1193577_1193724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005584884.1|1194040_1194415_+	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	40.2	7.4e-15
>prophage 6
NZ_CP040924	Clostridium sp. SYSU GA15002T chromosome, complete genome	3805212	1206264	1254147	3805212	terminase,transposase,tail,holin,head,integrase,protease,capsid,portal	Erysipelothrix_phage(45.71%)	50	1193950:1193965	1254939:1254954
1193950:1193965	attL	TGTTTTTATTGACAAA	NA	NA	NA	NA
WP_085333717.1|1206264_1206483_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	51.5	3.8e-11
WP_139903983.1|1207538_1207757_+	hypothetical protein	NA	A0A2I4R673	Erysipelothrix_phage	61.1	2.6e-20
WP_139903984.1|1207731_1208055_+	rRNA biogenesis protein rrp5	NA	A0A2K5B2A7	Erysipelothrix_phage	56.6	7.8e-21
WP_139903985.1|1208047_1209196_+	DUF2800 domain-containing protein	NA	A0A2K5B2A8	Erysipelothrix_phage	79.3	4.2e-178
WP_139903986.1|1209188_1209737_+	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	89.5	5.4e-91
WP_139903987.1|1209817_1211758_+	hypothetical protein	NA	A0A2K5B2B0	Erysipelothrix_phage	74.6	1.2e-297
WP_139903988.1|1211852_1212605_+	phage antirepressor Ant	NA	A0A0C5AFE7	Paenibacillus_phage	53.9	3.9e-63
WP_139903989.1|1212604_1213039_+	DUF4406 domain-containing protein	NA	A0A2K5B270	Erysipelothrix_phage	75.0	3.9e-60
WP_139903990.1|1213035_1215402_+	hypothetical protein	NA	A0A1W6JQ82	Corynebacterium_phage	52.0	2.7e-243
WP_139903991.1|1215620_1215902_+	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	68.9	9.7e-28
WP_139903992.1|1215882_1217232_+	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	76.9	4.8e-181
WP_139906292.1|1217239_1217674_+	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_139903993.1|1217768_1218122_+	HNH endonuclease	NA	A0A1X9I6D0	Streptococcus_phage	55.5	2.9e-37
WP_139903994.1|1218356_1219604_+	ParB N-terminal domain-containing protein	NA	Q6DMV0	Streptococcus_phage	55.1	7.7e-125
WP_139903995.1|1219711_1220584_+	virulence-related protein	NA	NA	NA	NA	NA
WP_139903996.1|1220584_1220791_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_139903997.1|1220854_1221325_+|terminase	phage terminase small subunit P27 family	terminase	Q6DMU4	Streptococcus_phage	72.4	1.9e-60
WP_139903998.1|1221325_1222873_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	71.8	3.9e-227
WP_139903999.1|1222909_1223482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139904000.1|1223459_1224401_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_139906293.1|1224529_1225753_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	72.2	1.6e-175
WP_139904001.1|1225755_1226442_+|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	65.3	6.2e-76
WP_139904002.1|1226455_1227646_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	76.6	4.7e-172
WP_139906294.1|1227659_1227884_+	Head fiber protein	NA	NA	NA	NA	NA
WP_139904003.1|1227898_1228177_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0RXE3	Streptococcus_phage	38.2	8.5e-08
WP_139904004.1|1228176_1228503_+|head	phage head closure protein	head	A6M954	Geobacillus_virus	37.9	9.3e-14
WP_139904005.1|1228495_1228894_+	hypothetical protein	NA	A0A2H4J368	uncultured_Caudovirales_phage	32.6	1.1e-13
WP_139904006.1|1228886_1229222_+	hypothetical protein	NA	E2ELJ0	Clostridium_phage	39.8	6.2e-13
WP_139904007.1|1229222_1229795_+|tail	phage tail protein	tail	A0A1L2BYA0	Clostridium_phage	58.9	2.1e-53
WP_139904008.1|1229812_1230136_+	hypothetical protein	NA	A0A2I7SBZ1	Paenibacillus_phage	31.6	6.0e-05
WP_139904009.1|1230333_1232910_+|tail	phage tail tape measure protein	tail	G4KNQ9	Staphylococcus_phage	32.9	1.2e-50
WP_139904010.1|1232909_1233617_+|tail	phage tail protein	tail	A0A0A7RWN1	Clostridium_phage	34.0	5.1e-33
WP_139904011.1|1233616_1235521_+	hypothetical protein	NA	A0A0A7RUI9	Clostridium_phage	41.9	2.0e-52
WP_139904012.1|1235532_1236702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139904013.1|1236716_1238396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139904014.1|1238412_1238817_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	54.5	1.5e-37
WP_139904015.1|1238813_1239518_+	amidase	NA	H7BVK7	unidentified_phage	41.9	2.0e-45
WP_139904016.1|1239641_1239878_+	hypothetical protein	NA	A0A2K5B2B1	Erysipelothrix_phage	44.6	4.4e-05
