The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041005	Salmonella enterica strain FDAARGOS_768 chromosome, complete genome	4857490	1002197	1098781	4857490	plate,capsid,integrase,transposase,head,tRNA,lysis,portal,tail,terminase	Salmonella_phage(81.63%)	90	1036037:1036083	1069730:1069776
WP_085983317.1|1002197_1003360_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
WP_000073810.1|1003638_1005621_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000061088.1|1005617_1006256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682341.1|1007969_1008566_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	91.3	2.6e-99
WP_010989066.1|1009143_1010427_+	membrane protein	NA	NA	NA	NA	NA
WP_001521074.1|1010686_1012561_-	membrane protein	NA	NA	NA	NA	NA
WP_000088556.1|1012726_1013602_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_000021514.1|1014718_1016398_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000819716.1|1016620_1018162_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000811366.1|1018291_1019134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682344.1|1019133_1019697_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000776032.1|1019720_1020356_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_000889012.1|1020429_1021632_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001033832.1|1021926_1022940_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_001098984.1|1022950_1023931_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000973738.1|1023927_1024302_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000480483.1|1024298_1024820_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000749979.1|1024932_1025217_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_010989065.1|1025311_1025668_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989064.1|1025821_1026640_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_001520831.1|1026684_1027968_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001520307.1|1028470_1030540_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_000701821.1|1030575_1030791_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001161781.1|1031241_1032069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|1032403_1033597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989063.1|1033986_1034580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542209.1|1034626_1034794_-	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
WP_001542208.1|1034807_1035872_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
1036037:1036083	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001536726.1|1036200_1037226_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
WP_000052560.1|1037229_1037862_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000102104.1|1037978_1038218_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
WP_000460862.1|1038253_1038763_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.9	5.1e-83
WP_000957775.1|1038770_1039004_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
WP_000166366.1|1038951_1039410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963195.1|1039629_1039971_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
WP_001244234.1|1040038_1040272_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
WP_000785509.1|1040271_1040499_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
WP_000104125.1|1040495_1041353_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.4	2.7e-129
WP_000301161.1|1041343_1043773_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	91.8	0.0e+00
WP_001154433.1|1043925_1044114_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_001217575.1|1044124_1044358_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_014344476.1|1044471_1045149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071892914.1|1045362_1047114_+	AIPR family protein	NA	NA	NA	NA	NA
WP_001292071.1|1047199_1048240_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	93.0	2.4e-188
WP_001098444.1|1048239_1050006_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.3	0.0e+00
WP_000216276.1|1050148_1050982_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_000730755.1|1050998_1052081_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	97.7	1.6e-190
WP_000059178.1|1052084_1052738_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	98.6	4.6e-113
WP_000673534.1|1052831_1053296_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	1.9e-84
WP_000868168.1|1053295_1053499_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	98.5	1.1e-33
WP_000171565.1|1053502_1053718_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069932.1|1053698_1054208_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	3.5e-92
WP_001648763.1|1054584_1055013_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
WP_001039961.1|1055108_1055540_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_000343947.1|1055532_1055979_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.0	1.9e-65
WP_000993751.1|1056047_1056626_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	98.4	3.3e-107
WP_000177403.1|1056622_1056982_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	98.3	8.0e-59
WP_000268333.1|1056968_1057877_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	99.0	7.7e-159
WP_001086807.1|1057869_1058475_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.0	4.1e-116
WP_001274647.1|1058471_1060046_+|tail	tail protein	tail	A0A1S6KZZ8	Salmonella_phage	60.7	2.1e-156
WP_010989059.1|1060015_1060633_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	84.6	4.1e-95
WP_001287105.1|1060636_1061044_-|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	84.4	2.2e-60
WP_010989058.1|1061050_1062130_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	92.1	5.4e-183
WP_001165559.1|1062099_1062657_+	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	97.8	8.0e-98
WP_000046109.1|1062759_1063932_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
WP_001207652.1|1063941_1064457_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.8	7.9e-92
WP_001280967.1|1064511_1064814_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
WP_000763317.1|1064828_1064948_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
WP_001282773.1|1064940_1067748_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	99.7	0.0e+00
WP_000980418.1|1067744_1068230_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	98.5	2.4e-66
WP_001010543.1|1068226_1069327_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.1	3.4e-193
WP_000980498.1|1069395_1069614_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_010989057.1|1070165_1071329_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1069730:1069776	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000196159.1|1071336_1073517_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533858.1|1073513_1074923_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237668.1|1074987_1086462_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1087075_1087558_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1087707_1088184_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1088173_1088464_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1088629_1088968_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1089116_1090778_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1090863_1091742_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1091864_1092455_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287923.1|1092489_1093095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1093215_1094502_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1094521_1095313_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1095478_1096840_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1097153_1097402_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1097420_1097969_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|1098013_1098781_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP041005	Salmonella enterica strain FDAARGOS_768 chromosome, complete genome	4857490	1125591	1230501	4857490	capsid,protease,integrase,holin,transposase,head,tRNA,lysis,portal,tail,terminase	Salmonella_phage(37.1%)	112	1117672:1117688	1205941:1205957
