The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041071	Bacillus tropicus strain LM1212-W3 chromosome, complete genome	5631167	396830	431037	5631167	transposase	Staphylococcus_phage(33.33%)	39	NA	NA
WP_118991659.1|396830_397619_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_050587967.1|398080_398278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072990.1|399232_399556_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_029440919.1|399678_400212_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_029440920.1|400346_401849_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.0	5.2e-35
WP_029440921.1|402014_402560_+	GNAT family N-acetyltransferase	NA	G9BWD5	Planktothrix_phage	31.8	2.1e-10
WP_029440922.1|402705_403269_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_029440923.1|403265_403970_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_029440924.1|403966_404743_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_029440925.1|404754_405654_+	PhzF family phenazine biosynthesis isomerase	NA	NA	NA	NA	NA
WP_000801653.1|405686_405896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050587969.1|406071_406875_+	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_029440926.1|406938_407496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118991735.1|407521_408349_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_029440928.1|408365_408932_+	SGNH/GDSL hydrolase family protein	NA	A0A0N9RRL9	Staphylococcus_phage	27.0	3.6e-05
WP_029440929.1|408976_409393_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_000040533.1|409473_410484_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_029440930.1|410886_411231_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_029440931.1|411423_411750_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_029440932.1|412059_413250_+	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L0U7	Tupanvirus	40.2	5.9e-50
WP_029440933.1|413466_414528_+	oxidoreductase	NA	NA	NA	NA	NA
WP_029440934.1|414560_415298_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029440935.1|415364_415706_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_029440936.1|416288_416684_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_029440937.1|416731_416866_+	BA3454 family stress response protein	NA	NA	NA	NA	NA
WP_000573529.1|416975_417110_+	BA3454 family stress response protein	NA	NA	NA	NA	NA
WP_029440938.1|417273_417687_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000987469.1|417814_418150_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_118991658.1|418419_419209_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_029440585.1|419284_420478_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	24.8	9.6e-24
WP_118991736.1|420773_421475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118991659.1|421579_422368_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_029440442.1|422631_422844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118991861.1|423337_424654_-	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_118991737.1|424932_426021_-	glycosyltransferase family 2 protein	NA	S5WBE2	Pseudomonas_phage	22.2	4.6e-09
WP_118991862.1|426223_427516_-	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_118991738.1|427717_427990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437250.1|428155_429274_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_118991739.1|429624_431037_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP041071	Bacillus tropicus strain LM1212-W3 chromosome, complete genome	5631167	987879	997108	5631167		Geobacillus_phage(25.0%)	11	NA	NA
WP_029438617.1|987879_988686_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	68.5	4.7e-107
WP_029438616.1|988750_988963_-	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	52.9	9.6e-12
WP_029438615.1|988965_990351_-	MBL fold metallo-hydrolase	NA	Q0H255	Geobacillus_phage	59.5	2.7e-78
WP_029438614.1|990797_991202_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_029438613.1|991217_991571_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_029438612.1|991592_992300_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	27.0	1.1e-16
WP_029438611.1|992365_992752_+	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_118991771.1|992773_993277_+	DNA topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	45.5	3.6e-41
WP_029438610.1|993423_994104_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BUR2	Microcystis_phage	38.7	7.8e-31
WP_029438609.1|994189_995383_+	glycosyl transferase family 1	NA	B0LUM8	Spodoptera_litura_multicapsid_nucleopolyhedrovirus	27.2	9.9e-13
WP_029438608.1|995740_997108_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	37.5	2.8e-19
>prophage 3
NZ_CP041071	Bacillus tropicus strain LM1212-W3 chromosome, complete genome	5631167	1089871	1156822	5631167	transposase,bacteriocin,integrase	Bacillus_phage(20.0%)	57	1101675:1101734	1155530:1157109
WP_029438525.1|1089871_1090099_-|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_029438524.1|1090298_1090745_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_029438523.1|1090770_1091109_-	divalent cation tolerance protein CutA	NA	A0A1S5V250	Saudi_moumouvirus	34.0	3.3e-14
WP_029438522.1|1091139_1091598_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_029438521.1|1091707_1092619_-	EamA family transporter	NA	NA	NA	NA	NA
WP_029438520.1|1092769_1094203_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_118991778.1|1094247_1094778_-	DUF4269 domain-containing protein	NA	NA	NA	NA	NA
WP_061687732.1|1094950_1095412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029438518.1|1095701_1096574_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	38.3	2.4e-32
WP_029438517.1|1096619_1097420_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_118991779.1|1097903_1098620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118991780.1|1100066_1101290_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
1101675:1101734	attL	AAAAAGACCAACTATGAGAAGTCAAGAGGAATTTTATAAATAGGAAACTTAAAAAAGGGT	NA	NA	NA	NA
WP_029437265.1|1101773_1102967_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	4.3e-24
WP_029438516.1|1103301_1103874_+	thiamine biosynthesis protein ThiJ	NA	NA	NA	NA	NA
WP_029438515.1|1103998_1104805_-	DegV family protein	NA	NA	NA	NA	NA
WP_029438514.1|1105004_1105511_-	DUF3189 family protein	NA	NA	NA	NA	NA
WP_029438513.1|1105765_1106359_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_061685883.1|1106363_1107386_-	serine hydrolase	NA	G1BSP8	Mycobacterium_virus	21.9	2.1e-11
WP_029438512.1|1107484_1108723_-	MFS transporter	NA	NA	NA	NA	NA
WP_029438511.1|1109221_1111360_-	PASTA domain-containing protein	NA	NA	NA	NA	NA
WP_061687737.1|1111730_1112330_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_029438510.1|1112576_1113566_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_118991781.1|1113672_1115091_-	HAMP domain-containing histidine kinase	NA	A0A1V0SKH0	Klosneuvirus	22.7	5.7e-07
WP_029438509.1|1115087_1115762_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_029438508.1|1115774_1116305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118991782.1|1116409_1116919_-	GrpB family protein	NA	NA	NA	NA	NA
WP_118991783.1|1117046_1117928_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_029438506.1|1118016_1119285_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.7	3.3e-14
WP_000120182.1|1119377_1119485_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_118991784.1|1119620_1120421_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_029438505.1|1120413_1122114_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.4	2.6e-14
WP_029438503.1|1123035_1123527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167506398.1|1123596_1124115_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_029438501.1|1124896_1125496_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_029438500.1|1126165_1126759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029438499.1|1126751_1127063_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_029438498.1|1127658_1128018_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_029438497.1|1128303_1129479_-	myo-inositol-1-phosphate synthase	NA	NA	NA	NA	NA
WP_029438496.1|1129483_1130806_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_029438495.1|1130838_1131717_-	UbiA-like protein EboC	NA	NA	NA	NA	NA
WP_029438494.1|1131713_1132544_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_029438493.1|1132558_1133356_-	hydrolase TatD	NA	NA	NA	NA	NA
WP_029438492.1|1133369_1134221_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_033694628.1|1134287_1134824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029438490.1|1135150_1136572_-	glucose dehydrogenase	NA	NA	NA	NA	NA
WP_118991658.1|1137465_1138254_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_029438489.1|1140051_1140498_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_029438488.1|1140854_1142432_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_029438487.1|1142825_1143677_+	DUF2935 domain-containing protein	NA	A0A167RKB4	Powai_lake_megavirus	25.1	3.4e-07
WP_118991785.1|1145186_1145549_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029438484.1|1146433_1147600_+	serine hydrolase	NA	G1DB24	Mycobacterium_phage	27.1	1.1e-21
WP_033694627.1|1147896_1148286_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_029438482.1|1148902_1149796_-	cation transporter	NA	NA	NA	NA	NA
WP_029438481.1|1150374_1150941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118991787.1|1150919_1152785_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_033694554.1|1152768_1155138_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_029437265.1|1155628_1156822_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	4.3e-24
1155530:1157109	attR	AAAAAGACCAACTATGAGAAGTCAAGAGGAATTTTATAAATAGGAAACTTAAAAAAGGGTGCACCAAATAACCCTAAGAGATGTAAAAAAATAAAAGTATCAAACTTCTTTTGAATATTGAGGGATTTCATACGGTTTATTGTTTTTAAGGATGGCATAAATAATGTAACACAACTTTCTAGCTACAGCTCCTATACAAACATAGTAGTGTTTTCCTTGTTTTCGTTTCTTCTCATAAAAAGCTTTCAAAACAGGGTCATGTTTATGGGCTGTAATAGCGGCTTGGAATAAGGCTCTACGTAAATGAGAAGAGCCACGCTTAGATATAGACATACCTGATGATTCAAATTGTCCAGATTGGGACACAGAGGCATCAATGCCTGCGTAAGCGACAAGCTTAGATGGTTTGTCAAAGCGGTGTATATCCCCAATTTCACTTAGTATAGTGGCACCTAAAATTGGTCCAACGCCAGGTACTGTCATGATAGGAGTATCTAAATCAATTAAAAGTTGTGACATTTCGTCTTCACATTCTTTGATTTGATCTTCGATAAAACGAATTTGCTCTATCAACATTTTTAGTTGGAAGGAAAAAGCATTTTTACAGAAGGTAACACCAAACGAATTAGAGGCTAATTCCATTAGCTTGTTAGCTGTTTTCTTCCCTAGTCGGTTACGACTGGTTTGCTCAATGATTTGTGTTAAATCATCAATAGATATCTGTTCATAGTCACTAGGAGAGGCATATTCAAGTAAGATTTGCGAAGAAGTTTTACCAAAAACATCCGAAAAGATGCTTTGGTACTCTGGGAAAGTTTGATCTAATACGACAAGAGCTTTTCGTTTTAAATCACTCATATTACTTACAAGCGCATTGCGAAAACGGCTCATTTGTTTTAGAGCGAACATTTTTTCGTCCACAAGTGGGGTTTCAACAAAACGGCCGAATCGAATGATATCGGCAATCATAGTGGCATCAATGGCGTCTGTTTTTCGCTTTCTAATTTCTGTTCCTTTTCGCCAGGCATTGGTTTGAATGGGGTTTAATACAATGACTGAAAATCCATGATCCAGTAGAAAAGAATAAACAGCTAACCAATAATGTCCGGTTGCTTCCATTCCAATCAGTATTTCTGTAGGAGACTCAATGTATTGGTAGATCTGATTTAAAAGGGTTTGTCCACCTTCTTTGTGATTCTGAAAAGGAAATGGCTTAGTAATAGGTTTTCCCGTTTGATCGATAATGGACGCATAATGTTTATGTTTAGCGATATCAATACCTAAATAGAACATAGCTTACACCCCTATTTTAATTAGTGTTAGATAGTGCTTTTCTCCCCTGAACTAATAAGCGCTACTACCTCGTAAGAGATACGAAGAATGGCTAAAAGCCATCAACATCCAACTCATTCGTAAACTACTTATTAGACAGAGGTACCGCTCTTTTTCACGAATACAAAGATTCAGGGAGATGGTCGGCAACACTCTATCTACAAATACCAGTATCTCATAAAAATAGATACCCTTGGGTTTATAGGTACATCCCGTCCCTAAAAACCTAACTTAATCATACGAGGAGA	NA	NA	NA	NA
>prophage 4