WP_139904017.1|1239939_1241496_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	50.9	4.6e-151
WP_139904018.1|1241500_1241932_+	recombinase	NA	A0A2K5B2B3	Erysipelothrix_phage	46.0	1.1e-27
WP_139904019.1|1241918_1243487_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	61.2	6.2e-172
WP_139904020.1|1243630_1243864_+	DUF1413 domain-containing protein	NA	NA	NA	NA	NA
WP_139904021.1|1243886_1247543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139903751.1|1248102_1248438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139903753.1|1248431_1248782_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_139903755.1|1248873_1250487_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	30.9	2.2e-55
WP_139904022.1|1250517_1251111_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_139903940.1|1251289_1252030_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_139904023.1|1252019_1252436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139904024.1|1252512_1254147_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.7	1.3e-60
1254939:1254954	attR	TTTGTCAATAAAAACA	NA	NA	NA	NA
>prophage 7
NZ_CP040924	Clostridium sp. SYSU GA15002T chromosome, complete genome	3805212	1543114	1551428	3805212		uncultured_Mediterranean_phage(50.0%)	9	NA	NA
WP_139904288.1|1543114_1543927_+	sporulation transcription factor Spo0A	NA	W8CYM9	Bacillus_phage	32.5	2.9e-08
WP_139904289.1|1544299_1544947_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_139904290.1|1545255_1546137_+	tyrosine recombinase	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	24.7	5.1e-14
WP_139904291.1|1546251_1547421_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	33.9	2.6e-34
WP_139904292.1|1547726_1548518_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	28.5	1.3e-08
WP_139904293.1|1548468_1549083_+	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.7	9.6e-20
WP_139904294.1|1549150_1549585_-	sporulation protein YtfJ	NA	NA	NA	NA	NA
WP_139904295.1|1549619_1550126_-	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_139904296.1|1550309_1551428_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	30.0	9.3e-29
>prophage 8
NZ_CP040924	Clostridium sp. SYSU GA15002T chromosome, complete genome	3805212	1926464	1940828	3805212		Cyanophage(22.22%)	11	NA	NA
WP_139904622.1|1926464_1927205_-	glucose 1-dehydrogenase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.9	2.4e-17
WP_139904623.1|1927317_1928568_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_139904624.1|1928581_1930084_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	45.8	6.5e-62
WP_139904625.1|1930095_1930704_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.7	3.6e-19
WP_139904626.1|1930691_1931690_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A127KMF9	Cyanophage	47.1	3.7e-69
WP_139904627.1|1931698_1933105_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.5	1.5e-60
WP_139904628.1|1933120_1933831_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	41.0	1.8e-41
WP_139904629.1|1933830_1934310_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	47.7	2.0e-28
WP_139904630.1|1934323_1938094_-	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.9	2.2e-42
WP_139904631.1|1938367_1939690_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_139904632.1|1939892_1940828_-	SPFH/Band 7/PHB domain protein	NA	A0A2K9KZA2	Tupanvirus	33.1	1.4e-22
>prophage 9
NZ_CP040924	Clostridium sp. SYSU GA15002T chromosome, complete genome	3805212	2169314	2179780	3805212	transposase	Geobacillus_virus(12.5%)	15	NA	NA
WP_139904801.1|2169314_2170178_-	hypothetical protein	NA	A6M985	Geobacillus_virus	47.2	4.6e-28
WP_139904802.1|2170394_2170565_+	YvrJ family protein	NA	NA	NA	NA	NA
WP_139904803.1|2170587_2170881_+	DUF1659 domain-containing protein	NA	NA	NA	NA	NA
WP_139904804.1|2170919_2171138_+	DUF2922 family protein	NA	NA	NA	NA	NA
WP_139904805.1|2171194_2171767_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_139906434.1|2171791_2172511_-	ATP-binding protein	NA	Q0H276	Geobacillus_phage	37.6	4.2e-35
WP_139904806.1|2172476_2173409_-	DnaD domain protein	NA	D2XR43	Bacillus_phage	37.0	5.5e-43
WP_139904807.1|2173395_2174535_-	hypothetical protein	NA	S4TZY3	uncultured_phage	29.3	1.6e-28
