The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040067	Escherichia coli strain A1_181 chromosome, complete genome	4778240	283254	323816	4778240	transposase,integrase	Bacillus_phage(33.33%)	33	271707:271721	298273:298287
271707:271721	attL	ATTGATAAAGCAATC	NA	NA	NA	NA
WP_000090707.1|283254_284097_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_085947771.1|284567_285729_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_099975594.1|285848_287468_+|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
WP_001049180.1|287467_288916_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001324699.1|288956_290513_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000262420.1|290524_291451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097216.1|291803_292103_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_089455121.1|292666_294316_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000080195.1|294302_295916_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|295946_296297_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|296293_296719_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000647571.1|297201_297552_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
WP_000790485.1|297698_298130_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_001377740.1|298374_299856_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
298273:298287	attR	ATTGATAAAGCAATC	NA	NA	NA	NA
WP_000697968.1|299848_300529_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000475506.1|300718_302104_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246155.1|302131_302485_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000157620.1|302598_303891_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_000574029.1|303901_307048_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
WP_000758224.1|307134_307575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001353604.1|307701_310149_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.3	1.3e-83
WP_000843494.1|310189_310387_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000287501.1|310420_311158_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
WP_001023257.1|311446_311896_-	copper resistance protein	NA	NA	NA	NA	NA
WP_001378117.1|312130_313948_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|313947_314844_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|314883_315264_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_000998778.1|315268_316198_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|316252_316933_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_001211180.1|316929_318330_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_000723069.1|318547_318982_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_001028905.1|319640_320693_-	DUF2776 domain-containing protein	NA	NA	NA	NA	NA
WP_085947917.1|322542_323816_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 2
NZ_CP040067	Escherichia coli strain A1_181 chromosome, complete genome	4778240	1166911	1174852	4778240		uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_001374723.1|1166911_1167673_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
WP_000254708.1|1167666_1168293_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1168432_1169572_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1169634_1170627_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104456.1|1170720_1172085_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1172173_1172950_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1172954_1173593_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1173589_1174852_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
>prophage 3
NZ_CP040067	Escherichia coli strain A1_181 chromosome, complete genome	4778240	1790675	1800117	4778240		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569361.1|1790675_1791602_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1791606_1792338_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1792318_1792426_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1792485_1793217_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1793438_1795124_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1795120_1795840_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1795886_1796357_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1796397_1796859_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_089455097.1|1796983_1798984_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292773.1|1798980_1800117_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 4
NZ_CP040067	Escherichia coli strain A1_181 chromosome, complete genome	4778240	2315755	2339536	4778240	tail,lysis,integrase	Enterobacteria_phage(26.32%)	27	2311998:2312012	2335776:2335790
2311998:2312012	attL	CGCCGTCGCGGATTG	NA	NA	NA	NA
WP_000598292.1|2315755_2316082_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2316287_2317502_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836058.1|2317513_2318533_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2318590_2318701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877001.1|2318720_2320001_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001296941.1|2320035_2320272_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001372999.1|2320359_2322831_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
WP_001083281.1|2322924_2323116_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2323112_2323301_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_072163420.1|2323384_2323627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054501.1|2323607_2324573_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_001373616.1|2324613_2325036_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