NZ_CP041071	Bacillus tropicus strain LM1212-W3 chromosome, complete genome	5631167	1376852	1400028	5631167	transposase,plate,tail,holin	Bacillus_phage(84.21%)	27	NA	NA
WP_029437265.1|1376852_1378046_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	4.3e-24
WP_029438311.1|1378342_1379125_+	arginase	NA	NA	NA	NA	NA
WP_029438309.1|1379799_1381263_-	recombinase family protein	NA	Q2XVV3	Bacillus_phage	54.3	1.3e-142
WP_029438308.1|1381606_1381834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118991798.1|1382115_1382739_-	hypothetical protein	NA	H0USY2	Bacillus_phage	79.6	1.4e-95
WP_029438306.1|1382680_1383871_-	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	64.9	9.8e-146
WP_029438305.1|1383986_1384169_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	88.3	1.5e-21
WP_029438304.1|1384165_1384468_-	hypothetical protein	NA	A0A288WG38	Bacillus_phage	54.1	3.4e-26
WP_029438303.1|1384467_1384734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000669091.1|1384919_1385120_+	helix-turn-helix transcriptional regulator	NA	Q2I8E4	Bacillus_phage	53.0	2.4e-12
WP_118991799.1|1385765_1385888_-	DUF3961 domain-containing protein	NA	Q3HKZ4	Bacillus_phage	59.5	2.4e-07
WP_029438302.1|1385875_1386226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033694537.1|1386405_1386645_+	helix-turn-helix transcriptional regulator	NA	A0A288WFZ7	Bacillus_phage	67.1	2.0e-21
WP_029438300.1|1386721_1387054_+	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	43.5	7.0e-17
WP_029438299.1|1387075_1387357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029438298.1|1387423_1388179_-	N-acetylmuramoyl-L-alanine amidase	NA	S5M842	Bacillus_phage	75.3	8.5e-103
WP_029438297.1|1388195_1388426_-|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	75.0	2.2e-25
WP_029438296.1|1388440_1388725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162901159.1|1388761_1388908_-	hypothetical protein	NA	A0A2H4JFI6	uncultured_Caudovirales_phage	81.2	8.3e-15
WP_029438295.1|1388925_1389483_-	hypothetical protein	NA	D2XPZ8	Bacillus_virus	70.1	8.3e-71
WP_118991800.1|1389497_1390907_-|plate	BppU family phage baseplate upper protein	plate	A0A1B1P836	Bacillus_phage	34.7	8.9e-45
WP_118991658.1|1390864_1391654_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_029438291.1|1391692_1391926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033694535.1|1391948_1392206_-	hypothetical protein	NA	A0A1B1P7E8	Bacillus_phage	76.5	1.2e-32
WP_029438290.1|1392232_1394611_-	hypothetical protein	NA	A0A1B1P7E6	Bacillus_phage	35.1	1.9e-180
WP_029438289.1|1394607_1396119_-|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	58.0	1.1e-160
WP_118991870.1|1396131_1400028_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	41.3	3.9e-42
>prophage 5
NZ_CP041071	Bacillus tropicus strain LM1212-W3 chromosome, complete genome	5631167	1405148	1420137	5631167	transposase,portal,terminase	Bacillus_phage(41.67%)	22	NA	NA
WP_029438278.1|1405148_1405931_-	scaffolding protein	NA	Q4ZC70	Staphylococcus_virus	40.9	7.4e-09
WP_029438277.1|1405989_1407507_-|portal	phage portal protein	portal	A0A142F1L7	Bacillus_phage	30.0	4.0e-67
WP_029438276.1|1407523_1409239_-|terminase	phage terminase large subunit	terminase	A0A142F1L6	Bacillus_phage	53.9	1.3e-154
WP_001086031.1|1409255_1409684_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	51.1	1.5e-32
WP_029438273.1|1409878_1410442_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	46.0	1.3e-34
WP_029438272.1|1410841_1411231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029438271.1|1411489_1411816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029438270.1|1411963_1412143_-	hypothetical protein	NA	A0A1B1P7M4	Bacillus_phage	64.0	3.3e-13
WP_029438269.1|1412139_1412667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033694534.1|1412644_1413103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029438267.1|1413105_1413303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029438266.1|1413299_1413497_-	hypothetical protein	NA	A0A1L2JY50	Aeribacillus_phage	49.1	8.6e-07
WP_029438265.1|1413501_1413780_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.0	5.1e-13
WP_029438264.1|1413804_1413999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033694533.1|1414117_1414264_-	BC1881 family protein	NA	NA	NA	NA	NA
WP_029438263.1|1414266_1415244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029438262.1|1415260_1415578_-	transglycosylase	NA	NA	NA	NA	NA
WP_050587870.1|1415593_1416241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029438260.1|1416237_1416648_-	hypothetical protein	NA	S5MUC4	Brevibacillus_phage	59.3	1.3e-12
WP_118991801.1|1416690_1418232_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	38.4	4.3e-117
WP_029438259.1|1418262_1418460_-	hypothetical protein	NA	A0A1B1P7W9	Bacillus_phage	76.9	1.9e-22
WP_029440585.1|1418943_1420137_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	24.8	9.6e-24
>prophage 6
NZ_CP041071	Bacillus tropicus strain LM1212-W3 chromosome, complete genome	5631167	1688581	1695960	5631167		Bacillus_phage(50.0%)	7	NA	NA
WP_118991811.1|1688581_1690477_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	25.4	5.4e-45
WP_098224425.1|1690473_1691121_-	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	31.2	2.3e-11
WP_029439504.1|1691230_1691992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087986843.1|1692795_1693182_+	hypothetical protein	NA	A0A1C8E993	Bacillus_phage	65.6	2.5e-42
WP_029439502.1|1693216_1694020_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	78.0	3.8e-85
WP_080449872.1|1694444_1694855_-	hypothetical protein	NA	D2XR44	Bacillus_phage	88.8	3.7e-52
WP_000427791.1|1695684_1695960_-	stage V sporulation protein SpoVS	NA	A0A1J0GVV0	Streptomyces_phage	43.4	8.4e-08
>prophage 7
NZ_CP041071	Bacillus tropicus strain LM1212-W3 chromosome, complete genome	5631167	1865058	1874377	5631167		Bacillus_phage(71.43%)	9	NA	NA
WP_029439370.1|1865058_1865931_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	45.1	1.1e-66
WP_029439369.1|1866064_1866736_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	92.7	3.7e-65
WP_000818985.1|1866883_1867603_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_029439368.1|1867798_1868386_+	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_029439367.1|1868409_1869483_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	89.9	2.0e-174
WP_118991871.1|1869479_1870166_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	94.3	2.7e-119
WP_000453899.1|1870245_1872006_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	96.9	1.1e-270
WP_001194292.1|1872246_1873011_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_029439365.1|1873108_1874377_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	32.0	7.6e-11
>prophage 8
NZ_CP041071	Bacillus tropicus strain LM1212-W3 chromosome, complete genome	5631167	2059253	2130103	5631167	plate,capsid,portal,holin,terminase,integrase,protease,transposase	Bacillus_phage(86.96%)	78	2059203:2059262	2130095:2130944
2059203:2059262	attL	AGAACCTGTCTAAAATCTATGGTATACTCTGTGTAAAAAAGGATGATTTCCATGATACAC	NA	NA	NA	NA
WP_118991658.1|2059253_2060042_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_000039582.1|2060610_2060955_-	DUF2294 domain-containing protein	NA	NA	NA	NA	NA
WP_029439227.1|2061070_2061553_-	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_118991825.1|2064188_2065013_+	HTH domain-containing protein	NA	A0A2H4J969	uncultured_Caudovirales_phage	75.0	3.2e-111
WP_033694722.1|2065022_2065643_-	phage protein	NA	H0USY2	Bacillus_phage	84.0	8.0e-99
WP_029439224.1|2065584_2066766_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	82.7	1.4e-189
WP_029439223.1|2066881_2067064_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	1.0e-22
WP_029439222.1|2067060_2067378_-	hypothetical protein	NA	H0USY0	Bacillus_phage	95.2	3.5e-50
WP_029439221.1|2067581_2067785_+	helix-turn-helix transcriptional regulator	NA	Q2I8E4	Bacillus_phage	51.5	2.4e-12
WP_029439220.1|2067789_2068368_+	type IV secretory system conjugative DNA transfer family protein	NA	A0A288WFT6	Bacillus_phage	72.6	1.0e-79
WP_029439219.1|2068434_2069187_-	N-acetylmuramoyl-L-alanine amidase	NA	S5M842	Bacillus_phage	74.0	5.2e-100
WP_029439218.1|2069203_2069434_-|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	92.1	5.3e-32
WP_001115042.1|2069476_2069716_-	peptidase	NA	A0A1B1P7E0	Bacillus_phage	100.0	7.4e-37
WP_029439217.1|2069731_2070691_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR30	Bacillus_phage	94.4	1.8e-174
WP_029440627.1|2070848_2072573_-|plate	BppU family phage baseplate upper protein	plate	A0A2H4J855	uncultured_Caudovirales_phage	54.0	2.0e-38
WP_029440626.1|2072562_2075178_-	hypothetical protein	NA	A0A2H4JFY7	uncultured_Caudovirales_phage	52.2	5.3e-277
WP_029440625.1|2075174_2075861_-	hypothetical protein	NA	A0A2H4J851	uncultured_Caudovirales_phage	62.3	2.0e-82
WP_118991872.1|2075853_2078703_-	hypothetical protein	NA	A0A1B1P764	Bacillus_phage	85.1	1.8e-209
WP_029440472.1|2078926_2080759_-	hypothetical protein	NA	A0A1B1P775	Bacillus_phage	98.9	6.0e-134
WP_029440473.1|2080937_2081399_-	hypothetical protein	NA	A0A1B1P772	Bacillus_phage	94.1	2.1e-75
WP_029440474.1|2081472_2082060_-	hypothetical protein	NA	A0A1B1P778	Bacillus_phage	86.6	1.3e-95
WP_029440475.1|2082060_2082489_-	hypothetical protein	NA	A0A1B1P769	Bacillus_phage	97.9	2.3e-73
WP_033694907.1|2082475_2082853_-	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	72.8	2.8e-46
WP_029440477.1|2082827_2083226_-	hypothetical protein	NA	A0A1B1P760	Bacillus_phage	77.1	3.9e-46
WP_029440478.1|2083206_2083506_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	87.6	2.1e-41
WP_029440479.1|2083515_2083740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029440480.1|2083754_2084918_-|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	44.1	2.3e-86
WP_118991826.1|2084959_2085679_-|protease	Clp protease ClpP	protease	A0A2H4JC91	uncultured_Caudovirales_phage	49.4	1.0e-52
WP_118991827.1|2085665_2086832_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	93.8	5.6e-210
WP_118991719.1|2086846_2088529_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	94.3	9.3e-312
WP_029440482.1|2088512_2088833_-	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	85.8	4.2e-43
WP_029437246.1|2088939_2089239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029437245.1|2089242_2089554_-	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	68.0	3.8e-33
WP_029437244.1|2089564_2089906_-	hypothetical protein	NA	A0A1B1P7D2	Bacillus_phage	35.2	9.7e-06
WP_029437243.1|2089907_2090225_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	55.1	2.3e-09
WP_050587850.1|2090238_2090472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029437241.1|2090673_2090886_-	cell division protein FtsK	NA	A0A1B1P7C1	Bacillus_phage	39.1	2.2e-08
WP_029439665.1|2091490_2092033_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P746	Bacillus_phage	91.1	2.3e-89
WP_029439666.1|2092029_2092500_-	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	63.2	7.5e-49
WP_033694766.1|2092520_2092691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029437265.1|2092986_2094180_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	4.3e-24