1117672:1117688	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1125591_1126629_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1126744_1127434_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1127752_1128136_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1128197_1128785_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1128887_1129787_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1129804_1131139_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1131269_1132007_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1131991_1133614_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1133877_1134042_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1134038_1134614_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1134645_1135296_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1135295_1136252_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1136248_1136728_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1137225_1138455_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1138432_1138717_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1138757_1138997_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_071892913.1|1139039_1140197_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_000017125.1|1140159_1143087_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001539619.1|1143213_1143564_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1143585_1143744_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_010989055.1|1143736_1143997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1144046_1144457_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1144576_1144816_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1144781_1145156_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1145240_1146224_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1146226_1146976_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1146986_1147334_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1147330_1147642_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_010989003.1|1147719_1148010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1148301_1148535_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1148646_1148868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929803.1|1148950_1149553_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001096550.1|1149761_1150373_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1150369_1150510_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1150506_1151184_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211409.1|1151456_1152020_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1152526_1152715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110786.1|1152929_1153616_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	99.6	7.9e-132
WP_001574216.1|1153891_1154221_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|1154204_1154657_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|1154674_1155127_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1155362_1155764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1156050_1156596_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1156567_1158499_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1158482_1158686_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1158682_1160263_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1160252_1161749_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1161761_1162109_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1162163_1163192_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1163249_1163609_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1163619_1164003_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1164030_1164609_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1164657_1165788_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1165896_1166298_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1166305_1167052_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1167102_1167498_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1167494_1167833_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|1167804_1170900_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|1170902_1171232_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1171241_1171940_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1171946_1172684_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1172581_1173229_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1173290_1176653_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1176691_1176934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1176987_1179360_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1179356_1180181_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1180170_1180749_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1180845_1181073_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1181179_1181392_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_015701342.1|1181454_1181520_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_015589559.1|1182099_1182264_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1182976_1183114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1183616_1185110_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1185514_1187314_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1187330_1188305_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1188578_1189259_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1189255_1190161_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1190172_1190901_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1190912_1191644_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1191643_1192024_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1192135_1192396_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1192433_1193360_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276365.1|1193475_1194672_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684022.1|1194693_1195611_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1195649_1196498_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1196613_1197507_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1197517_1198879_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1198882_1199518_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1199542_1200094_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000734248.1|1200144_1201689_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001747289.1|1201689_1201923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000970045.1|1201944_1205832_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001670672.1|1206481_1207912_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
1205941:1205957	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_001054236.1|1207913_1208678_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_000625591.1|1208674_1210012_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_000717694.1|1210088_1210427_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000856793.1|1210475_1211936_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_001100652.1|1211991_1214136_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000100008.1|1214218_1215550_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001187150.1|1215910_1217455_-	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000883144.1|1217636_1218827_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919178.1|1219151_1220405_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_001173729.1|1220600_1221740_+	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000982961.1|1221734_1223012_-	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_000805728.1|1223137_1223776_+	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000111027.1|1223766_1224753_+	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000020685.1|1224753_1225767_-	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000017587.1|1225777_1226596_-	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000985204.1|1226599_1227643_-	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000174944.1|1227824_1228703_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000553467.1|1228847_1229651_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000940032.1|1229769_1230501_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP041005	Salmonella enterica strain FDAARGOS_768 chromosome, complete genome	4857490	1553534	1583127	4857490	protease,holin,tail	Salmonella_phage(38.46%)	32	NA	NA