WP_001678528.1|2325165_2326110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001678529.1|2326657_2328007_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
WP_023147793.1|2328324_2328927_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
WP_023147794.1|2329286_2330267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032181055.1|2330471_2330780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|2330786_2330894_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013632.1|2330938_2331151_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
WP_000980999.1|2331366_2331618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|2331684_2331963_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_001373319.1|2331964_2333014_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.2e-108
WP_000904112.1|2333026_2333401_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762889.1|2333397_2334219_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.7e-78
WP_001373320.1|2334964_2337127_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	96.6	0.0e+00
2335776:2335790	attR	CGCCGTCGCGGATTG	NA	NA	NA	NA
WP_032181053.1|2337958_2339356_+	chaperone of endosialidase	NA	K7PGT9	Enterobacteria_phage	85.2	1.4e-204
WP_072163404.1|2339410_2339536_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	82.5	1.5e-12
>prophage 5
NZ_CP040067	Escherichia coli strain A1_181 chromosome, complete genome	4778240	2740949	2751727	4778240	integrase	Enterobacteria_phage(40.0%)	11	2738922:2738945	2750430:2750453
2738922:2738945	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
WP_000379042.1|2740949_2742905_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
WP_001753331.1|2745269_2745809_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_072163463.1|2745991_2746303_+	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
WP_001372461.1|2746299_2746980_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
WP_000149533.1|2746976_2747135_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_001678641.1|2747131_2748196_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
WP_001678640.1|2748349_2748568_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
WP_000488406.1|2748615_2748855_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|2748994_2749231_+	excisionase	NA	NA	NA	NA	NA
WP_000741339.1|2749220_2750363_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	99.7	8.1e-206
WP_000444487.1|2750476_2751727_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2750430:2750453	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 6
NZ_CP040067	Escherichia coli strain A1_181 chromosome, complete genome	4778240	3077179	3085949	4778240	integrase	Salmonella_phage(90.0%)	12	3076849:3076862	3085991:3086004
3076849:3076862	attL	AAAACAATAAGTTA	NA	NA	NA	NA
WP_001376441.1|3077179_3077368_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
WP_089455086.1|3077526_3079920_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.5	0.0e+00
WP_001544405.1|3079916_3080774_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
WP_000752610.1|3080770_3080998_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001244224.1|3080997_3081231_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000996717.1|3081298_3081640_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956192.1|3081757_3082054_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000460892.1|3082061_3082571_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|3082603_3082825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680871.1|3082970_3083849_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.7e-30
WP_001678408.1|3083860_3084805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372563.1|3084896_3085949_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
3085991:3086004	attR	TAACTTATTGTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP040067	Escherichia coli strain A1_181 chromosome, complete genome	4778240	3165532	3192736	4778240	tail,integrase,capsid,lysis	Enterobacteria_phage(47.06%)	46	3167448:3167462	3192810:3192824
WP_001356070.1|3165532_3166822_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
WP_000767389.1|3166880_3167357_+	kinase inhibitor	NA	NA	NA	NA	NA
3167448:3167462	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001753290.1|3168102_3169434_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_072163407.1|3169507_3169684_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.5	9.4e-21
WP_000239881.1|3169833_3170502_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_072035100.1|3170446_3170584_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
WP_001372490.1|3171392_3171953_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
WP_000105084.1|3172341_3172575_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|3172631_3173042_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|3173393_3173546_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001228702.1|3173574_3173781_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001372488.1|3173997_3174495_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
WP_000839582.1|3174494_3174710_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_000592543.1|3175979_3176939_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|3177131_3177656_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|3177811_3178189_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971068.1|3178274_3178415_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001372483.1|3178411_3178774_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
WP_001372487.1|3178770_3179061_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