WP_029439667.1|2094365_2094548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033694767.1|2094567_2094690_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_029439668.1|2094739_2095165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029439669.1|2095200_2095509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162901164.1|2095892_2096060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016098383.1|2096287_2096452_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	98.1	2.9e-24
WP_029439670.1|2096502_2096769_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	85.2	4.1e-36
WP_050587941.1|2096765_2097068_-	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	51.6	2.0e-18
WP_029439672.1|2097071_2097878_-	ATP-binding protein	NA	D2XQ17	Bacillus_virus	81.6	1.8e-122
WP_029439673.1|2098995_2099643_-	sigma-70 family RNA polymerase sigma factor	NA	H0USU1	Bacillus_phage	84.7	2.6e-100
WP_029439674.1|2099898_2100231_-	hypothetical protein	NA	W8CYU1	Bacillus_phage	88.9	1.5e-43
WP_029439675.1|2100393_2101188_-	antirepressor	NA	A0A0S2GLP8	Bacillus_phage	93.6	4.9e-133
WP_000788399.1|2101225_2101381_-	hypothetical protein	NA	I7J4K2	Bacillus_phage	96.1	2.6e-22
WP_029439676.1|2101400_2101589_-	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	93.5	6.7e-25
WP_000819158.1|2101656_2101863_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_029439677.1|2102032_2102377_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	41.5	6.1e-16
WP_134981279.1|2102373_2102553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029439678.1|2102777_2103998_-	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	49.5	2.2e-108
WP_029439679.1|2104738_2105830_+|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	79.3	1.8e-162
WP_029439680.1|2105803_2106529_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_029439681.1|2106943_2108482_+	spore germination protein GerSA	NA	NA	NA	NA	NA
WP_029439682.1|2108478_2109576_+	endospore germination permease	NA	NA	NA	NA	NA
WP_118991829.1|2109576_2110713_+	spore germination protein GerSC	NA	NA	NA	NA	NA
WP_001116178.1|2110791_2110926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029439683.1|2110983_2114346_-	phosphonate ABC transporter permease	NA	NA	NA	NA	NA
WP_029439684.1|2114424_2116524_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_029439685.1|2116781_2117120_-	VOC family protein	NA	NA	NA	NA	NA
WP_029439686.1|2117190_2117526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029439687.1|2117660_2118056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029439688.1|2118097_2118817_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_029439689.1|2118930_2120637_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000728446.1|2120917_2122624_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_029439690.1|2123000_2124713_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_118991830.1|2126528_2127566_-	LCP family protein	NA	NA	NA	NA	NA
WP_029439691.1|2127583_2128612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000864744.1|2128624_2129158_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_118991658.1|2129313_2130103_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
2130095:2130944	attR	GTGTATCATGGAAATCATCCTTTTTTACACAGAGTATACCATAGATTTTAGACAGGTTCTAAGGAAATATCCATCTGGATCCACGACTTTAAATCCTCTCATCTCCCACGGATAAGTTTGAATTTCTTCTTGTATTGTGCATCGCTTCTCTTTACAACGTTCATATACGTCTTCAATGCGGTCGACAACAATAATTAGTTCAAATCCATTCCCTTTCATTTCTTTTCGATCGTAAAAATTGTGATTTTCACTCAATGTTGAATCATTAGCTAGTAATAGCGAAAACTAATCGTAATTAAAACGCGCTGCGTACATACTTCTTTTATACAGCTTTAAACCAATTACTTCTCCATAGAACAATAATGACTTTTCGATATCATTTACATATAGCTGAACCCGGAACCAATGATTCATCCATTTCCTCCTCATCAAAAAAAGCCCACTTTTCCAGTGGACTTTCTACTTTACAACGGTAAATCCCTCTTCTTAAACACTATAATTGCTACTATGAAAATACAAAGTGCTCCAGCTGTTAAACCTATACTCACTGGCCATATATTATACGTTCCCTCAGCAATTTCTTTCGGACGAAATAGCGTAAATAATGATATATTTCTCATCCACTCTAACTTATCACTTAATTTACCTACCATATCCGTTACGAAAAATAAAATGGTTAAACTTGCTGAGTAGCTAAGTGCCTTTCTTTCGTCATTACATATACAAGAAAAGAAAAATGAATACGCACTAACGACGAAAAATATGAGCCCTCCAACTATATTTATCTTCAGGAATAATTCTTTATTTAAGTTATTATCTTGTAAAAACCATTCCGCACCTACTATGCCCG	NA	NA	NA	NA
>prophage 9
NZ_CP041071	Bacillus tropicus strain LM1212-W3 chromosome, complete genome	5631167	2474384	2545322	5631167	capsid,portal,transposase,head,terminase,tail,protease,integrase,tRNA	Bacillus_phage(79.63%)	95	2466573:2466589	2539797:2539813
2466573:2466589	attL	TTCTTTACGAATAATTC	NA	NA	NA	NA
WP_029439624.1|2474384_2477150_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	26.8	2.0e-85
WP_001131611.1|2477499_2478006_-	septum site-determining protein DivIVA	NA	NA	NA	NA	NA
WP_029439625.1|2478095_2478863_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_029439626.1|2478878_2479142_-	YggT family protein	NA	NA	NA	NA	NA
WP_000119137.1|2479148_2479619_-	cell division protein SepF	NA	NA	NA	NA	NA
WP_029439627.1|2479638_2480313_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_029439628.1|2480309_2481128_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_001980616.1|2481246_2481531_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_000197753.1|2481677_2482457_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.5	5.8e-46
WP_000976948.1|2482614_2483334_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	42.9	3.3e-19
WP_029439629.1|2483353_2484271_-	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
WP_000888991.1|2484585_2485740_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_001087553.1|2485779_2487087_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_000798232.1|2487487_2488258_-	cell division protein DivIB	NA	NA	NA	NA	NA
WP_029439630.1|2488356_2489262_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_001265416.1|2489323_2490418_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_000753510.1|2490523_2491615_-	stage V sporulation protein E	NA	NA	NA	NA	NA
WP_029439631.1|2491705_2493058_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_000893059.1|2493058_2494033_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_029439632.1|2494055_2495531_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_001266226.1|2495735_2497652_-	stage V sporulation protein D	NA	NA	NA	NA	NA
WP_029439633.1|2497733_2499833_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_000067082.1|2499905_2500268_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_029439634.1|2500283_2501216_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_118991640.1|2501585_2503202_-	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
WP_029439635.1|2503281_2504172_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_029439636.1|2504466_2504940_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000246480.1|2504973_2505480_-	RsfA family transcriptional regulator	NA	G3MB11	Bacillus_virus	34.7	5.1e-11
WP_001984764.1|2505609_2505783_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_140611837.1|2505844_2506345_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_118991641.1|2506618_2507236_-	hypothetical protein	NA	Q2LIA9	Bacillus_phage	78.1	1.2e-81
WP_029439637.1|2507177_2508362_-	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	60.9	2.6e-138
WP_029439638.1|2508480_2508663_-	hypothetical protein	NA	A0A288WGN6	Bacillus_phage	78.3	3.1e-19
WP_029439639.1|2508659_2508956_-	hypothetical protein	NA	A0A288WG38	Bacillus_phage	52.6	1.2e-23
WP_001237238.1|2509140_2509353_+	helix-turn-helix transcriptional regulator	NA	Q2I8E4	Bacillus_phage	100.0	2.7e-30
WP_029439640.1|2509345_2509837_+	hypothetical protein	NA	Q3HL01	Bacillus_phage	98.2	1.2e-76
WP_029439641.1|2509893_2510691_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	69.8	1.8e-111
WP_029439642.1|2510690_2510897_-	hypothetical protein	NA	D2XR32	Bacillus_phage	89.7	2.6e-30
WP_000818882.1|2510905_2511145_-	peptidase	NA	A0A1B1P7E0	Bacillus_phage	86.1	8.0e-31
WP_029439643.1|2511235_2511568_-	hypothetical protein	NA	A0A1B2APY3	Phage_Wrath	60.7	8.8e-28
WP_029439644.1|2511631_2513122_-	hypothetical protein	NA	A0A0S2SXW1	Bacillus_phage	41.0	1.6e-31
WP_029439645.1|2513180_2514800_-	hypothetical protein	NA	A0A0K1LLF9	Bacillus_phage	38.3	3.6e-98
WP_029439646.1|2514815_2515679_-|tail	phage tail family protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	56.0	1.7e-75
WP_029439647.1|2515683_2520198_-	hypothetical protein	NA	A6XMK6	Bacillus_virus	52.9	1.6e-111
WP_029439648.1|2520376_2520838_-	hypothetical protein	NA	A0A1B1P772	Bacillus_phage	61.8	2.5e-49
WP_029439649.1|2520905_2521493_-	hypothetical protein	NA	A0A1B1P778	Bacillus_phage	85.1	3.6e-93
WP_029439650.1|2521494_2521923_-	hypothetical protein	NA	A0A1B1P769	Bacillus_phage	85.1	1.3e-63
WP_033694784.1|2521909_2522287_-	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	76.8	2.1e-46
WP_098142341.1|2522303_2522660_-|head,tail	phage head-tail adapter protein	head,tail	A0A1B1P760	Bacillus_phage	86.4	2.2e-53
WP_029439653.1|2522640_2522940_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	84.5	6.2e-41
WP_029439654.1|2522949_2523189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029439655.1|2523203_2524355_-|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	93.5	1.5e-204
WP_029439656.1|2524383_2525109_-|protease	Clp protease ClpP	protease	A0A1B1P753	Bacillus_phage	82.6	7.9e-106
WP_118991642.1|2525110_2526277_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	92.0	1.6e-204
WP_029439657.1|2526291_2527974_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	94.4	1.2e-311
WP_029439658.1|2527957_2528278_-	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	85.8	1.7e-44
WP_029439659.1|2528385_2528694_-	hypothetical protein	NA	A0A1B1P767	Bacillus_phage	90.4	5.6e-45
WP_033694765.1|2528696_2529002_-	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	95.0	1.4e-51
WP_029439661.1|2529004_2529256_-	hypothetical protein	NA	A0A1B1P743	Bacillus_phage	52.4	9.3e-14
WP_029439662.1|2529260_2529557_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	50.0	1.2e-07
WP_029439663.1|2529563_2529788_-	hypothetical protein	NA	A0A1B1P745	Bacillus_phage	85.1	6.1e-25
WP_158001557.1|2529793_2529952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029439664.1|2530321_2530876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162901141.1|2530909_2531065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029439665.1|2531266_2531809_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P746	Bacillus_phage	91.1	2.3e-89
WP_029439666.1|2531805_2532276_-	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	63.2	7.5e-49
WP_033694766.1|2532296_2532467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029437265.1|2532762_2533956_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	4.3e-24
WP_029439667.1|2534141_2534324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033694767.1|2534343_2534466_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_029439668.1|2534515_2534941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029439669.1|2534976_2535285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029438025.1|2535653_2535902_-	helix-turn-helix transcriptional regulator	NA	A0A0U3J7D7	Bacillus_phage	89.0	4.2e-35
WP_029438026.1|2536018_2536228_-	hypothetical protein	NA	A0A1B1P8C8	Bacillus_phage	68.8	6.8e-18
WP_033694511.1|2536253_2536433_-	hypothetical protein	NA	A0A1B1P7M8	Bacillus_phage	94.5	9.2e-24
WP_029438027.1|2536432_2536630_-	hypothetical protein	NA	A0A097BYE4	Leuconostoc_phage	38.7	6.2e-05
WP_029438028.1|2536667_2536961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167506397.1|2537053_2537194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029438029.1|2537798_2537990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029437230.1|2538031_2538514_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	49.5	1.5e-20
