The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029839	Salmonella enterica subsp. enterica serovar Typhimurium strain 10ST07093 chromosome, complete genome	4865212	975308	984040	4865212	protease,transposase	Dickeya_phage(14.29%)	8	NA	NA
WP_001201751.1|975308_976427_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|976423_978370_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|978499_978721_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|979044_979365_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|979395_981672_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|981863_982322_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_140238273.1|982494_982770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085983316.1|982784_984040_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 2
NZ_CP029839	Salmonella enterica subsp. enterica serovar Typhimurium strain 10ST07093 chromosome, complete genome	4865212	1033899	1132707	4865212	protease,holin,tRNA,integrase,portal,lysis,terminase,tail	Salmonella_phage(43.64%)	101	1036808:1036827	1108595:1108614
WP_001154025.1|1033899_1034703_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1034695_1036018_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1035998_1036703_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1036702_1041169_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1036808:1036827	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1041513_1043355_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1043614_1044163_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1044190_1044838_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1044899_1046090_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1046274_1047366_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1047972_1049373_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1049573_1050035_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301921.1|1050031_1050265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000544849.1|1050351_1051566_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1051810_1053247_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1053324_1054527_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1054721_1056014_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1056058_1056307_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1056347_1056587_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000017133.1|1057748_1060634_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|1060760_1061060_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1061081_1061240_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014344008.1|1061232_1061493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1061542_1061953_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1062072_1062312_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1062277_1062652_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_001738833.1|1062736_1063720_+	gifsy-1 prophage PrpO	NA	H6WRX7	Salmonella_phage	99.7	1.6e-162
WP_000800010.1|1063722_1064472_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1064482_1064830_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1064826_1065138_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1065215_1065506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1065797_1066031_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1066142_1066364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1066446_1067049_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001241019.1|1067048_1067255_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_001096552.1|1067257_1067869_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1067865_1068012_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1068001_1068799_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1068865_1069183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1069356_1069482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1069617_1070067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1070427_1071114_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1071389_1071719_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|1071702_1072155_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_031248426.1|1072172_1072652_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	75.0	2.3e-53
WP_000371784.1|1072859_1073393_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1073349_1075488_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1075484_1075691_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_077679777.1|1075717_1077235_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_010989008.1|1077158_1079240_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1079330_1079654_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1079646_1079946_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1079926_1080493_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1080489_1080891_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1080902_1081652_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1081697_1082096_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1082092_1082422_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1082501_1085489_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|1085485_1085818_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1085916_1086414_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1086530_1087064_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1087153_1087849_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1087858_1088596_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1088493_1089198_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000178849.1|1092658_1092901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|1092954_1095393_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|1095392_1095974_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001533476.1|1096449_1097418_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|1098065_1098692_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1098760_1099060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1099044_1099731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1100001_1100193_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1100619_1103232_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1103439_1104450_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1104615_1105158_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1105154_1106264_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1106362_1108471_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1108483_1110391_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1108595:1108614	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1110405_1111659_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1111663_1113304_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1113300_1113864_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1114119_1114287_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1114386_1114905_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156453.1|1114973_1116734_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1116919_1117372_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1117443_1118496_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1118852_1119362_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1119578_1120184_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1120170_1122324_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1122342_1122789_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1122912_1124967_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1125002_1125461_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1125555_1126218_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1126388_1126805_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1126849_1127167_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1127224_1128436_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1128650_1129199_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1129224_1130004_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1130052_1130334_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1130330_1130660_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1130746_1131406_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1132026_1132707_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 3
NZ_CP029839	Salmonella enterica subsp. enterica serovar Typhimurium strain 10ST07093 chromosome, complete genome	4865212	1921040	1927849	4865212	integrase,tail	Salmonella_phage(33.33%)	11	1915903:1915925	1925618:1925640