WP_000224914.1|3179053_3179224_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001372486.1|3179223_3179679_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072157016.1|3179675_3179777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|3179869_3180322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720581.1|3180318_3180879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001403556.1|3181135_3181327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000145917.1|3181363_3181657_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001372464.1|3181653_3182355_-	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_001415152.1|3182351_3183281_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.2e-109
WP_001182899.1|3183367_3183907_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067458.1|3183976_3184207_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|3184311_3185001_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000389051.1|3185123_3185873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210934.1|3185869_3186697_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000233576.1|3187205_3187412_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|3187487_3187784_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3187789_3188575_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_001372450.1|3188571_3189252_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_072126246.1|3189248_3189431_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_023148020.1|3189403_3189595_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_001395510.1|3189605_3189887_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763365.1|3189985_3190207_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_000120065.1|3190417_3191020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525073.1|3191144_3191330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|3191262_3191430_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|3191469_3191688_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|3191665_3192736_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3192810:3192824	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 8
NZ_CP040067	Escherichia coli strain A1_181 chromosome, complete genome	4778240	3920667	4021739	4778240	tRNA,portal,protease,integrase,terminase,tail,lysis	Escherichia_phage(33.33%)	102	3995400:3995414	4022524:4022538
WP_001286857.1|3920667_3923484_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
WP_000767329.1|3923526_3924468_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_001295417.1|3924475_3924694_-	DUF2575 family protein	NA	NA	NA	NA	NA
WP_001274021.1|3924796_3925060_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000062888.1|3929551_3930457_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_000681360.1|3930516_3931683_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
WP_000935262.1|3932211_3932421_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001118464.1|3932524_3933655_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516131.1|3933743_3935660_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	9.0e-149
WP_000843559.1|3936036_3936441_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102383.1|3936466_3937180_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|3937328_3937895_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094682.1|3937929_3938517_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130185.1|3938631_3939585_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001112597.1|3939863_3941294_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000906183.1|3941363_3942140_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_000738723.1|3942292_3942589_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000781063.1|3942802_3944089_-	threonine synthase	NA	NA	NA	NA	NA
WP_000241660.1|3944089_3945022_-	homoserine kinase	NA	NA	NA	NA	NA
WP_001753208.1|3945023_3947486_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_001386572.1|3947566_3947632_-	thr operon leader peptide	NA	NA	NA	NA	NA
WP_001223186.1|3947845_3948532_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|3948931_3949072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|3949167_3949884_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920307.1|3949942_3951295_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001188666.1|3952775_3953465_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_000875487.1|3953477_3953951_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|3954161_3955031_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|3955027_3955675_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001346116.1|3955726_3956239_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068679.1|3956281_3956608_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409451.1|3956697_3958635_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|3958845_3960513_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|3960819_3962052_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_001029698.1|3962072_3963455_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132956.1|3963503_3964472_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124615.1|3964577_3965222_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_139972904.1|3965249_3966266_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000224877.1|3966721_3967441_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|3967520_3968744_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477811.1|3968795_3970118_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_001295412.1|3970244_3971024_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143253.1|3971281_3972832_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088379.1|3972803_3973667_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563058.1|3973981_3974764_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001299799.1|3974760_3975834_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|3975955_3976117_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|3976243_3976849_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202566.1|3977241_3978828_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001217539.1|3979047_3979296_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_001026781.1|3979612_3980158_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_024199269.1|3980168_3980741_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.6	7.4e-91