WP_000109490.1|2538533_2538785_-	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	42.2	4.9e-07
WP_000717826.1|2538810_2538978_-	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.4e-13
WP_001125952.1|2538996_2539356_-	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	53.3	1.1e-31
WP_029438030.1|2539348_2539627_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	64.4	3.5e-14
WP_029438031.1|2539643_2539838_-	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	81.2	1.9e-22
2539797:2539813	attR	TTCTTTACGAATAATTC	NA	NA	NA	NA
WP_029438032.1|2539840_2540704_-	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	71.1	1.3e-102
WP_029438033.1|2540645_2541521_-	replication protein	NA	V5UQV4	Oenococcus_phage	38.3	4.2e-37
WP_033694513.1|2541526_2541703_-	hypothetical protein	NA	A0A1B1P7U0	Bacillus_phage	82.8	6.5e-22
WP_033694514.1|2541732_2541897_-	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	85.2	1.1e-18
WP_000284333.1|2541953_2542154_-	helix-turn-helix domain-containing protein	NA	A0A0U4IIS1	Bacillus_phage	48.0	3.9e-07
WP_029438034.1|2542206_2542431_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000153812.1|2542649_2543018_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	39.6	4.1e-10
WP_000719898.1|2543281_2543431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029438035.1|2543443_2544541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029438036.1|2544977_2545322_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	36.6	6.1e-16
>prophage 10
NZ_CP041071	Bacillus tropicus strain LM1212-W3 chromosome, complete genome	5631167	2990043	3050406	5631167	transposase,tRNA,protease,coat	Bacillus_phage(18.18%)	59	NA	NA
WP_029437265.1|2990043_2991237_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	4.3e-24
WP_000349152.1|2991421_2991805_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_001068065.1|2991841_2992102_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.5	1.3e-05
WP_000125362.1|2992129_2993269_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.1	2.5e-82
WP_000354028.1|2993281_2994334_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_000138162.1|2994353_2994554_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_000344453.1|2994550_2995552_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.3	5.2e-07
WP_000464508.1|2995557_2996175_-	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
WP_029440005.1|2996363_2997308_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_029440006.1|2997321_2997849_-	BofC protein	NA	NA	NA	NA	NA
WP_029440007.1|2997969_2998899_-	DMT family transporter	NA	NA	NA	NA	NA
WP_029440008.1|2998965_2999286_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_118991648.1|2999729_3000164_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_029440010.1|3000198_3000840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118991649.1|3001020_3002949_-|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
WP_029440012.1|3003169_3004276_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_029440013.1|3004306_3005140_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_029440014.1|3005159_3006689_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_029440015.1|3006840_3007983_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	30.1	1.1e-32
WP_000812272.1|3007982_3008525_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_029440016.1|3008604_3009252_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000621725.1|3009489_3010341_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_029440017.1|3010437_3012348_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_029440018.1|3012397_3014320_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000114530.1|3014294_3015071_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	1.7e-29
WP_029440019.1|3015164_3016247_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_029440020.1|3016236_3016944_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_029440021.1|3017083_3018370_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_029440022.1|3018369_3018918_-	sporulation protein	NA	NA	NA	NA	NA
WP_000944957.1|3018981_3019272_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_001973720.1|3019275_3019620_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000270907.1|3019631_3019940_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_029440023.1|3020109_3021498_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_029440024.1|3021565_3022426_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_029440025.1|3022418_3023165_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000503310.1|3023298_3024096_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000391517.1|3024098_3024785_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_029440026.1|3024820_3025366_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_029440027.1|3025380_3026232_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000466737.1|3026273_3027293_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_001013370.1|3027450_3028128_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_001226285.1|3028174_3028750_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_029440028.1|3028971_3029934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029440029.1|3030099_3031401_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_029440030.1|3031494_3034140_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.7	8.0e-164
WP_029440031.1|3034534_3035560_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_029440032.1|3035622_3036600_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_000712928.1|3036709_3037999_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	34.1	1.7e-05
WP_029440033.1|3037998_3038988_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_029440034.1|3039057_3039810_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_029440035.1|3039812_3040742_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_000008996.1|3040757_3041591_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_029440036.1|3041608_3042943_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_029440037.1|3043359_3043812_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000359781.1|3043814_3044231_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_029440038.1|3044262_3044859_-	ribosome biogenesis GTP-binding protein YsxC	NA	NA	NA	NA	NA
WP_029440039.1|3044855_3047186_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.8	1.0e-178
WP_029440040.1|3047369_3049040_-|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	33.0	7.4e-14
WP_000472281.1|3049146_3050406_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	66.1	7.7e-149
>prophage 11
NZ_CP041071	Bacillus tropicus strain LM1212-W3 chromosome, complete genome	5631167	3095823	3103502	5631167		Staphylococcus_phage(16.67%)	10	NA	NA
WP_029440066.1|3095823_3096747_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	47.8	2.4e-46
WP_029440067.1|3096872_3097808_-	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	25.9	4.3e-11
WP_029440068.1|3097809_3098502_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.7	4.8e-36
WP_033694813.1|3098670_3098844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001014310.1|3098844_3099039_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001255958.1|3099078_3100278_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	6.1e-71
WP_029440069.1|3100573_3100897_+	heme oxygenase	NA	NA	NA	NA	NA
WP_029440070.1|3100962_3101727_-	class B sortase	NA	NA	NA	NA	NA
WP_029440071.1|3101758_3102529_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.4	1.7e-05
WP_001036835.1|3102518_3103502_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	7.1e-17
>prophage 12
NZ_CP041071	Bacillus tropicus strain LM1212-W3 chromosome, complete genome	5631167	3335868	3383339	5631167	transposase	Staphylococcus_phage(22.22%)	52	NA	NA
WP_029437205.1|3335868_3337281_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_029440214.1|3338594_3339815_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_029440215.1|3339811_3341068_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_029440216.1|3341421_3342231_+	alpha/beta hydrolase	NA	A0A0B5A484	Mycobacterium_phage	27.3	5.9e-09
WP_033694832.1|3342435_3344580_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_029440218.1|3344814_3345045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000455572.1|3345056_3345353_-	DUF3986 family protein	NA	NA	NA	NA	NA
WP_029440219.1|3345473_3346481_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_029440220.1|3346492_3347257_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.0	7.4e-38
WP_000368783.1|3347249_3348056_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000849109.1|3348090_3348318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029440222.1|3348532_3349648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029440223.1|3349741_3350416_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_118991659.1|3350549_3351339_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_000276389.1|3351958_3352438_-	antimutator 8-oxo-(dGTP/GTP)ase	NA	A0A2H4PQM4	Staphylococcus_phage	33.3	2.8e-19
WP_029440224.1|3352522_3352840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000472802.1|3352923_3353073_+	YtzI protein	NA	NA	NA	NA	NA
WP_029440225.1|3353283_3353514_+	YczI family protein	NA	NA	NA	NA	NA
WP_029440226.1|3353844_3354084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001141369.1|3354397_3354871_-	S-ribosylhomocysteine lyase LuxS	NA	NA	NA	NA	NA
WP_000809327.1|3354999_3355236_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	72.6	2.4e-27
WP_000838161.1|3355232_3355796_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_029440227.1|3356020_3357370_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_029440228.1|3357359_3358388_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_001141559.1|3358554_3358770_-	spore germination protein	NA	NA	NA	NA	NA
WP_029440229.1|3358870_3359677_-	S-layer protein	NA	NA	NA	NA	NA
WP_029440230.1|3360385_3361420_+	YdcF family protein	NA	NA	NA	NA	NA
WP_029440231.1|3361494_3361812_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000411240.1|3362053_3362926_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	34.6	8.2e-33
WP_029440232.1|3363049_3363265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071191.1|3363365_3364181_-	DUF4247 domain-containing protein	NA	NA	NA	NA	NA
WP_029440233.1|3364193_3364700_-	DUF4178 domain-containing protein	NA	NA	NA	NA	NA
WP_000220322.1|3364721_3365126_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_029440234.1|3365206_3365872_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_029440235.1|3366274_3366853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029440236.1|3366887_3367058_-	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_029440237.1|3367074_3369063_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_000060512.1|3369059_3369287_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_118991843.1|3369531_3370725_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_118991844.1|3371132_3372326_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_029440240.1|3372935_3373604_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_029440241.1|3373812_3375666_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.2	9.6e-31