WP_000781589.1|1553534_1554029_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1554442_1554934_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1554923_1555187_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1555183_1557670_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1557676_1558372_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1558358_1559228_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1559343_1559793_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1559802_1560405_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1560425_1561043_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_000990028.1|1561039_1561699_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1561750_1562488_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1562484_1562697_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1562693_1563173_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1563169_1565101_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1565097_1565655_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001238333.1|1565651_1566695_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1566738_1567386_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1568115_1568679_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1568870_1569074_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1569376_1570168_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1570464_1570668_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1570836_1573203_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1573531_1574521_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1574535_1574904_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1574932_1576264_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1576560_1576890_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1577482_1578724_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1578726_1579254_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1579631_1580075_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1580128_1581958_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1582305_1582596_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1582623_1583127_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 4
NZ_CP041005	Salmonella enterica strain FDAARGOS_768 chromosome, complete genome	4857490	1655179	1664350	4857490	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1655179_1656127_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824855.1|1656110_1656842_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1656822_1656930_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1656989_1657721_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1657943_1659629_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1659625_1660345_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1660391_1660859_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1660915_1661446_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1661617_1662076_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1662316_1664350_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
NZ_CP041005	Salmonella enterica strain FDAARGOS_768 chromosome, complete genome	4857490	1732658	1743164	4857490		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1732658_1734062_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1734239_1735133_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1735509_1736595_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1736594_1737494_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1737541_1738420_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1738420_1738972_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1738977_1739970_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1739966_1740740_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1740744_1741824_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1741850_1743164_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP041005	Salmonella enterica strain FDAARGOS_768 chromosome, complete genome	4857490	1829158	1839761	4857490		Morganella_phage(25.0%)	12	NA	NA
WP_001219015.1|1829158_1829632_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001738920.1|1830279_1830570_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_000598920.1|1830941_1831739_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000500831.1|1832219_1832381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|1832507_1832927_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|1832929_1834198_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|1834652_1834865_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1834875_1835064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|1835324_1836521_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|1837170_1837470_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|1837561_1838257_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|1838330_1839761_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP041005	Salmonella enterica strain FDAARGOS_768 chromosome, complete genome	4857490	1943805	1950614	4857490	integrase,tail	Salmonella_phage(33.33%)	11	1946015:1946037	1955730:1955752
WP_000856224.1|1943805_1944036_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|1944173_1944548_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|1944548_1945424_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|1945440_1945794_+	YebY family protein	NA	NA	NA	NA	NA
1946015:1946037	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|1946167_1947022_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|1947081_1947576_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|1947765_1947996_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|1948049_1948583_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|1948839_1949007_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|1949071_1949260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|1949732_1950614_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
1955730:1955752	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 8
NZ_CP041005	Salmonella enterica strain FDAARGOS_768 chromosome, complete genome	4857490	2737870	2822604	4857490	protease,integrase,holin,tRNA,lysis,portal,tail,terminase	Salmonella_phage(43.64%)	93	2761964:2761983	2833750:2833769
WP_000938191.1|2737870_2738551_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2739171_2739831_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2739917_2740247_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2740243_2740525_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2740573_2741353_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2741378_2741927_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2742141_2743353_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2743410_2743728_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2743772_2744189_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2744359_2745022_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2745116_2745575_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2745610_2747665_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2747788_2748235_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2748253_2750407_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2750393_2750999_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2751215_2751725_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2752081_2753134_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2753205_2753658_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2753843_2755604_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2755672_2756191_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2756290_2756458_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2756713_2757277_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2757273_2758914_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2758918_2760172_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2760186_2762094_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2761964:2761983	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2762106_2764215_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2764313_2765423_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2765419_2765962_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2766127_2767138_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2767345_2769958_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2770384_2770576_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2770846_2771533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|2771517_2771817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2771885_2772512_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001533476.1|2773159_2774128_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000143167.1|2774603_2775185_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001144679.1|2775184_2777623_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000178849.1|2777676_2777919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001687102.1|2777957_2778833_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_001541992.1|2778859_2781307_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	68.0	0.0e+00