WP_139972905.1|3980740_3984139_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001233090.1|3984203_3984803_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_139972906.1|3984873_3988371_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.3	0.0e+00
WP_000090895.1|3988431_3989064_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_139972907.1|3989000_3989744_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	4.5e-149
WP_001152385.1|3989749_3990448_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_032183763.1|3990457_3990787_-|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	99.1	8.6e-60
WP_139972908.1|3990786_3993861_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	95.7	0.0e+00
WP_001161009.1|3993832_3994162_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_139972921.1|3994170_3994557_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	98.4	4.0e-64
WP_000211109.1|3994617_3995361_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001079398.1|3995372_3995774_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
3995400:3995414	attL	GATTTCCGCCATCGC	NA	NA	NA	NA
WP_000677108.1|3995770_3996349_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001283153.1|3996360_3996636_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3996628_3996952_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_077794792.1|3997038_3999066_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.5	0.0e+00
WP_000985939.1|3999010_4000519_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	1.0e-288
WP_001072973.1|4000518_4000731_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	7.1e-31
WP_024232579.1|4000727_4002830_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	99.6	0.0e+00
WP_000373425.1|4002829_4003324_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_001447005.1|4003482_4003683_-	hypothetical protein	NA	K7PJR7	Enterobacteria_phage	98.5	1.4e-33
WP_001139675.1|4003999_4004152_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_139972909.1|4004139_4004607_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	99.4	2.9e-77
WP_001135250.1|4004603_4005101_-	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|4005100_4005316_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|4005383_4006436_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_021537120.1|4006585_4006780_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	98.4	5.1e-28
WP_032180888.1|4007025_4008192_+	nucleoid-associated protein	NA	A0A291AUQ0	Sinorhizobium_phage	25.3	9.7e-13
WP_016159279.1|4008188_4009415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016159280.1|4009407_4009752_-	hypothetical protein	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	3.3e-54
WP_139972910.1|4009769_4010759_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	2.1e-194
WP_069354058.1|4010766_4011609_-	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	92.2	2.0e-140
WP_139972911.1|4011628_4012018_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	96.9	3.3e-66
WP_000210154.1|4012014_4012341_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_139972912.1|4012337_4012667_-	hypothetical protein	NA	A0A291AWV6	Escherichia_phage	95.1	4.8e-50
WP_042028809.1|4012669_4013611_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.7	2.9e-153
WP_001250272.1|4013600_4013780_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_139972913.1|4013955_4014513_-	protein YmfL	NA	S5FXP0	Shigella_phage	94.6	3.3e-96
WP_001191669.1|4014505_4014766_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001347307.1|4014737_4014890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001311077.1|4014863_4015556_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_139972914.1|4015611_4015890_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	94.9	1.9e-12
WP_071587686.1|4016043_4016244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000135680.1|4016258_4016621_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001530589.1|4016686_4017511_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.3e-149
WP_112891064.1|4017638_4018175_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	4.5e-98
WP_001061359.1|4018209_4018404_+	helix-turn-helix domain-containing protein	NA	A5LH59	Enterobacteria_phage	95.3	4.9e-31
WP_139972915.1|4018579_4019413_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_139972916.1|4019503_4020445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139972917.1|4020515_4021739_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	97.8	2.0e-234
4022524:4022538	attR	GATTTCCGCCATCGC	NA	NA	NA	NA
>prophage 9
NZ_CP040067	Escherichia coli strain A1_181 chromosome, complete genome	4778240	4110044	4116603	4778240	transposase	uncultured_Caudovirales_phage(16.67%)	7	NA	NA