WP_029440242.1|3375662_3376352_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	5.3e-35
WP_029440243.1|3376391_3377012_-	class D sortase	NA	NA	NA	NA	NA
WP_029440244.1|3377101_3377545_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_029440245.1|3377722_3378055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002156638.1|3378239_3378455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001019304.1|3378615_3379143_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	31.8	1.7e-12
WP_000167905.1|3379329_3380232_+	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_029440246.1|3380311_3380992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029440247.1|3381172_3382132_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	27.8	4.5e-16
WP_118991658.1|3382549_3383339_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP041071	Bacillus tropicus strain LM1212-W3 chromosome, complete genome	5631167	3471149	3549442	5631167	capsid,portal,coat,transposase,head,terminase,tail,protease,integrase,tRNA	Bacillus_phage(46.0%)	92	3492969:3492986	3553012:3553029
WP_029440495.1|3471149_3472526_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	28.1	2.6e-49
WP_029440496.1|3472565_3472949_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_029440497.1|3473044_3473788_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_029440498.1|3473838_3474420_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_029440499.1|3474461_3475349_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.7	7.7e-79
WP_029440500.1|3475457_3477182_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.4	5.2e-180
WP_001158742.1|3477325_3477931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029440501.1|3478014_3479499_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	8.7e-59
WP_029440502.1|3479643_3480270_-	3D domain-containing protein	NA	A0A0H3UZG2	Geobacillus_virus	43.9	9.5e-15
WP_029440503.1|3480356_3480674_-	membrane protein	NA	NA	NA	NA	NA
WP_029440504.1|3480670_3481177_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000856614.1|3481299_3482508_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000829779.1|3482970_3483960_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	3.0e-31
WP_029440505.1|3484086_3484563_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391915.1|3484894_3486142_+	MFS transporter	NA	NA	NA	NA	NA
WP_029440506.1|3486152_3487040_-	decarboxylase	NA	NA	NA	NA	NA
WP_029440507.1|3487120_3487582_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_029440508.1|3487904_3488969_+	hypothetical protein	NA	A0A0S2MVF4	Bacillus_phage	48.8	9.2e-10
WP_029440509.1|3489117_3489309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029440510.1|3489322_3489589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029440511.1|3489981_3491157_-	serine hydrolase	NA	R4JG75	Mycobacterium_phage	28.5	1.2e-26
WP_140611869.1|3492089_3493214_+	hypothetical protein	NA	NA	NA	NA	NA
3492969:3492986	attL	GATGATGCAGCAACTACA	NA	NA	NA	NA
WP_029440513.1|3493317_3494385_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	91.8	4.3e-193
WP_000253960.1|3494381_3494621_-	hypothetical protein	NA	A0A2H4J378	uncultured_Caudovirales_phage	97.5	1.5e-32
WP_029440514.1|3494620_3494857_-	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	97.4	1.2e-18
WP_029440515.1|3495266_3499262_-	peptidase S74	NA	Q2LIB7	Bacillus_phage	85.3	0.0e+00
WP_029440516.1|3499258_3500749_-|tail	phage tail protein	tail	Q2LIB8	Bacillus_phage	93.8	3.3e-276
WP_029440517.1|3500754_3504615_-|tail	phage tail tape measure protein	tail	Q2I8F0	Bacillus_phage	91.1	0.0e+00
WP_158001569.1|3504629_3504806_-	hypothetical protein	NA	I3WTY5	Bacillus_phage	89.7	2.9e-22
WP_029440518.1|3504835_3505153_-	hypothetical protein	NA	A0A288WFU2	Bacillus_phage	100.0	1.2e-53
WP_000896773.1|3505202_3505811_-|tail	tail protein	tail	A0A288WG55	Bacillus_phage	98.5	1.1e-103
WP_029440519.1|3505811_3506171_-	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	95.0	2.7e-59
WP_029440520.1|3506167_3506605_-	HK97 gp10 family phage protein	NA	A0A288WGM7	Bacillus_phage	99.3	1.0e-76
WP_029440521.1|3506597_3506921_-|head	phage head closure protein	head	H0USW8	Bacillus_phage	92.5	7.0e-54
WP_000244596.1|3506917_3507196_-|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	94.6	5.8e-41
WP_029440522.1|3507216_3508389_-|capsid	phage major capsid protein	capsid	A0A2H4J387	uncultured_Caudovirales_phage	88.5	3.0e-195
WP_029440523.1|3508426_3509137_-|protease	Clp protease ClpP	protease	A0A0S2GLD5	Bacillus_phage	96.2	1.3e-124
WP_000577482.1|3509123_3510377_-|portal	phage portal protein	portal	A0A2H4J371	uncultured_Caudovirales_phage	97.4	1.7e-236
WP_029440524.1|3510565_3512260_-|terminase	terminase large subunit	terminase	A0A2H4JB98	uncultured_Caudovirales_phage	99.6	0.0e+00
WP_029440525.1|3512261_3512765_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4J8E3	uncultured_Caudovirales_phage	99.4	6.7e-88
WP_029440526.1|3512873_3513248_-	HNH endonuclease	NA	H0USW1	Bacillus_phage	88.5	2.0e-60
WP_029440527.1|3513237_3513492_-	hypothetical protein	NA	A0A0S2GLL6	Bacillus_phage	88.1	3.8e-39
WP_029440528.1|3513492_3513747_-	hypothetical protein	NA	A0A1B1P7X2	Bacillus_phage	59.3	2.8e-18
WP_029440529.1|3513769_3513991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029440530.1|3514205_3514595_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	57.4	3.5e-36
WP_162901144.1|3514778_3514916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033694916.1|3515252_3515519_-	hypothetical protein	NA	A0A0H3V0M3	Geobacillus_virus	51.2	1.3e-13
WP_118991662.1|3515562_3515721_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_029440531.1|3515734_3516274_-	nuclease	NA	A0A0S2SXQ1	Bacillus_phage	54.2	3.5e-50
WP_029440532.1|3516276_3516705_-	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	69.5	1.5e-56
WP_029440533.1|3516692_3516932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029440534.1|3517257_3519600_-	DNA primase	NA	A0A2H4J990	uncultured_Caudovirales_phage	84.7	0.0e+00
WP_029440535.1|3519671_3520148_-	DUF669 domain-containing protein	NA	A0A1B2AQ07	Phage_Wrath	46.9	3.0e-29
WP_029440536.1|3520147_3520849_-	AAA family ATPase	NA	A0A2H4JHI2	uncultured_Caudovirales_phage	58.1	1.6e-71
WP_029440537.1|3520849_3521044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162901145.1|3521040_3521217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029440538.1|3521194_3521431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029440539.1|3521704_3521905_-	hypothetical protein	NA	A0A1B1P7L2	Bacillus_phage	56.5	7.7e-11
WP_118991663.1|3522167_3522956_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_029440542.1|3522953_3523565_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	68.0	2.7e-75
WP_000277639.1|3523585_3523774_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	75.8	9.4e-19
WP_001025461.1|3523785_3523983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162901146.1|3524003_3524159_-	hypothetical protein	NA	A0A2H4J977	uncultured_Caudovirales_phage	76.0	6.8e-15
WP_000817630.1|3524178_3524499_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_029440543.1|3524677_3525016_+	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	35.2	1.4e-09
WP_029440544.1|3525166_3526618_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_033694917.1|3526739_3526916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162901147.1|3527057_3527207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033694929.1|3527203_3528343_-	hypothetical protein	NA	H0UST6	Bacillus_phage	65.3	1.0e-139
WP_050587961.1|3528571_3528757_-	hypothetical protein	NA	H0UST5	Bacillus_phage	70.5	8.1e-15
WP_029440546.1|3529862_3530924_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	83.6	2.1e-171
WP_029440547.1|3531011_3531365_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	39.5	3.2e-12
WP_029440548.1|3532089_3532653_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000573821.1|3532759_3533113_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	43.3	6.3e-16
WP_000077386.1|3533154_3534021_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000595026.1|3534266_3534506_-	YuzB family protein	NA	NA	NA	NA	NA
WP_029440549.1|3534858_3535929_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_029440550.1|3536160_3536334_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_029440551.1|3536388_3537048_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.2	1.2e-23
WP_029440552.1|3537031_3537829_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000212737.1|3537969_3538311_-	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
WP_029440553.1|3538847_3539525_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_118991664.1|3539623_3540502_-	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_000248595.1|3540470_3540779_-	YuzD family protein	NA	NA	NA	NA	NA
WP_000431159.1|3540985_3541222_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_001125496.1|3541416_3541632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048557137.1|3541693_3542695_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_000665103.1|3542815_3543307_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	3.5e-41
WP_029440556.1|3543327_3543807_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_029440557.1|3544309_3546883_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_029440558.1|3546866_3547655_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	1.1e-33
WP_029437205.1|3548029_3549442_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
3553012:3553029	attR	GATGATGCAGCAACTACA	NA	NA	NA	NA
>prophage 14
NZ_CP041071	Bacillus tropicus strain LM1212-W3 chromosome, complete genome	5631167	4393201	4401574	5631167		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|4393201_4394509_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170542.1|4394597_4395317_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	5.2e-49
WP_000278820.1|4395309_4395564_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666778.1|4395560_4396244_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_029437191.1|4396227_4398447_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.0	1.3e-162
WP_029437192.1|4398431_4399847_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.0	3.3e-55
WP_029437193.1|4399949_4400990_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.6	9.4e-68
WP_029437194.1|4400986_4401574_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.8	1.7e-26
>prophage 15
NZ_CP041071	Bacillus tropicus strain LM1212-W3 chromosome, complete genome	5631167	4424451	4510278	5631167	capsid,portal,plate,coat,transposase,holin,terminase,integrase,protease,tRNA	Bacillus_phage(67.31%)	101	4443421:4443451	4483217:4483247
WP_000086999.1|4424451_4424742_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_029437209.1|4424757_4426215_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_001047685.1|4426229_4427657_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_000977671.1|4428127_4429033_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.8	3.1e-27
WP_029437210.1|4429172_4429919_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_118991682.1|4429998_4431438_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_029437212.1|4431554_4432922_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_029437213.1|4432914_4434366_+	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000263262.1|4434413_4434737_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_029437214.1|4434777_4436007_-	aminopeptidase	NA	NA	NA	NA	NA