WP_000246065.1|2781378_2782083_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2781980_2782718_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2782727_2783423_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2783512_2784046_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2784162_2784660_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|2784758_2785091_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|2785087_2788075_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|2788154_2788484_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|2788480_2788879_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|2788924_2789674_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|2789685_2790087_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|2790083_2790650_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|2790630_2790930_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2790922_2791246_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|2791336_2793418_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_077679777.1|2793341_2794859_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_000196190.1|2794885_2795092_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|2795088_2797227_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|2797183_2797717_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|2797924_2798404_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2798421_2798874_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2798857_2799187_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|2799462_2800149_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2800509_2800959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2801094_2801220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|2801393_2801711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|2801777_2802575_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|2802564_2802711_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|2802707_2803319_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_000929805.1|2803527_2804130_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|2804212_2804434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2804545_2804779_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_010989003.1|2805070_2805361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2805438_2805750_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_140192261.1|2805718_2806093_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.3	3.2e-50
WP_000800010.1|2806103_2806853_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|2806855_2807839_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2807923_2808298_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2808263_2808503_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2808622_2809033_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_010989002.1|2809082_2809343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|2809335_2809494_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|2809515_2809815_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000017134.1|2809941_2812827_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.4	0.0e+00
WP_001539618.1|2812789_2813947_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2813989_2814229_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2814269_2814518_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|2814562_2815855_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|2816049_2817252_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|2817329_2818766_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|2819010_2820225_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|2820541_2821003_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2821203_2822604_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
2833750:2833769	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 9
NZ_CP041005	Salmonella enterica strain FDAARGOS_768 chromosome, complete genome	4857490	2868998	2953040	4857490	protease,integrase,holin,transposase,tRNA,lysis,tail,terminase	Escherichia_phage(29.09%)	84	2860719:2860734	2958579:2958594
2860719:2860734	attL	GCTTTATTACCTTTTT	NA	NA	NA	NA
WP_000886697.1|2868998_2870291_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	8.6e-95
WP_000067785.1|2870549_2871893_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.9	1.6e-80
WP_001519746.1|2871902_2872514_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_001542260.1|2872656_2876712_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.9e-88
WP_000228469.1|2876846_2877341_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537407.1|2877886_2878855_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	1.1e-62
WP_001044541.1|2878968_2880735_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.1	6.0e-22
WP_001202267.1|2880735_2882457_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.5	8.4e-13
WP_001241650.1|2882501_2883206_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001539595.1|2883206_2883590_+	membrane protein	NA	NA	NA	NA	NA
WP_001040187.1|2883517_2883736_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000597928.1|2883826_2884738_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000809973.1|2884846_2885707_+	pirin family protein	NA	NA	NA	NA	NA
WP_000097893.1|2885726_2886404_+	hydrolase	NA	NA	NA	NA	NA
WP_085983316.1|2886740_2887995_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|2888458_2888917_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|2889108_2891385_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2891415_2891736_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2892059_2892281_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|2892410_2894357_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|2894353_2895472_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_001519667.1|2895617_2896568_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000599761.1|2896564_2898223_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_000491118.1|2898424_2899324_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_000458775.1|2899467_2901120_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_001669316.1|2901131_2902100_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815313.1|2902257_2903976_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	1.7e-29
WP_000566344.1|2904014_2905016_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000069000.1|2905026_2906460_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000866904.1|2906555_2907569_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000645853.1|2907565_2908396_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	1.8e-08
WP_001160725.1|2908392_2908716_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_130522148.1|2909078_2909294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024131093.1|2909701_2909923_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010989000.1|2910756_2911995_+	sialidase	NA	NA	NA	NA	NA
WP_001116083.1|2912065_2912641_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.8	5.2e-92
WP_001144671.1|2912640_2915013_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	64.2	5.8e-89
WP_071892911.1|2915056_2918503_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	69.8	0.0e+00
WP_001035652.1|2918596_2919121_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	100.0	1.3e-97
WP_010988999.1|2919174_2919852_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	67.6	3.0e-67
WP_000415909.1|2919749_2920484_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	77.4	2.7e-114
WP_001204739.1|2920495_2921191_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	71.4	3.2e-96
WP_000815758.1|2921322_2921841_-	outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	30.2	3.1e-11
WP_000447242.1|2921967_2922297_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	68.5	2.2e-39