WP_000684856.1|4110044_4111001_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4111001_4111769_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|4112326_4112584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254876.1|4113635_4114787_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000747102.1|4114706_4115057_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_000227281.1|4115157_4115730_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|4115778_4116603_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
>prophage 10
NZ_CP040067	Escherichia coli strain A1_181 chromosome, complete genome	4778240	4367133	4379621	4778240	integrase	Shigella_phage(40.0%)	14	4357732:4357745	4375577:4375590
4357732:4357745	attL	TGCTGATAAGACGC	NA	NA	NA	NA
WP_000332259.1|4367133_4368231_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	1.8e-210
WP_001217553.1|4368291_4368540_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000543834.1|4368762_4369314_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_001678535.1|4369291_4370662_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_001753753.1|4371099_4373253_-	chaperone of endosialidase	NA	K7PGT9	Enterobacteria_phage	53.6	1.4e-211
WP_000649477.1|4374383_4374584_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859462.1|4374674_4375349_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_071587686.1|4375800_4376001_+	hypothetical protein	NA	NA	NA	NA	NA
4375577:4375590	attR	TGCTGATAAGACGC	NA	NA	NA	NA
WP_000135682.1|4376015_4376378_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_001753751.1|4376443_4377268_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	6.6e-149
WP_000610754.1|4377454_4378237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093912.1|4378273_4378543_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	97.8	2.5e-41
WP_000019186.1|4378576_4379125_-	hypothetical protein	NA	S5M7T3	Escherichia_phage	89.6	2.7e-82
WP_000287252.1|4379147_4379621_-	SocA family protein	NA	K4NZT7	Burkholderia_phage	31.8	2.4e-18
>prophage 1
NZ_CP040068	Escherichia coli strain A1_181 plasmid p_unnamed1_KPC2, complete sequence	210031	32693	41429	210031	transposase	Acidithiobacillus_phage(33.33%)	13	NA	NA
WP_000268395.1|32693_33632_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.5e-69
WP_000532167.1|33631_33829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001337764.1|33815_34067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001096362.1|34066_34309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001258027.1|34311_34674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000098292.1|34666_34879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194038.1|34938_35694_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.0	5.8e-59
WP_001274811.1|35708_37250_-|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	4.4e-130
WP_001050849.1|37494_38529_+	site-specific DNA-methyltransferase	NA	H8ZMF1	Synechococcus_phage	20.9	1.0e-05
WP_000058870.1|38542_38992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338945.1|38973_39285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001151304.1|39458_40244_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_001207227.1|40247_41429_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
>prophage 2
NZ_CP040068	Escherichia coli strain A1_181 plasmid p_unnamed1_KPC2, complete sequence	210031	115344	172226	210031	transposase,integrase	Escherichia_phage(33.33%)	51	120481:120540	167191:168011
WP_000427614.1|115344_116349_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|116427_119400_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|119402_119960_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_122146091.1|119997_120288_-|transposase	transposase	transposase	NA	NA	NA	NA
120481:120540	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|120543_121248_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000052512.1|121697_123173_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|123228_124113_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_004896925.1|124471_125014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|125898_126603_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018326.1|126721_127537_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_001067855.1|127719_128424_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000935452.1|128470_129775_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000204520.1|129813_130521_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|130517_130754_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|130750_131113_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_015063453.1|131130_132825_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_000522996.1|132863_133289_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|133316_133592_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|133607_133973_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|134044_134500_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000787563.1|135846_136119_+	MafI family immunity protein	NA	NA	NA	NA	NA
WP_084845456.1|136123_136348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000243483.1|136378_136714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139972925.1|136880_137060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|137170_138031_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|139774_140479_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152403.1|140551_143449_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