WP_158001543.1|4436492_4436963_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_029437142.1|4436952_4438059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437216.1|4439085_4440189_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_029437217.1|4440465_4441662_-	pyrimidine nucleoside transporter NupC	NA	NA	NA	NA	NA
WP_118991683.1|4442066_4443467_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.5	5.1e-117
4443421:4443451	attL	ATACGACTCATGTGGAGTGTGTGGCTTGGCT	NA	NA	NA	NA
WP_029437219.1|4443525_4444650_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	98.7	9.7e-212
WP_029437220.1|4444925_4445270_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	61.3	1.2e-32
WP_118991685.1|4445760_4446912_+	hypothetical protein	NA	D2XQ10	Bacillus_virus	43.3	7.0e-72
WP_162901148.1|4446947_4447103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162901149.1|4447251_4447389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437221.1|4447418_4447778_-	helix-turn-helix transcriptional regulator	NA	A0A0A7AR52	Bacillus_phage	41.2	4.3e-20
WP_033694430.1|4447948_4448152_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV9	Bacillus_phage	59.7	3.4e-14
WP_029437223.1|4448218_4448950_+	Rha family transcriptional regulator	NA	A0A1B1P7T7	Bacillus_phage	89.3	2.1e-122
WP_029437224.1|4448993_4449344_+	helix-turn-helix domain-containing protein	NA	A0A1B0T6C2	Bacillus_phage	81.0	4.6e-51
WP_158001545.1|4449340_4449508_+	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	88.9	3.4e-20
WP_033694431.1|4449537_4449714_+	hypothetical protein	NA	A0A0U3SQC4	Bacillus_phage	86.2	1.2e-23
WP_029437225.1|4449718_4450606_+	chromosomal replication initiator protein DnaA	NA	A0A0U3TZZ4	Bacillus_phage	66.4	5.5e-93
WP_029437226.1|4450620_4451535_+	AAA family ATPase	NA	A0A0U3U1U1	Bacillus_phage	98.7	2.9e-169
WP_029437227.1|4451547_4451742_+	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	87.5	8.2e-26
WP_029437228.1|4451758_4452037_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.3	7.4e-12
WP_001125952.1|4452029_4452389_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	53.3	1.1e-31
WP_000717826.1|4452407_4452575_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.4e-13
WP_029437229.1|4452600_4452852_+	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	48.7	1.3e-15
WP_029437230.1|4452871_4453354_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	49.5	1.5e-20
WP_029437231.1|4453392_4453632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158001546.1|4453645_4453819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437232.1|4453852_4454185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437233.1|4454212_4454908_+	hypothetical protein	NA	A0A1I9S6E4	Bacillus_phage	81.0	8.4e-113
WP_029437234.1|4455125_4455305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437235.1|4455343_4455526_+	hypothetical protein	NA	A0A0A7AR63	Bacillus_phage	54.4	2.2e-12
WP_029437236.1|4455562_4455799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437237.1|4456058_4456241_+	hypothetical protein	NA	G9J254	Bacillus_phage	70.4	3.9e-14
WP_033694472.1|4456269_4456452_+	hypothetical protein	NA	G9J1S8	Bacillus_phage	51.7	1.9e-08
WP_033694432.1|4456462_4456585_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_029437238.1|4456605_4456788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866511.1|4456892_4457063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437239.1|4457083_4457560_+	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	61.0	9.3e-47
WP_029437240.1|4457556_4458099_+|integrase	site-specific integrase	integrase	A0A1B1P746	Bacillus_phage	88.3	3.6e-87
WP_029437241.1|4458702_4458915_+	cell division protein FtsK	NA	A0A1B1P7C1	Bacillus_phage	39.1	2.2e-08
WP_050587850.1|4459116_4459350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437243.1|4459363_4459681_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	55.1	2.3e-09
WP_029437244.1|4459682_4460024_+	hypothetical protein	NA	A0A1B1P7D2	Bacillus_phage	35.2	9.7e-06
WP_029437245.1|4460034_4460346_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	68.0	3.8e-33
WP_029437246.1|4460349_4460649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437247.1|4460755_4461079_+	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	87.6	5.5e-43
WP_029437248.1|4461059_4462733_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	89.7	7.8e-290
WP_029437249.1|4462749_4463913_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	59.4	2.3e-131
WP_029437250.1|4464009_4465128_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_033694433.1|4465478_4466222_+|protease	Clp protease ClpP	protease	Q8W605	Listeria_phage	65.4	1.4e-60
WP_029437251.1|4466259_4467402_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	57.8	2.5e-122
WP_158001547.1|4467421_4467562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000438401.1|4467563_4467869_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	54.1	1.2e-18
WP_029437252.1|4467852_4468200_+	hypothetical protein	NA	A0A1B1P760	Bacillus_phage	62.7	1.8e-31
WP_029437253.1|4468189_4468576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437254.1|4468565_4468988_+	hypothetical protein	NA	R4IBU7	Listeria_phage	39.7	2.3e-20
WP_029437255.1|4468994_4469588_+	hypothetical protein	NA	A0A1B1P778	Bacillus_phage	55.3	5.0e-58
WP_029437256.1|4469606_4470059_+	hypothetical protein	NA	A0A1B1P772	Bacillus_phage	36.3	2.1e-19
WP_029437257.1|4470241_4471852_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	71.4	8.2e-103
WP_118991849.1|4473464_4474487_+	hypothetical protein	NA	A0A2I7SCT8	Paenibacillus_phage	62.4	1.3e-24
WP_029437261.1|4474479_4475166_+	hypothetical protein	NA	A0A2H4J851	uncultured_Caudovirales_phage	61.4	4.9e-81
WP_029437262.1|4475162_4477778_+	hypothetical protein	NA	A0A2H4JFY7	uncultured_Caudovirales_phage	52.1	4.1e-277
WP_118991686.1|4477767_4479492_+|plate	BppU family phage baseplate upper protein	plate	A0A2H4J855	uncultured_Caudovirales_phage	54.0	5.2e-39
WP_029437264.1|4479579_4480002_+|holin	phage holin family protein	holin	D2XPZ9	Bacillus_virus	97.1	1.4e-67
WP_029437265.1|4480084_4481278_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	4.3e-24
WP_029437266.1|4481574_4482372_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	72.1	1.3e-112
WP_029437267.1|4482600_4482954_-	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	34.7	1.4e-10
WP_029437268.1|4483356_4484346_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
4483217:4483247	attR	ATACGACTCATGTGGAGTGTGTGGCTTGGCT	NA	NA	NA	NA
WP_118991687.1|4484661_4486680_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_001251708.1|4486757_4487276_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	37.7	1.0e-22
WP_029437270.1|4487651_4489388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029437271.1|4489735_4490443_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_029437272.1|4490503_4491199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704467.1|4491213_4492323_-	dipeptide epimerase	NA	Q6A202	Oenococcus_phage	25.5	8.6e-19
WP_029437273.1|4492415_4493687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437274.1|4493675_4495097_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_029437275.1|4495391_4496507_+	amidohydrolase	NA	NA	NA	NA	NA
WP_029437276.1|4496639_4497248_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_029437277.1|4497251_4497998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437278.1|4498050_4499577_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	30.8	9.1e-19
WP_000924418.1|4499591_4500155_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_029437279.1|4500745_4501975_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_029437280.1|4501987_4503028_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_000926550.1|4503083_4503725_+	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_029437281.1|4503765_4504773_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_029437282.1|4504769_4505810_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000732577.1|4505858_4506776_-	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_029437283.1|4507108_4508071_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.2	2.7e-13
WP_000235471.1|4508266_4508635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276020.1|4508825_4509056_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_029437284.1|4509292_4509808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437285.1|4509828_4510278_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 16
NZ_CP041071	Bacillus tropicus strain LM1212-W3 chromosome, complete genome	5631167	5509520	5588856	5631167	capsid,portal,plate,terminase,protease,integrase,transposase,bacteriocin	Bacillus_phage(76.0%)	71	5526756:5526773	5554401:5554418
WP_029437993.1|5509520_5511407_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	34.3	1.9e-87
WP_029437994.1|5511613_5512723_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	76.2	2.1e-142
WP_029437995.1|5513148_5513493_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	42.9	7.7e-19
WP_029437996.1|5514017_5515157_+	hypothetical protein	NA	H0UST6	Bacillus_phage	37.1	8.4e-62
WP_162901155.1|5515160_5515298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155417052.1|5515447_5515600_+	hypothetical protein	NA	A0A0A7AQZ6	Bacillus_phage	74.0	5.2e-12
WP_029437997.1|5515606_5515954_-	helix-turn-helix transcriptional regulator	NA	A0A0A7AR52	Bacillus_phage	91.3	4.2e-49
WP_033694466.1|5516129_5516348_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV9	Bacillus_phage	90.3	4.7e-30
WP_029437999.1|5516406_5517081_+	hypothetical protein	NA	A0A288WFT2	Bacillus_phage	52.2	4.0e-59
WP_029438000.1|5517118_5517394_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	86.5	2.1e-35
WP_033694467.1|5517429_5517594_+	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	70.4	7.2e-15
WP_033694468.1|5517623_5517800_+	hypothetical protein	NA	A0A0U3SQC4	Bacillus_phage	79.3	2.7e-20
WP_029438001.1|5517804_5518554_+	DnaD domain protein	NA	A0A1B0T6C0	Bacillus_phage	77.9	3.8e-71
WP_029438002.1|5518492_5519368_+	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	45.5	2.6e-63
WP_029438003.1|5519383_5519578_+	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	78.1	1.8e-20
WP_000805170.1|5519603_5519777_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	91.2	2.6e-23
WP_029438004.1|5519791_5520046_+	hypothetical protein	NA	A0A1B0T6B9	Bacillus_phage	85.7	1.1e-35
WP_029438005.1|5520545_5520737_+	hypothetical protein	NA	A0A1B0T6B5	Bacillus_phage	92.1	6.2e-26
WP_029438006.1|5520795_5521014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029438007.1|5521190_5522420_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.8	5.0e-84
WP_029438008.1|5522790_5523366_+	hypothetical protein	NA	A0A219UQR9	Bacillus_phage	34.7	3.7e-13
WP_029438009.1|5523410_5523656_+	hypothetical protein	NA	A0A0S2MVC7	Bacillus_phage	58.0	1.6e-18
WP_000220910.1|5523706_5523898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029438010.1|5523939_5524242_+	hypothetical protein	NA	Q3HKX6	Bacillus_phage	73.0	2.2e-33
WP_118991858.1|5524305_5524404_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_029438011.1|5524424_5524607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437265.1|5524792_5525986_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	4.3e-24