WP_139904808.1|2174591_2175371_-	AAA family ATPase	NA	A0A1L2K2K3	Aeribacillus_phage	46.8	2.1e-59
WP_139904809.1|2175593_2176049_+	helix-turn-helix domain-containing protein	NA	A0A090D830	Clostridium_phage	42.0	1.4e-12
WP_139904810.1|2176207_2176393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139906435.1|2176595_2176838_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_139904811.1|2176993_2177674_-	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
WP_139904812.1|2178098_2179016_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1L2BX38	Bacteriophage	39.2	2.1e-55
WP_139904813.1|2179012_2179780_-	site-specific DNA-methyltransferase	NA	A0A249XUJ2	Enterococcus_phage	33.0	2.4e-28
>prophage 10
NZ_CP040924	Clostridium sp. SYSU GA15002T chromosome, complete genome	3805212	2373571	2389527	3805212	transposase	Escherichia_phage(50.0%)	12	NA	NA
WP_139903760.1|2373571_2374879_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_139904952.1|2375059_2375335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139904953.1|2375312_2376470_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_139904954.1|2376876_2377944_-	EamA family transporter	NA	NA	NA	NA	NA
WP_139904955.1|2377958_2378231_-	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_139903735.1|2378948_2380175_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_139904956.1|2380422_2381142_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	41.3	1.0e-36
WP_139904957.1|2381141_2382644_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_139904958.1|2383382_2384384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139904960.1|2384441_2387726_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	25.5	4.2e-61
WP_139906446.1|2387738_2387990_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_139903735.1|2388300_2389527_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP040924	Clostridium sp. SYSU GA15002T chromosome, complete genome	3805212	2815421	2854066	3805212	tRNA,transposase,protease	Micromonas_pusilla_virus(20.0%)	36	NA	NA
WP_139905385.1|2815421_2817161_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	39.8	1.7e-98
WP_139905386.1|2817260_2818277_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_139905387.1|2818291_2819350_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_139905388.1|2819497_2821294_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_139905389.1|2821341_2821746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905390.1|2821833_2822151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139905391.1|2822143_2822569_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_139905392.1|2822759_2823314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905393.1|2823580_2824822_+	diphosphate--fructose-6-phosphate 1-phosphotransferase	NA	NA	NA	NA	NA
WP_139905394.1|2824979_2827067_-	sodium-translocating pyrophosphatase	NA	NA	NA	NA	NA
WP_139905395.1|2827576_2828242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139905396.1|2828365_2829664_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_139905397.1|2830023_2830689_+	DUF4397 domain-containing protein	NA	NA	NA	NA	NA
WP_139905398.1|2830809_2831736_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_139905399.1|2831939_2832248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905400.1|2832636_2832933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905401.1|2833209_2833854_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_139905402.1|2834034_2835180_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_139905403.1|2835179_2836298_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_139905404.1|2837346_2837979_-	response regulator	NA	W8CYM9	Bacillus_phage	30.4	6.2e-06