1915903:1915925	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1921040_1921922_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1922394_1922583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1922647_1922815_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1923071_1923605_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1923658_1923889_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1924078_1924573_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1924632_1925487_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1925860_1926214_-	YebY family protein	NA	NA	NA	NA	NA
1925618:1925640	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1926230_1927106_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1927106_1927481_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1927618_1927849_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 4
NZ_CP029839	Salmonella enterica subsp. enterica serovar Typhimurium strain 10ST07093 chromosome, complete genome	4865212	2003299	2082641	4865212	protease,holin,integrase,head,portal,transposase,plate,lysis,terminase,capsid,tail	Salmonella_phage(84.85%)	104	2009837:2009852	2084264:2084279
WP_000502119.1|2003299_2003758_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2003938_2005144_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|2005222_2006710_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|2006966_2008370_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2008384_2008792_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2008791_2009160_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2009231_2010716_+	alpha-amylase	NA	NA	NA	NA	NA
2009837:2009852	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2010755_2011181_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2011366_2012572_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2012568_2012802_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2013066_2013453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2013572_2013887_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2014103_2015786_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2015778_2016774_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2016766_2017474_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2017473_2018844_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2018865_2019309_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2019305_2020523_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2020627_2021095_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2021099_2022104_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2022100_2022514_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2022513_2022891_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2022890_2023628_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2023637_2023907_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2023915_2024710_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103975.1|2024991_2025615_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2025653_2025902_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2025976_2026204_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2026513_2027329_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001738345.1|2027307_2029020_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2029184_2029430_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2029446_2030358_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2030533_2031454_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2031442_2031913_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2031893_2033324_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2033397_2034093_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2034184_2034484_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2035133_2036330_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2036590_2036779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2036789_2037002_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2037456_2038725_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2038727_2039147_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2039273_2039435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099112411.1|2039736_2039952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2040065_2040287_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|2040499_2041507_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_000760554.1|2041791_2042361_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
WP_000554736.1|2042360_2043923_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	99.8	7.5e-287
WP_001207832.1|2043909_2044497_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_001738350.1|2044499_2045021_-|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	99.4	1.5e-93
WP_014343856.1|2045055_2045601_-	phage protein	NA	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_000605050.1|2045572_2045986_-	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273649.1|2045990_2046524_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066636.1|2046523_2047582_-	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_000863818.1|2047578_2048919_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_000785385.1|2048952_2050881_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000588852.1|2050965_2051292_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2051288_2051645_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007991.1|2051644_2053141_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000497739.1|2053130_2053295_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779218.1|2053298_2053859_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_001135697.1|2053855_2054368_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702408.1|2054339_2054744_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_000927378.1|2054740_2055064_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2055066_2055267_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000257528.1|2055317_2056523_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_001193639.1|2056537_2057188_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|2057165_2058407_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|2058406_2058589_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088182.1|2058600_2060334_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000929191.1|2060330_2060825_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135225.1|2060950_2061301_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_001292890.1|2061361_2061664_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_000877027.1|2061883_2062303_-	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001050825.1|2062515_2063001_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_001005901.1|2062997_2063612_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001527046.1|2063614_2063959_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_014343859.1|2064120_2064555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001527054.1|2064484_2064742_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_000188927.1|2064874_2065498_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001061457.1|2066503_2067364_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001241579.1|2067380_2067770_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2067766_2068660_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2068659_2069142_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2069143_2069962_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2069958_2070183_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2070179_2071337_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2071333_2071888_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2071916_2072141_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_071529734.1|2072079_2072265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020636.1|2072238_2072934_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000997190.1|2073748_2074120_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_001738355.1|2074177_2075005_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	99.6	2.9e-152
WP_000008351.1|2075141_2075681_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|2075751_2075982_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071070.1|2075978_2076494_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000065095.1|2076490_2077108_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000208068.1|2077104_2077938_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_001061334.1|2077941_2078511_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2078535_2078778_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2078779_2079769_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2080060_2080858_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2081229_2081520_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2082167_2082641_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2084264:2084279	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 5