WP_000866511.1|5526281_5526452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029438012.1|5526475_5526946_+	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	67.7	4.6e-54
5526756:5526773	attL	AAAGAAAAATTGTAATTA	NA	NA	NA	NA
WP_001028518.1|5526942_5527485_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P746	Bacillus_phage	99.4	4.2e-96
WP_029437241.1|5528088_5528301_+	cell division protein FtsK	NA	A0A1B1P7C1	Bacillus_phage	39.1	2.2e-08
WP_050587850.1|5528502_5528736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437243.1|5528749_5529067_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	55.1	2.3e-09
WP_029437244.1|5529068_5529410_+	hypothetical protein	NA	A0A1B1P7D2	Bacillus_phage	35.2	9.7e-06
WP_029437245.1|5529420_5529732_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	68.0	3.8e-33
WP_029437246.1|5529735_5530035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029440482.1|5530141_5530462_+	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	85.8	4.2e-43
WP_118991719.1|5530445_5532128_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	94.3	9.3e-312
WP_118991720.1|5532142_5533300_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	93.4	3.3e-207
WP_029437250.1|5533396_5534515_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_118991721.1|5534865_5535585_+|protease	Clp protease ClpP	protease	A0A2H4JC91	uncultured_Caudovirales_phage	49.4	7.7e-53
WP_029440480.1|5535626_5536790_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	44.1	2.3e-86
WP_029440479.1|5536804_5537029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029440478.1|5537038_5537338_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	87.6	2.1e-41
WP_029440477.1|5537318_5537717_+	hypothetical protein	NA	A0A1B1P760	Bacillus_phage	77.1	3.9e-46
WP_033694907.1|5537691_5538069_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	72.8	2.8e-46
WP_029440475.1|5538055_5538484_+	hypothetical protein	NA	A0A1B1P769	Bacillus_phage	97.9	2.3e-73
WP_029440474.1|5538484_5539072_+	hypothetical protein	NA	A0A1B1P778	Bacillus_phage	86.6	1.3e-95
WP_029440473.1|5539145_5539607_+	hypothetical protein	NA	A0A1B1P772	Bacillus_phage	94.1	2.1e-75
WP_029440472.1|5539785_5541618_+	hypothetical protein	NA	A0A1B1P775	Bacillus_phage	98.9	6.0e-134
WP_118991722.1|5543192_5544596_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_029437180.1|5546098_5547976_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	24.2	1.2e-20
WP_118991723.1|5548107_5549742_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	33.6	3.8e-63
WP_118991859.1|5550329_5551052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437178.1|5551357_5551543_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_023523669.1|5551664_5551946_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	67.2	4.0e-13
WP_029437177.1|5551967_5552201_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_029437176.1|5552253_5552532_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	57.3	1.9e-20
WP_029437794.1|5552891_5554307_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_118991724.1|5554825_5572945_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	26.8	4.8e-159
5554401:5554418	attR	TAATTACAATTTTTCTTT	NA	NA	NA	NA
WP_029440341.1|5573290_5574016_+	thioesterase	NA	NA	NA	NA	NA
WP_029440340.1|5574176_5575304_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_029440339.1|5576270_5576978_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_158001559.1|5577188_5577470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029440338.1|5577829_5578570_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	41.2	2.5e-38
WP_118991843.1|5578662_5579856_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_118991844.1|5580263_5581457_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_029440625.1|5583467_5584154_+	hypothetical protein	NA	A0A2H4J851	uncultured_Caudovirales_phage	62.3	2.0e-82
WP_029440626.1|5584150_5586766_+	hypothetical protein	NA	A0A2H4JFY7	uncultured_Caudovirales_phage	52.2	5.3e-277
WP_029440627.1|5586755_5588480_+|plate	BppU family phage baseplate upper protein	plate	A0A2H4J855	uncultured_Caudovirales_phage	54.0	2.0e-38
WP_000389067.1|5588625_5588856_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	93.4	5.3e-32
>prophage 1
NZ_CP041074	Bacillus tropicus strain LM1212-W3 plasmid p1, complete sequence	211160	17109	69339	211160	transposase	Streptococcus_phage(71.43%)	40	NA	NA
WP_029440585.1|17109_18303_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	24.8	9.6e-24
WP_118991976.1|18598_21109_+	Cys-Gln thioester bond-forming surface protein	NA	NA	NA	NA	NA
WP_002192128.1|21209_21551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002170075.1|21565_21934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118991975.1|21935_22649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118991974.1|22623_24561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118991973.1|24560_25640_+	hypothetical protein	NA	A0A1S5SEZ8	Streptococcus_phage	34.4	1.6e-41
WP_118991971.1|25924_26491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118991970.1|26494_27169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118991969.1|27183_28188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118991968.1|28189_29500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118991658.1|31516_32306_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_029439035.1|32991_33411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162901182.1|33411_33585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002170063.1|33768_33942_-	ribbon-helix-helix domain-containing protein	NA	B5LPT4	Bacillus_virus	50.9	8.4e-06
WP_118991967.1|34079_34613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098778602.1|34631_35120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118991966.1|35168_37376_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	36.8	1.6e-69
WP_029439033.1|37436_37877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118991965.1|38006_38714_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	3.1e-38
WP_029438007.1|41689_42919_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.8	5.0e-84
WP_162901181.1|43052_43361_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167506400.1|43914_44058_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_140611926.1|44054_44300_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162901180.1|44320_44488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118991962.1|44484_45756_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_029437170.1|45870_47283_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_118991961.1|47654_49352_+	DUF2334 domain-containing protein	NA	NA	NA	NA	NA
WP_086390279.1|52318_52705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086390280.1|52718_52925_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_118991959.1|53206_54637_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_118991958.1|56046_59826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118991957.1|62844_63726_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_118991956.1|63805_64141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050001586.1|64228_64438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118991892.1|65306_66014_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	2.1e-39
WP_029440413.1|66366_67053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029440412.1|67161_67467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118991893.1|67862_68231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118991658.1|68549_69339_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP041074	Bacillus tropicus strain LM1212-W3 plasmid p1, complete sequence	211160	80021	148002	211160	bacteriocin,transposase,integrase,tRNA	Streptococcus_phage(53.33%)	56	68538:68597	95775:96627
68538:68597	attL	CTAAGAATCTGTCTAAAATCTTTTCAATAAAATTGCCACACTTGCCAATAAGCAACTCTG	NA	NA	NA	NA
WP_029440407.1|80021_81182_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_029440406.1|81699_81897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118991894.1|82163_82493_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	36.6	1.1e-09
WP_118991895.1|82527_83235_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	1.1e-38
WP_029440405.1|83838_84039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029440404.1|84071_85034_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_029440403.1|85409_86303_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_158001565.1|86965_87253_-	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_118991891.1|87364_88072_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	2.4e-38
WP_118991896.1|88137_88515_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.0	5.0e-27
WP_029438007.1|89607_90837_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.8	5.0e-84
WP_033694859.1|91315_91567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029437142.1|93102_94209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158001543.1|94198_94669_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_029440399.1|94956_95208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118991658.1|95786_96576_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_029440398.1|97056_97299_-	hypothetical protein	NA	NA	NA	NA	NA
95775:96627	attR	CTAAGAATCTGTCTAAAATCTTTTCAATAAAATTGCCACACTTGCCAATAAGCAACTCTGTCTACTATTTTCAAGTGTTCGTTCACAATTCTTCCACAGTCTACGGTAATTTTCCAACCAGGCAAAGGTGCGTTCCACAATCCAGCGTTTTGGTAACACGACAAATTTGTGAAGTTCAGAGCGTTTGATGATTTCAACTGAACAATCAATCGTTTCTTTTATTGATTGCGCAAAGGATGGCCCTGTATATCCGCCATCACAAAGTATATTTGTCACTTTTTCCAATGTTTTCTTATGTCTTTCACACATTTGGATGGCGCCCTCTCGGTCTGTTATGTTCGCAGTTGTTACATCAATTGCATGAATGAGACCGTTCGTATCTACAGCAATATGACGTTTGATTCCTGACACTTTCTTTCCAGCATCATAACCCTTTTCACCAGCTATCCATGTGTTTTTCACGCTTTGTGCATCTACGATGCAGAAACTTGTCTGATTCTTACGTCCATCTTGCTCGCGATAGGTTTCAACCAATTTTTTTATGCACTTTTTCGAGAAGACTTATGCCATTCTCGTCTACTTTCCGCCAAATTTGATAGTAAGCATACACGGTTTTCCAGTGTGGAAAGTCACTTGGCAGATTGCGCCATTGGCAGCCTGTTGTGAGCAGATATAAGACGCCACAGAATACTTCATACAAATCGACTGTGCGGGGGCGCGTCTTTTTACGGGCATTTTCTAAATCTTCACGAATCAGTTCAAACTGTTCACGAGTAATATTACTTGTATAATTGTGTATCATGGAAATCATCCTTTTTTACACAGAGTATACCATAGATTTTAGACAGGTTCT	NA	NA	NA	NA
WP_029440397.1|97405_97651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033694857.1|97698_98235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029437170.1|98888_100301_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_029440394.1|101172_102372_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_029440393.1|102368_103049_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.1	8.1e-36
WP_118991899.1|103045_104239_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016106960.1|104575_104899_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_118991900.1|104983_106690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029440391.1|106694_107204_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_030030022.1|107217_107766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029440390.1|107755_108394_+	ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	26.4	5.5e-10
WP_162901171.1|108407_108584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029440389.1|109134_109410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118991901.1|109428_110106_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	30.5	6.0e-15