WP_000372081.1|2922296_2925458_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	55.7	4.3e-257
WP_010988998.1|2925429_2925747_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	65.1	1.6e-31
WP_000479032.1|2925764_2926169_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	54.1	6.3e-28
WP_000538780.1|2926213_2926957_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	75.6	6.2e-98
WP_001032970.1|2926967_2927369_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	66.9	4.9e-49
WP_000053599.1|2927365_2927950_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	77.1	4.5e-75
WP_000002963.1|2927953_2928229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107911.1|2928221_2928545_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	63.2	1.0e-28
WP_000860093.1|2928633_2930820_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	72.1	1.3e-276
WP_000196424.1|2932203_2932410_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	48.6	1.4e-07
WP_010988995.1|2932406_2934515_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	70.6	1.5e-293
WP_000348548.1|2934501_2934993_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	57.5	2.6e-44
WP_024131087.1|2935047_2935269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000744510.1|2935344_2935536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001050822.1|2935827_2936313_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	93.8	5.7e-76
WP_001004342.1|2936309_2936924_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	1.4e-108
WP_001527046.1|2936926_2937271_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_010988994.1|2937860_2938259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001119738.1|2939316_2939709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762838.1|2939863_2940679_-	molecular chaperone	NA	A0A1B5FPA5	Escherichia_phage	72.3	3.7e-112
WP_001258392.1|2940675_2941536_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	84.6	1.0e-136
WP_000844637.1|2941535_2942504_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	95.3	1.9e-179
WP_000956017.1|2942500_2944129_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	83.4	7.1e-272
WP_001090725.1|2944241_2944610_-	hypothetical protein	NA	A0A1B5FPB1	Escherichia_phage	88.5	4.5e-57
WP_010988992.1|2945109_2945364_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JEY0	uncultured_Caudovirales_phage	52.9	7.5e-11
WP_000497764.1|2945476_2946172_+	helix-turn-helix transcriptional regulator	NA	F1C5C2	Cronobacter_phage	67.5	7.4e-85
WP_000152744.1|2946350_2946668_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	51.0	3.0e-17
WP_000763696.1|2946660_2946855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000155901.1|2946851_2947037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000267318.1|2947224_2947434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010988991.1|2947357_2947774_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	55.7	1.4e-27
WP_001088169.1|2947773_2948010_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	76.7	4.5e-26
WP_000886590.1|2947999_2948395_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	74.6	6.7e-51
WP_010988990.1|2948349_2948742_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	76.1	5.9e-23
WP_000687968.1|2948980_2949205_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	65.3	1.9e-18
WP_010988989.1|2949201_2949510_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	80.8	2.1e-15
WP_010988988.1|2949875_2950118_+	excisionase family protein	NA	G9L654	Escherichia_phage	62.8	1.8e-22
WP_010988987.1|2950145_2951471_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	65.9	3.2e-169
WP_001270724.1|2951566_2952082_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027186.1|2952311_2953040_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	5.1e-28
2958579:2958594	attR	AAAAAGGTAATAAAGC	NA	NA	NA	NA
>prophage 10
NZ_CP041005	Salmonella enterica strain FDAARGOS_768 chromosome, complete genome	4857490	4306562	4353606	4857490	plate,tail,tRNA	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4306562_4307561_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4307648_4308959_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4309205_4309721_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4309819_4310029_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4310050_4310164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4310160_4311486_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4311664_4312273_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4312381_4312750_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4312920_4315341_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4315439_4316312_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4316325_4316823_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4317003_4317921_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4318084_4319443_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4319531_4320641_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4321002_4322193_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4322324_4323869_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4323883_4324774_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4324939_4325350_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4325492_4327589_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4327588_4328326_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_022742863.1|4328322_4328991_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4329024_4329267_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4329710_4331360_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4331704_4333054_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4333186_4333534_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4334109_4334397_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270442.1|4334399_4335005_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	4.2e-60
WP_000777266.1|4335017_4335332_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4335491_4335947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4335943_4336141_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4336130_4337558_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4337557_4338082_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4338133_4338451_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4338410_4338539_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4338635_4340990_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4340989_4341943_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4341942_4342152_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4342139_4343183_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4343192_4343915_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4344242_4344605_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4344601_4345531_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4345530_4347078_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4347241_4347601_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4347591_4348707_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4348699_4349332_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4349334_4351080_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4351084_4351690_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4351686_4352142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4352390_4352681_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4352877_4353606_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP041006	Salmonella enterica strain FDAARGOS_768 plasmid unnamed1, complete sequence	93933	56790	66086	93933	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_000088645.1|56790_57471_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
WP_000369839.1|57852_58209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490265.1|58201_58672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925627.1|59182_59605_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000457541.1|59604_60879_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_001541561.1|60960_61938_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
WP_000427676.1|61934_63140_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728917.1|63554_64496_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_001541562.1|64527_65094_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|65150_65486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|65669_66086_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