NZ_CP029839	Salmonella enterica subsp. enterica serovar Typhimurium strain 10ST07093 chromosome, complete genome	4865212	2168634	2179140	4865212		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2168634_2169948_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2169974_2171054_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2171058_2171832_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2171828_2172821_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2172826_2173378_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2173378_2174257_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2174304_2175204_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2175203_2176289_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2176665_2177559_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2177736_2179140_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 6
NZ_CP029839	Salmonella enterica subsp. enterica serovar Typhimurium strain 10ST07093 chromosome, complete genome	4865212	2247448	2256619	4865212	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2247448_2249482_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2249722_2250181_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2250352_2250883_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2250939_2251407_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2251453_2252173_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2252169_2253855_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2254077_2254809_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2254868_2254976_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2254956_2255688_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2255671_2256619_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 7
NZ_CP029839	Salmonella enterica subsp. enterica serovar Typhimurium strain 10ST07093 chromosome, complete genome	4865212	2276026	2342421	4865212	holin,lysis,tail	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|2276026_2276722_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2276875_2277760_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2277936_2278656_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2278652_2278898_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001738396.1|2279102_2280344_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|2280337_2281573_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2281647_2282658_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535905.1|2282673_2284194_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2284327_2285326_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2285824_2286847_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2286996_2288139_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2288153_2288822_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2289151_2290009_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2289997_2290387_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2290391_2291759_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2291975_2292863_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2292895_2294218_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2294261_2296253_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2296597_2298067_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2298256_2299120_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2299240_2300290_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2300368_2301226_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2301290_2302979_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2302995_2303934_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2303933_2305064_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2305432_2306614_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2306678_2307344_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2307345_2307468_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2307855_2308110_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2308433_2309006_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2309218_2310205_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2310234_2310954_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2311367_2311940_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2312265_2313822_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2313928_2315734_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2315743_2316838_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2316837_2317863_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2317864_2319454_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2319457_2319802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2320192_2321383_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2321410_2322106_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2322257_2324018_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2324142_2324427_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2324535_2325156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2325183_2326191_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2326370_2326598_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2326629_2328390_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2328670_2329174_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2329201_2329492_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2329839_2331669_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2331722_2332166_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2332543_2333071_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2333073_2334315_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2334907_2335237_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2335533_2336865_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2336893_2337262_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2337276_2338266_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2338594_2340961_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2341129_2341333_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2341629_2342421_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NZ_CP029839	Salmonella enterica subsp. enterica serovar Typhimurium strain 10ST07093 chromosome, complete genome	4865212	2681286	2788341	4865212	holin,protease,tRNA,integrase,head,portal,transposase,lysis,terminase,capsid,tail	Salmonella_phage(31.67%)	111	2705831:2705847	2796245:2796261
WP_000940032.1|2681286_2682018_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2682136_2682940_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2683084_2683963_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2684144_2685188_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2685191_2686010_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2686020_2687034_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2687034_2688021_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2688011_2688650_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2688775_2690053_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2690047_2691187_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2691382_2692636_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2692960_2694151_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2694332_2695877_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2696237_2697569_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2697651_2699796_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2699851_2701312_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2701360_2701699_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2701775_2703113_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2703109_2703874_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2703875_2705306_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