WP_139905405.1|2837994_2839104_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_139905406.1|2839132_2839780_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_139905407.1|2839776_2840790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905408.1|2841223_2841637_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_139905409.1|2841687_2842941_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_139905410.1|2842903_2843974_+	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_139905411.1|2844183_2844558_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_139905412.1|2844720_2845482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905413.1|2845791_2846124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905414.1|2846249_2846582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905415.1|2846609_2846966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905416.1|2847100_2847499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905417.1|2847601_2848207_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_139905418.1|2848206_2850531_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.5	2.4e-180
WP_139905419.1|2850737_2852420_-|protease	ATP-dependent protease LonB	protease	A0A0G2YAM1	Acanthamoeba_polyphaga_mimivirus	30.2	2.8e-13
WP_139905420.1|2852776_2854066_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.4	2.2e-143
>prophage 12
NZ_CP040924	Clostridium sp. SYSU GA15002T chromosome, complete genome	3805212	2909206	2938732	3805212	transposase,protease,integrase	Oenococcus_phage(20.0%)	29	2917660:2917675	2931998:2932013
WP_139905463.1|2909206_2910517_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_139905464.1|2910945_2912331_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_139905465.1|2912420_2912924_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_139905466.1|2913167_2913605_-	DNA mismatch endonuclease Vsr	NA	V5UTF4	Oenococcus_phage	54.5	6.8e-28
WP_139905467.1|2914048_2914450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905468.1|2914462_2914759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905469.1|2914985_2915366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905470.1|2915394_2915874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905471.1|2915977_2916613_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	49.2	1.8e-05
WP_139905472.1|2916698_2917433_-	hypothetical protein	NA	NA	NA	NA	NA
2917660:2917675	attL	TCAAAATTATATTTTT	NA	NA	NA	NA
WP_139904066.1|2922049_2923345_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_139905473.1|2923583_2924183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139905474.1|2924275_2925652_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_139905475.1|2925653_2926451_+	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	25.0	1.0e-05
WP_139905476.1|2927064_2929755_-	DUF927 domain-containing protein	NA	I3VYX9	Thermoanaerobacterium_phage	33.5	7.8e-90
WP_139905477.1|2929786_2930032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905478.1|2930076_2930292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905479.1|2930768_2931629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139903937.1|2931720_2932614_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
2931998:2932013	attR	TCAAAATTATATTTTT	NA	NA	NA	NA
WP_139905480.1|2932613_2933219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905481.1|2933619_2933805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905482.1|2933940_2934396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139906462.1|2934416_2934752_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_139905483.1|2934864_2935029_+	YvrJ family protein	NA	NA	NA	NA	NA
WP_139905484.1|2935082_2935274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905485.1|2935505_2935760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139905486.1|2935945_2937172_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	54.3	1.3e-55
WP_139905487.1|2938130_2938298_-	DUF3368 domain-containing protein	NA	NA	NA	NA	NA
WP_139905488.1|2938264_2938732_-|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
>prophage 13
NZ_CP040924	Clostridium sp. SYSU GA15002T chromosome, complete genome	3805212	3048042	3113335	3805212	terminase,transposase,capsid,portal,holin,protease,integrase,plate	Clostridium_phage(27.78%)	62	3037705:3037734	3051449:3051478
3037705:3037734	attL	CATTAGTGATAATCTTCTTTTTTTCATTTT	NA	NA	NA	NA
WP_139905569.1|3048042_3049461_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	34.3	1.8e-05
WP_139905570.1|3049846_3051475_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_139905571.1|3053568_3054201_+	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
3051449:3051478	attR	CATTAGTGATAATCTTCTTTTTTTCATTTT	NA	NA	NA	NA