WP_004152402.1|143537_144158_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_004152400.1|145323_145683_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_004152398.1|146186_147371_+|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152397.1|147647_148967_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|149216_150098_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152395.1|150149_150389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152394.1|150385_151165_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|151161_152187_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|152293_155323_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|155432_157148_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001445937.1|157682_158639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|159366_159969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000243801.1|160191_160512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000932880.1|160530_160818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949433.1|160810_161347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543934.1|161349_162360_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_079390445.1|162689_165770_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
WP_011918375.1|165793_166105_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011787805.1|166104_166365_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_001067855.1|167253_167958_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000859348.1|168115_168262_+	DUF2474 domain-containing protein	NA	NA	NA	NA	NA
167191:168011	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCT	NA	NA	NA	NA
WP_007372360.1|168422_169574_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001141269.1|170259_170535_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_087776199.1|171018_172226_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.7	2.6e-101
>prophage 1
NZ_CP040069	Escherichia coli strain A1_181 plasmid p_unnamed2, complete sequence	97582	0	23434	97582		Escherichia_phage(50.0%)	24	NA	NA
WP_001076427.1|0_861_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_000817632.1|1260_2466_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	100.0	2.0e-226
WP_000725191.1|2462_3428_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	99.4	1.7e-167
WP_000067708.1|3694_5401_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
WP_000085145.1|5461_7051_+	hypothetical protein	NA	A0A077SLN8	Escherichia_phage	100.0	2.5e-306
WP_000041761.1|7060_7876_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	9.8e-113
WP_001345490.1|7988_8207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001345489.1|8262_8493_+	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	98.7	3.0e-35
WP_000509939.1|8504_9014_+	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_001352007.1|9130_9286_-	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	90.2	4.0e-15
WP_024192401.1|9620_10466_-	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	98.6	5.5e-151
WP_001187875.1|10495_11296_-	protein kilA	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
WP_111968254.1|11459_12503_-	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	93.1	9.2e-172
WP_000245712.1|12499_12721_-	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	100.0	1.3e-38
WP_033558660.1|13121_13796_+	hypothetical protein	NA	Q71TC4	Escherichia_phage	92.0	7.5e-18
WP_000846124.1|14064_14334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000188924.1|14392_14959_+	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	100.0	6.6e-100
WP_000523980.1|14969_15581_+	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_139527469.1|15595_16477_+	morphogenetic protein	NA	A0A1B0VBL3	Salmonella_phage	98.6	2.0e-172
WP_139972928.1|16558_20299_+	transglycosylase SLT domain-containing protein	NA	Q1MVL3	Enterobacteria_phage	86.8	0.0e+00
WP_000002800.1|20298_20655_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_029487598.1|20651_22085_+	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	99.4	3.4e-270
WP_001561131.1|22084_22921_+	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	99.6	1.5e-153
WP_029487597.1|22999_23434_+	hypothetical protein	NA	Q71TD4	Escherichia_phage	98.6	3.7e-74
>prophage 2
NZ_CP040069	Escherichia coli strain A1_181 plasmid p_unnamed2, complete sequence	97582	28170	97265	97582	transposase,holin,portal,integrase	Escherichia_phage(66.25%)	83	40353:40369	97239:97255
WP_000332809.1|28170_28452_+	hypothetical protein	NA	Q71TD9	Escherichia_phage	97.8	8.7e-45
WP_000887652.1|28519_28849_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000580776.1|28845_29289_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_000164724.1|29275_29878_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	99.5	1.6e-99
WP_139972929.1|29879_31799_+	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	98.4	0.0e+00
WP_096935682.1|31795_32161_+	ddrA	NA	Q1MVM8	Enterobacteria_phage	96.7	1.5e-44
WP_100728218.1|32173_35161_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.0	0.0e+00
WP_001165936.1|35150_35459_+	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
WP_046644916.1|35489_36284_-	hypothetical protein	NA	Q71TF1	Escherichia_phage	95.8	1.5e-142
WP_042032564.1|36486_36975_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	99.4	1.9e-87
WP_042032566.1|37144_37702_+	lysozyme	NA	Q71TF3	Escherichia_phage	98.9	1.4e-105
WP_001369289.1|37837_38014_+	hypothetical protein	NA	Q71TR5	Escherichia_phage	96.6	7.9e-28
WP_029396176.1|37993_39013_-	hypothetical protein	NA	Q71TR6	Escherichia_phage	99.4	2.7e-184
WP_139972930.1|39005_40715_-|portal	phage portal protein	portal	A0A077SL38	Escherichia_phage	99.3	0.0e+00
40353:40369	attL	GGTCTTCTTATCGAAAG	NA	NA	NA	NA
WP_139972931.1|40790_47558_+	helicase	NA	Q1MVN7	Enterobacteria_phage	98.7	0.0e+00
WP_000224043.1|47591_48032_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_000747846.1|48028_48277_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_139972932.1|48318_49623_-	SIR2 family protein	NA	Q38324	Lactococcus_phage	31.7	5.8e-06