WP_016122923.1|110402_110702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029440387.1|110811_111144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029440386.1|111353_111947_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_002204993.1|112080_112272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016122926.1|112497_112731_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_029440385.1|112752_113034_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.0	1.1e-10
WP_029440384.1|113159_113465_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_029440383.1|113580_114165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118991890.1|114884_115592_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	1.4e-38
WP_118991658.1|116224_117014_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_134981305.1|117750_118419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118991659.1|120121_120911_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_029440378.1|121641_122343_-	ADP-ribosyltransferase	NA	Q331X8	Clostridium_botulinum_C_phage	35.3	4.9e-28
WP_118991903.1|122536_125137_-	iota toxin protein Ib	NA	A0A1V0E026	Clostridioides_phage	39.3	1.6e-140
WP_029440375.1|125544_125781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118991658.1|133544_134333_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_118991890.1|134527_135235_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	1.4e-38
WP_029440374.1|135688_137680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118991904.1|138268_138976_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.0	2.6e-37
WP_029440373.1|139641_141144_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_140611931.1|141390_141576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029440372.1|141743_144074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118991905.1|144448_145156_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	1.8e-38
WP_029440369.1|146389_147289_+	kinase	NA	NA	NA	NA	NA
WP_029440368.1|147303_148002_+|tRNA	alanyl-tRNA editing protein	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP041075	Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence	157863	3206	78716	157863	transposase,integrase	Bacillus_phage(40.0%)	57	12121:12139	76211:76229
WP_118991922.1|3206_3896_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	58.7	7.4e-69
WP_000070738.1|5524_6412_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_118991921.1|7071_7779_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	2.1e-39
WP_029441165.1|9024_10461_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
12121:12139	attL	AAGCTGAGTAGTTACGAAA	NA	NA	NA	NA
WP_118991920.1|12582_13356_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	1.6e-32
WP_029441164.1|13330_15301_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_029441162.1|15820_16087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029441161.1|16100_16292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029441160.1|16509_17403_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_118991950.1|17848_18490_-	recombinase family protein	NA	A0A1B0VBM1	Salmonella_phage	33.2	2.2e-14
WP_167506401.1|18647_18785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029440404.1|18817_19780_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_118991949.1|20158_21052_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_029437250.1|21446_22565_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_118991948.1|22915_24280_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_029439084.1|25561_25858_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_029439083.1|26659_28894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029439082.1|29260_29767_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	46.8	2.4e-29
WP_118991947.1|29664_30045_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	58.8	2.3e-16
WP_140611939.1|31220_31448_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_029437398.1|31486_31774_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.5	9.0e-05
WP_118991944.1|32036_33107_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_029441152.1|33113_34082_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_029441153.1|34068_34665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029441154.1|34661_35405_-	amino acid racemase	NA	NA	NA	NA	NA
WP_029441155.1|35420_36332_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_140611944.1|36623_37244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029441157.1|37573_37843_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_118991927.1|38500_39208_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	1.8e-38
WP_167506404.1|40146_42054_-	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_118991943.1|42627_43335_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	2.1e-39
WP_118991658.1|44592_45381_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_033694890.1|46802_47876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029440438.1|48077_48947_+	ETX/MTX2 family pore-forming toxin	NA	NA	NA	NA	NA
WP_029440439.1|49362_50184_+	ETX/MTX2 family pore-forming toxin	NA	NA	NA	NA	NA
WP_118991941.1|50728_50944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118991955.1|51233_52580_-	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_118991940.1|52911_54000_-	glycosyltransferase family 2 protein	NA	A0A2K9L5M2	Tupanvirus	22.1	6.9e-13
WP_118991939.1|54325_55636_-	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_029437250.1|56941_58060_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_033694759.1|58410_58647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437142.1|59267_60374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158001543.1|60363_60834_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_033694744.1|61768_62788_+	zinc-ribbon domain-containing protein	NA	A0A1B1P7Q7	Bacillus_phage	62.2	2.5e-134
WP_029439513.1|62897_63851_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_029439512.1|64101_64983_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_029439511.1|66032_66455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029439510.1|66567_66840_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	65.6	1.8e-23
WP_029439509.1|66901_67180_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	68.9	6.0e-14
WP_029439508.1|67557_67800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029439506.1|68531_70394_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.2	3.3e-31
WP_002205092.1|71220_71460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029437120.1|71706_71895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029437121.1|72212_72875_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_029440585.1|73171_74365_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	24.8	9.6e-24
WP_118991938.1|74425_75445_-	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_029437205.1|77303_78716_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
76211:76229	attR	TTTCGTAACTACTCAGCTT	NA	NA	NA	NA
>prophage 2
NZ_CP041075	Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence	157863	101938	150643	157863	transposase	Bacillus_phage(50.0%)	51	NA	NA
WP_158001543.1|101938_102409_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_029437142.1|102398_103505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134981243.1|103584_103914_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_118991931.1|103923_105036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029437145.1|105049_106138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029437146.1|106234_106528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029437147.1|106553_106793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029437148.1|106818_107268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002187991.1|107854_108103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029437149.1|108251_108827_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_029437150.1|108869_109388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162901172.1|109412_109559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118991658.1|111176_111965_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_029437152.1|112848_113052_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_029437153.1|113255_113753_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_097984829.1|114097_115042_+	Replicase RepFR55	NA	NA	NA	NA	NA
WP_029437155.1|115687_116242_+	DUF3967 domain-containing protein	NA	NA	NA	NA	NA
WP_029437156.1|116470_117661_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_029437157.1|117667_118108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086413261.1|118601_118739_-	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_118991930.1|118740_119835_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	45.8	3.5e-81
WP_029437159.1|120268_120565_+	hypothetical protein	NA	H0USY0	Bacillus_phage	45.5	2.2e-14
WP_029437160.1|120566_120752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437161.1|120852_122034_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	56.2	4.0e-123
WP_029437162.1|121972_122587_+	hypothetical protein	NA	H0USY2	Bacillus_phage	45.1	8.1e-43
WP_000118337.1|122588_122813_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM0	Bacillus_phage	50.6	6.8e-16
WP_029437163.1|123326_123575_+	DNA-binding protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	46.1	2.7e-13
WP_029437164.1|123667_123904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118991954.1|124935_125163_+	DUF2187 family protein	NA	NA	NA	NA	NA
WP_162901177.1|125144_125315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437166.1|125317_125614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437167.1|125658_125883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437168.1|126066_127179_+	helix-turn-helix domain-containing protein	NA	A0A288TXV8	Enterococcus_phage	49.1	1.4e-80
WP_162901176.1|127413_127563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437169.1|127613_128699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029437170.1|129009_130422_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_029437171.1|130478_130952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029437172.1|131185_131761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118991929.1|131892_132387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029437170.1|132466_133879_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_029437183.1|134352_134955_-	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	26.1	1.7e-08
WP_118991928.1|135227_142835_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.1	9.4e-141
WP_118991927.1|143156_143864_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.5	1.8e-38
WP_029437184.1|144089_144425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050587816.1|146535_147066_+	signal peptidase I	NA	NA	NA	NA	NA
WP_029437187.1|147636_147918_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A1B1P791	Bacillus_phage	31.4	8.3e-11
WP_029437188.1|147939_148173_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016099605.1|148225_148504_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	60.7	7.4e-20
WP_016099606.1|148618_148909_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016099607.1|148978_149287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118991926.1|149725_150643_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