2705831:2705847	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|2705955_2709843_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|2709864_2710098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2710098_2711643_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2711693_2712245_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2712269_2712905_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2712908_2714270_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2714280_2715174_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2715289_2716138_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2716176_2717094_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276370.1|2717115_2718312_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2718427_2719354_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2719391_2719652_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2719763_2720144_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2720143_2720875_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2720886_2721615_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2721626_2722532_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2722528_2723209_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2723482_2724457_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2724473_2726273_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2726677_2728171_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2728619_2728757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2729469_2729634_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2730213_2730279_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2730341_2730554_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2730659_2730887_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2730983_2731562_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2731551_2732376_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000178853.1|2734797_2735040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2735078_2738441_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2738502_2739150_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_015701343.1|2739047_2739785_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	3.0e-129
WP_001152689.1|2739791_2740490_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2740499_2740829_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372065.1|2740831_2743927_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_010989052.1|2743898_2744237_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2744233_2744629_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2744679_2745426_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2745433_2745835_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2745943_2747074_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2747122_2747701_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2747728_2748112_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2748122_2748482_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2748539_2749568_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2749622_2749970_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2749982_2751479_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_001738454.1|2751468_2752956_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	63.3	5.8e-180
WP_000201415.1|2753044_2753248_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2753231_2755163_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2755134_2755680_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2755966_2756368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2756603_2757056_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984581.1|2757073_2757526_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|2757509_2757839_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2758114_2758801_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2759015_2759204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2759710_2760274_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_072095218.1|2760364_2760550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097241.1|2760546_2761224_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2761220_2761361_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_000929791.1|2762173_2762776_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|2762810_2763059_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2763175_2763409_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000877757.1|2763651_2764284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000664368.1|2764391_2765090_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000801764.1|2765103_2765799_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_001738749.1|2765795_2766632_-	replication protein	NA	K7PGT1	Enterobacteria_phage	48.5	4.6e-49
WP_010835408.1|2766723_2767098_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000643689.1|2767057_2767300_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_000660736.1|2767399_2767795_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_001111772.1|2767853_2768693_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000356948.1|2768685_2769072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950426.1|2769071_2769734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|2770190_2770349_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2770370_2770721_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_014344386.1|2773736_2774894_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|2774936_2775176_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2775216_2775501_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2775478_2776708_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2777205_2777685_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2777681_2778638_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2778637_2779288_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2779319_2779895_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2779891_2780056_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001521719.1|2780055_2780235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000083343.1|2781925_2782663_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2782793_2784128_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2784145_2785045_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2785147_2785735_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2785796_2786180_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2786498_2787188_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2787303_2788341_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2796245:2796261	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 9
NZ_CP029839	Salmonella enterica subsp. enterica serovar Typhimurium strain 10ST07093 chromosome, complete genome	4865212	2815148	2920628	4865212	tRNA,integrase,head,portal,transposase,terminase,capsid,tail	Cronobacter_phage(64.58%)	100	2891043:2891058	2919075:2919090
WP_000469804.1|2815148_2815916_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2815960_2816509_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2816527_2816776_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2817089_2818451_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2818616_2819408_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2819427_2820714_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287923.1|2820834_2821440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2821474_2822065_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2822187_2823066_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2823151_2824813_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2824961_2825300_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2825465_2825756_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2825745_2826222_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2826371_2826854_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237670.1|2827467_2838942_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533858.1|2839006_2840416_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196159.1|2840412_2842593_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989057.1|2842600_2843764_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001738745.1|2844296_2845106_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_001738744.1|2845259_2846318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001738743.1|2846536_2846746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001738742.1|2846922_2847255_-	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	50.9	2.2e-23
WP_001738741.1|2847360_2849061_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	77.4	4.1e-222
WP_001738740.1|2849063_2849609_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	73.6	7.9e-66
WP_001738739.1|2849580_2850306_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	54.4	1.2e-64
WP_001738738.1|2850295_2850736_-|tail	phage tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	29.8	4.3e-06
WP_001738737.1|2850737_2852789_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	82.6	9.7e-133
WP_001738736.1|2852799_2853387_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	7.6e-91
WP_001738734.1|2853379_2854564_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	80.7	5.5e-181
WP_000004502.1|2854560_2854890_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	68.8	9.3e-38
WP_001738733.1|2854886_2856947_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.6	6.2e-273
WP_001738732.1|2857134_2857392_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	57.3	4.9e-18
WP_024137079.1|2857378_2857567_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	75.8	2.0e-21
WP_001738731.1|2857496_2857877_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	64.0	2.4e-29
WP_000175561.1|2857876_2858218_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	94.1	6.9e-52