WP_001376241.1|49679_50321_-	hypothetical protein	NA	A0A077SK30	Escherichia_phage	99.1	1.8e-114
WP_032246987.1|50509_51070_-	Ref family protein	NA	Q5QBN4	Enterobacteria_phage	99.5	8.5e-100
WP_032246986.1|51317_51629_-	hypothetical protein	NA	Q5QBN5	Enterobacteria_phage	97.1	1.1e-45
WP_032246985.1|51679_52711_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077SLE7	Escherichia_phage	99.1	4.2e-193
WP_000542332.1|52718_52940_-	hypothetical protein	NA	A0A077SLI9	Escherichia_phage	100.0	3.4e-36
WP_001312283.1|53351_53465_+	hypothetical protein	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
WP_012817944.1|53483_53579_+	hypothetical protein	NA	Q38402	Escherichia_phage	100.0	2.8e-11
WP_000874156.1|53544_53754_+	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000611664.1|53864_54716_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	100.0	1.2e-158
WP_139972933.1|54748_55075_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	100.0	2.9e-52
WP_079390445.1|55112_58193_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
WP_011918375.1|58216_58528_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011787805.1|58527_58788_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_032163774.1|60321_61806_-	hypothetical protein	NA	Q71T61	Escherichia_phage	98.4	2.9e-288
WP_000219616.1|61805_62999_-	hypothetical protein	NA	Q71T62	Escherichia_phage	99.5	5.7e-178
WP_001326849.1|63084_63537_-	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_139972934.1|63625_64669_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.6	4.1e-204
WP_000113018.1|64696_64876_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
WP_001216030.1|64880_65261_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	99.2	1.9e-63
WP_001190712.1|65260_65482_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_000506726.1|65554_65944_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
WP_046644566.1|66067_66319_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	92.8	1.3e-36
WP_024134677.1|66472_66670_-	hypothetical protein	NA	Q71TI2	Escherichia_phage	98.5	7.5e-27
WP_001261544.1|66980_67343_-	hypothetical protein	NA	Q71TI4	Escherichia_phage	100.0	2.2e-56
WP_077787973.1|67339_68272_-	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	98.1	1.2e-178
WP_000988658.1|68253_68628_-	hypothetical protein	NA	A0A077SL57	Escherichia_phage	96.0	3.2e-66
WP_046644560.1|68634_68928_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	91.8	7.0e-45
WP_000516537.1|69106_69340_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	97.4	1.6e-36
WP_139972935.1|69422_70640_-	DUF551 domain-containing protein	NA	A0A1B0V865	Salmonella_phage	55.7	3.2e-107
WP_139972936.1|70641_71352_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	58.1	6.0e-58
WP_000672528.1|71348_72083_-	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	55.2	1.7e-39
WP_001018057.1|72079_72370_-	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	82.3	1.2e-36
WP_000151166.1|72366_73233_-	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	47.2	1.2e-47
WP_097457805.1|73229_73874_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	99.5	2.6e-132
WP_001471568.1|73866_74127_-	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	100.0	5.2e-44
WP_122633930.1|74123_74702_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	100.0	3.2e-110
WP_000021759.1|74896_75403_-	hypothetical protein	NA	A0A077SK53	Escherichia_phage	98.2	4.5e-92
WP_075851234.1|75475_76738_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.3	1.7e-233
WP_000267620.1|76739_76958_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
WP_096106394.1|77039_77741_-	hypothetical protein	NA	Q71TJ0	Escherichia_phage	97.0	3.3e-141
WP_106474605.1|77737_78415_-	serine/threonine protein phosphatase	NA	Q71TJ1	Escherichia_phage	97.3	6.6e-131
WP_000484108.1|78411_79038_-	norphogenetic protein	NA	Q71T82	Escherichia_phage	99.0	4.0e-122
WP_032144601.1|78935_79598_-	hypothetical protein	NA	A0A077SL54	Escherichia_phage	100.0	4.5e-124
WP_000095380.1|79539_79695_-	hypothetical protein	NA	A0A077SK20	Escherichia_phage	100.0	1.2e-19
WP_023351696.1|79762_80341_-	VRR-NUC domain-containing protein	NA	A0A077SLK0	Escherichia_phage	99.0	5.7e-107
WP_000840930.1|80343_80589_-	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
WP_000235786.1|80735_81113_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_023351694.1|81122_82340_+	hypothetical protein	NA	A0A077SL53	Escherichia_phage	99.3	1.6e-223
WP_000896801.1|82343_83072_+	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_000602713.1|83058_83844_+	hypothetical protein	NA	A0A1B0V7N6	Salmonella_phage	100.0	7.2e-145
WP_001561111.1|83845_84862_+	hypothetical protein	NA	Q71T91	Escherichia_phage	99.1	5.0e-191
WP_000535208.1|84854_85487_+	hypothetical protein	NA	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
WP_139972937.1|85532_86531_-	glycosyltransferase family 4 protein	NA	A0A1B0VCH7	Salmonella_phage	99.4	1.9e-195
WP_001276599.1|86530_87895_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	100.0	2.1e-253
WP_077726511.1|87885_88101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000234829.1|88367_88532_-	DUF3927 family protein	NA	A0A1B0VDU8	Salmonella_phage	100.0	1.2e-17
WP_000900640.1|88531_88957_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	100.0	1.8e-70
WP_001068935.1|89148_89340_+	hypothetical protein	NA	Q71T98	Escherichia_phage	100.0	6.0e-29
WP_139972938.1|90515_93803_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	98.9	0.0e+00
WP_000472525.1|93799_94705_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	98.7	8.5e-158