WP_139905572.1|3054296_3055199_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_139905573.1|3055195_3056455_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_139905574.1|3056702_3056894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905575.1|3057155_3057350_-	small, acid-soluble spore protein, alpha/beta type	NA	NA	NA	NA	NA
WP_139905576.1|3057472_3058336_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_139905577.1|3058347_3059247_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_139905578.1|3059444_3060812_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_139905579.1|3060953_3062267_-	response regulator	NA	NA	NA	NA	NA
WP_139905580.1|3062259_3064071_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_139905581.1|3064067_3065363_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_139905582.1|3065506_3066838_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_139905583.1|3067061_3069368_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_139905584.1|3069596_3069947_-	DUF2200 family protein	NA	NA	NA	NA	NA
WP_139906468.1|3070135_3070240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905585.1|3070233_3070548_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.7	3.4e-05
WP_139905586.1|3070661_3071813_-	flagellar protein FliB	NA	NA	NA	NA	NA
WP_139905587.1|3071907_3072171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905588.1|3072510_3073359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905589.1|3073345_3074599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905590.1|3074715_3075456_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.1	2.8e-34
WP_139905591.1|3075472_3076156_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_139905592.1|3076168_3076987_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_139905593.1|3078887_3079196_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_139905594.1|3079285_3080485_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_139905595.1|3080788_3081865_+	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_139905596.1|3081810_3082953_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_139905597.1|3082965_3084432_+	spore germination protein	NA	NA	NA	NA	NA
WP_139905598.1|3084616_3085354_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	40.9	1.1e-35
WP_139905599.1|3088776_3088974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905600.1|3088994_3089369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905601.1|3089670_3090258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905602.1|3090241_3091036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905603.1|3091025_3091583_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_139905604.1|3091924_3092782_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_139905605.1|3093210_3093636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905606.1|3093743_3094448_-	N-acetylmuramoyl-L-alanine amidase	NA	H7BVK7	unidentified_phage	35.2	8.1e-23
WP_139905607.1|3094450_3094861_-|holin	phage holin family protein	holin	A0A0A7RTU1	Clostridium_phage	56.2	1.3e-33
WP_139905608.1|3095047_3095716_-	acyltransferase	NA	NA	NA	NA	NA
WP_139905609.1|3095780_3098102_-|plate	BppU family phage baseplate upper protein	plate	NA	NA	NA	NA
WP_139905610.1|3098083_3098647_-	hypothetical protein	NA	M1IEW5	Bacillus_virus	39.0	2.5e-06
WP_139905611.1|3098643_3099762_-	hypothetical protein	NA	A0A2I7QIN8	Bacillus_phage	48.0	1.1e-98
WP_139905612.1|3099762_3101463_-	DNRLRE domain-containing protein	NA	A0A2H4JAI8	uncultured_Caudovirales_phage	29.9	1.4e-68
WP_139905613.1|3101462_3103145_-	hypothetical protein	NA	A0A2K5B297	Erysipelothrix_phage	48.6	5.0e-10
WP_139905614.1|3103322_3103721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905615.1|3103769_3104345_-	hypothetical protein	NA	A0A2K5B294	Erysipelothrix_phage	38.0	2.2e-18
WP_139905616.1|3104357_3104849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905617.1|3104814_3105141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905618.1|3105127_3105484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905619.1|3105452_3105764_-	hypothetical protein	NA	Q8W603	Listeria_phage	43.0	5.7e-13
WP_139905620.1|3105947_3107129_-|capsid	phage major capsid protein	capsid	R4IBU5	Listeria_phage	42.0	3.0e-70