WP_001738730.1|2858204_2858507_-	Holin from bacteriophage origin	NA	A0A0M5M1H1	Salmonella_phage	55.3	1.4e-19
WP_000044253.1|2858517_2858973_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.8	5.9e-59
WP_001738729.1|2858969_2860097_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	81.6	2.4e-173
WP_001738727.1|2860093_2860801_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	75.6	3.7e-100
WP_001738725.1|2860797_2861304_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	68.7	6.2e-65
WP_020978745.1|2861300_2861789_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.1e-63
WP_001738722.1|2861849_2862551_-|terminase	terminase endonuclease subunit from bacteriophage origin	terminase	F1BUM0	Cronobacter_phage	69.0	1.3e-89
WP_001738720.1|2862554_2863577_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.8	3.0e-159
WP_001738719.1|2863638_2864442_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.8	1.3e-80
WP_001738718.1|2864603_2866379_+	Terminase ATPase subunit from bacteriophage origin	NA	F1BUM5	Cronobacter_phage	83.4	1.5e-291
WP_001738716.1|2866375_2867437_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	78.3	5.5e-164
WP_012602735.1|2867433_2867757_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	93.3	4.7e-50
WP_001739154.1|2867730_2867949_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	47.2	3.6e-06
WP_031247519.1|2868064_2870080_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	7.9e-297
WP_001738714.1|2870081_2870294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001738712.1|2870290_2871160_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	81.0	1.9e-130
WP_001738711.1|2871150_2871384_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_001738709.1|2871451_2871853_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	65.4	1.6e-47
WP_001738708.1|2871852_2872281_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	58.2	4.9e-31
WP_001738705.1|2872475_2872979_-	phage protein	NA	F1BUN6	Cronobacter_phage	72.5	4.5e-60
WP_024137081.1|2873016_2873220_-	hypothetical protein	NA	F1BUN7	Cronobacter_phage	57.4	9.2e-12
WP_024137082.1|2873365_2873932_+	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	59.1	3.7e-66
WP_001738703.1|2873931_2874963_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUN9	Cronobacter_phage	84.9	1.6e-173
WP_001738702.1|2874965_2875943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124715.1|2876283_2877480_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.9	1.4e-107
WP_001238818.1|2877483_2879181_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_000628291.1|2879167_2879401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000200483.1|2879387_2879936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562051.1|2879938_2880199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071737793.1|2880503_2880689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210082.1|2880652_2881219_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	4.1e-57
WP_000984209.1|2881235_2881478_-	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	77.8	5.2e-30
WP_000149860.1|2881474_2882212_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.4	9.0e-81
WP_015701354.1|2883012_2883564_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_001216603.1|2883560_2883788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795388.1|2883784_2884105_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783717.1|2884119_2886453_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.7	0.0e+00
WP_001542208.1|2886944_2888009_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
WP_001738700.1|2888100_2888190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989063.1|2888236_2888830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|2889219_2890413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161781.1|2890747_2891575_-	hypothetical protein	NA	NA	NA	NA	NA
2891043:2891058	attL	ACAAACATATATTCTT	NA	NA	NA	NA
WP_000701821.1|2892025_2892241_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001520307.1|2892276_2894346_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_001520831.1|2894848_2896132_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010989064.1|2896176_2896995_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_010989065.1|2897148_2897505_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000749979.1|2897599_2897884_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_000480483.1|2897996_2898518_+	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000973738.1|2898514_2898889_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001098984.1|2898885_2899866_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_001033832.1|2899876_2900890_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000889012.1|2901184_2902387_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000776032.1|2902460_2903096_-	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_001682344.1|2903119_2903683_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000811366.1|2903682_2904525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000819716.1|2904654_2906196_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000021514.1|2906418_2908098_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000088556.1|2909214_2910090_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_001521074.1|2910255_2912130_+	membrane protein	NA	NA	NA	NA	NA
WP_010989066.1|2912389_2913673_-	membrane protein	NA	NA	NA	NA	NA
WP_001738699.1|2914250_2914847_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	90.8	7.7e-99
WP_000061088.1|2916570_2917209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000073810.1|2917205_2919188_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
2919075:2919090	attR	AAGAATATATGTTTGT	NA	NA	NA	NA
WP_085983317.1|2919466_2920628_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
>prophage 10
NZ_CP029839	Salmonella enterica subsp. enterica serovar Typhimurium strain 10ST07093 chromosome, complete genome	4865212	4426403	4446823	4865212	tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4426403_4427132_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4427328_4427619_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4427867_4428323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4428319_4428925_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4428929_4430675_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4430677_4431310_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4431302_4432418_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4432408_4432768_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4432931_4434479_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4434478_4435408_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4435404_4435767_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4436094_4436817_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4436826_4437870_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4437857_4438067_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4438066_4439020_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262500.1|4439019_4441374_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_001185654.1|4441470_4441599_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4441558_4441876_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4441927_4442452_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4442451_4443879_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4443868_4444066_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4444062_4444518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4444677_4444992_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4445004_4445610_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4445612_4445900_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4446475_4446823_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP029838	Salmonella enterica subsp. enterica serovar Typhimurium strain 10ST07093 plasmid p10ST07093B, complete sequence	93798	21700	30996	93798	transposase	Escherichia_phage(28.57%)	12	NA	NA
WP_000088645.1|21700_22381_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
WP_000091632.1|22525_22714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|22762_23119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490265.1|23111_23582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925627.1|24092_24515_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000457541.1|24514_25789_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_014344447.1|25870_26848_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
WP_000427676.1|26844_28050_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728917.1|28464_29406_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_001541562.1|29437_30004_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|30060_30396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|30579_30996_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