WP_001177860.1|94697_94982_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_001369296.1|95256_95436_+	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
WP_000890193.1|95444_96233_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	90.1	3.0e-106
WP_000007770.1|96272_96695_+	hypothetical protein	NA	Q71TL5	Escherichia_phage	96.4	1.4e-57
WP_001281121.1|96872_97265_+	hypothetical protein	NA	A0A1B0VBK3	Salmonella_phage	99.2	2.6e-71
97239:97255	attR	GGTCTTCTTATCGAAAG	NA	NA	NA	NA
>prophage 1
NZ_CP040070	Escherichia coli strain A1_181 plasmid p_unnamed3, complete sequence	82718	1262	55476	82718	integrase,protease,transposase	Macacine_betaherpesvirus(26.32%)	56	NA	NA
WP_001066942.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_023141670.1|2123_2249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042012863.1|2957_3152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|3448_4618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105060.1|4813_5107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089455122.1|7088_7268_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|7258_7963_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013362816.1|8285_9818_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_013362817.1|10346_10796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139972939.1|11304_12424_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	3.9e-51
WP_100249774.1|12512_12623_-	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	88.6	1.9e-08
WP_013362818.1|12627_13365_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
WP_013362819.1|13490_13586_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001067855.1|13720_14425_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|14546_15452_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|15448_16687_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|16686_17271_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001336397.1|17216_17573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|17763_18528_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_024143553.1|18556_18739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130000.1|18754_19060_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|19070_20276_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|20431_20635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001993321.1|20653_20833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|20762_21602_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|21595_21943_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|22148_22937_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|23067_23541_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_001067855.1|24443_25148_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000439434.1|26458_26791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557619.1|26792_27050_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|27142_27796_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000130640.1|28735_29593_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_031943482.1|29585_29660_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083850.1|29896_30151_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_023144756.1|30447_30582_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_013023861.1|31452_31665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139341.1|31795_32356_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000205718.1|32410_33157_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
WP_001671341.1|38225_38528_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000274437.1|39894_40329_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104873.1|40342_40564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086185.1|40564_41248_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001348615.1|41632_42535_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_001349526.1|42572_42845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000817036.1|43401_44373_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_000772446.1|44372_45539_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_001241949.1|46126_46396_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	7.6e-46
WP_139972940.1|46452_47665_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000016982.1|48968_49775_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159868.1|49775_50081_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|50082_50301_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000215657.1|50934_51132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000642771.1|51128_51413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085961182.1|52512_53726_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000080195.1|53862_55476_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 2
NZ_CP040070	Escherichia coli strain A1_181 plasmid p_unnamed3, complete sequence	82718	66418	77032	82718	transposase	Escherichia_phage(50.0%)	9	NA	NA
WP_001553854.1|66418_69535_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
WP_001553855.1|69656_70940_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.9e-10
WP_001553856.1|70936_72493_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
WP_001190712.1|72675_72897_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_085947917.1|73056_74329_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001513661.1|74617_74797_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001513660.1|74824_75184_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513659.1|75470_75788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012372828.1|76015_77032_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