WP_139905621.1|3107155_3107881_-|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	47.2	4.4e-40
WP_139906469.1|3107877_3109023_-|portal	phage portal protein	portal	E2ELI3	Clostridium_phage	36.4	1.7e-70
WP_139905622.1|3109055_3110726_-|terminase	terminase large subunit	terminase	E2ELI2	Clostridium_phage	42.2	3.9e-116
WP_139905623.1|3110706_3111027_-|terminase	P27 family phage terminase small subunit	terminase	E2ELI1	Clostridium_phage	55.0	3.3e-24
WP_139905624.1|3111134_3111407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905625.1|3111409_3111763_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_139905626.1|3111765_3111984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905627.1|3112033_3112360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905628.1|3112825_3113335_-	helix-turn-helix domain-containing protein	NA	I2E8Y5	Clostridium_phage	42.5	1.2e-28
>prophage 14
NZ_CP040924	Clostridium sp. SYSU GA15002T chromosome, complete genome	3805212	3117732	3126423	3805212		Clostridium_phage(71.43%)	14	NA	NA
WP_139905638.1|3117732_3117954_-	hypothetical protein	NA	Q4ZC86	Staphylococcus_virus	38.0	3.1e-05
WP_139905639.1|3117981_3118161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905640.1|3118471_3119305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905641.1|3119317_3119698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905642.1|3119691_3120120_-	DUF1064 domain-containing protein	NA	A0A0A7RTV9	Clostridium_phage	67.6	3.8e-47
WP_139905643.1|3120272_3121604_-	replicative DNA helicase	NA	Q8SBL9	Clostridium_phage	39.0	1.3e-77
WP_139905644.1|3121616_3122354_-	DnaD domain protein	NA	A0A0A7RTY6	Clostridium_phage	51.6	3.2e-38
WP_139905645.1|3122364_3123162_-	recombinase RecT	NA	A0A0A7RW37	Clostridium_phage	84.0	2.8e-128
WP_139905646.1|3123164_3124076_-	hypothetical protein	NA	A0A0A7RWR9	Clostridium_phage	69.7	1.1e-120
WP_139905647.1|3124078_3124357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905648.1|3124431_3124614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905649.1|3124719_3124818_-	Spo0E family sporulation regulatory protein-aspartic acid phosphatase	NA	NA	NA	NA	NA
WP_139905650.1|3125087_3125453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905651.1|3125688_3126423_-	hypothetical protein	NA	S5MP04	Brevibacillus_phage	40.5	4.1e-41
>prophage 15
NZ_CP040924	Clostridium sp. SYSU GA15002T chromosome, complete genome	3805212	3145067	3152276	3805212	protease	Clostridium_phage(33.33%)	7	NA	NA
WP_139905670.1|3145067_3146243_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	70.2	9.7e-154
WP_139905671.1|3147246_3147861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139905672.1|3147970_3148513_+|protease	spore protease YyaC	protease	A0A0A8WIQ6	Clostridium_phage	34.9	3.0e-25
WP_139905673.1|3148655_3149672_-	MreB/Mrl family cell shape determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	25.1	3.1e-07
WP_139905674.1|3149761_3150016_-	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	60.0	2.0e-19
WP_139905675.1|3150200_3150983_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	29.0	5.0e-05
WP_139905676.1|3151217_3152276_-	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	33.3	3.9e-29
>prophage 16
NZ_CP040924	Clostridium sp. SYSU GA15002T chromosome, complete genome	3805212	3517467	3527356	3805212		Bacillus_phage(57.14%)	9	NA	NA
WP_139906002.1|3517467_3518349_-	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	45.0	1.7e-54
WP_139906003.1|3518421_3518883_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	37.4	1.5e-17
WP_139906004.1|3518887_3519910_-	NADPH dehydrogenase NamA	NA	NA	NA	NA	NA
WP_139906005.1|3520065_3520755_+	response regulator	NA	W8CYM9	Bacillus_phage	35.0	1.8e-35
WP_139906006.1|3520747_3522217_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	29.7	7.9e-28
WP_139906007.1|3522309_3523236_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_139906008.1|3523665_3524460_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	45.4	6.3e-64
WP_139906009.1|3524459_3524966_+	dihydrofolate reductase	NA	A0A0A0RMX1	Bacillus_phage	38.6	4.5e-23
WP_139906010.1|3525067_3527356_-	AAA domain-containing protein	NA	A0A223W0B1	Agrobacterium_phage	40.7	1.6e-123
