The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041146	Nocardioides humi strain DCY24 chromosome, complete genome	6220618	695193	759401	6220618	integrase,transposase	uncultured_virus(30.0%)	60	692627:692647	738774:738794
692627:692647	attL	CTCGTCCAGGGTGAAGCCGAG	NA	NA	NA	NA
WP_136562090.1|695193_696279_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_141003264.1|698847_699306_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_141003265.1|699316_699895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141003266.1|700041_700689_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4B2E0	Arthrobacter_phage	41.9	1.3e-35
WP_141003217.1|700754_702033_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	52.6	2.5e-70
WP_141003267.1|701988_702597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141003268.1|702603_702834_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_141003269.1|703293_703752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141003270.1|703837_704404_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_141003271.1|704478_705318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141003272.1|705331_706162_+	DUF3152 domain-containing protein	NA	NA	NA	NA	NA
WP_141003273.1|706787_707195_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_141007713.1|707408_708005_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_141003274.1|708060_710538_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	32.0	2.9e-83
WP_141003275.1|710534_712880_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.3	6.8e-98
WP_141007714.1|712927_713143_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_141003276.1|713334_713637_-	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_141003277.1|713752_714376_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_141003278.1|715792_716899_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	29.3	9.5e-26
WP_141003279.1|717834_718080_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_141003280.1|718142_719684_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_141007715.1|719794_720133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141003281.1|720253_720499_+	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_141003282.1|720495_720819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141007716.1|721483_722497_+	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_141003283.1|723011_725096_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_141003284.1|725100_725745_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_141003285.1|725814_726789_+	AAA family ATPase	NA	A0A1V0SL40	Klosneuvirus	27.9	4.2e-09
WP_141003286.1|726872_728696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141003212.1|728814_730053_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.4	2.6e-101
WP_141003287.1|730116_730779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141003288.1|730775_732140_-	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_141003289.1|732150_733296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141003290.1|734047_734620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141003291.1|734585_735431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141003292.1|735516_736566_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_141003293.1|736850_738464_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	54.7	1.6e-122
WP_141007717.1|738608_738989_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
738774:738794	attR	CTCGGCTTCACCCTGGACGAG	NA	NA	NA	NA
WP_141003294.1|740261_741203_-	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_141003295.1|741307_742705_+	flavoprotein	NA	NA	NA	NA	NA
WP_141003296.1|742769_744005_+	MFS transporter	NA	NA	NA	NA	NA
WP_141003297.1|743990_744638_-	arsenate reductase ArsC	NA	NA	NA	NA	NA
WP_141003298.1|744750_745152_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4PQT4	Staphylococcus_phage	42.9	1.4e-06
WP_141003299.1|745148_746288_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_141003300.1|746284_746767_+	heat-shock protein HtpX	NA	NA	NA	NA	NA
WP_141003301.1|746787_747246_+	low molecular weight phosphatase family protein	NA	NA	NA	NA	NA
WP_141003302.1|747682_747943_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_141007718.1|747945_748203_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_141003303.1|748984_749251_-	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_141003304.1|749250_749661_-	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_141003305.1|749811_750114_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_141003306.1|750121_751612_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_141003307.1|751613_752438_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_141003308.1|754944_755148_+	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_141003309.1|755144_755771_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_141003310.1|756058_756517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141003311.1|756599_757160_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	38.0	7.4e-11
WP_141003312.1|757224_758061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141003313.1|758076_758907_+	DUF3152 domain-containing protein	NA	NA	NA	NA	NA
WP_141003314.1|759038_759401_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP041146	Nocardioides humi strain DCY24 chromosome, complete genome	6220618	3965162	3974553	6220618	protease	Enterobacteria_phage(33.33%)	8	NA	NA
WP_141005866.1|3965162_3967235_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	47.0	7.3e-112
WP_141005867.1|3967252_3967870_+	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	51.4	5.6e-44
WP_141005868.1|3967877_3968228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141007965.1|3968391_3969744_-	sugar nucleotide-binding protein	NA	A0A291LA50	Escherichia_phage	36.3	4.4e-17
WP_141007966.1|3969785_3970805_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.4	4.9e-77
WP_141005869.1|3970877_3971771_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	55.2	1.3e-86
WP_141005870.1|3971945_3973508_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_141007967.1|3973701_3974553_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.6	3.7e-22
>prophage 3
NZ_CP041146	Nocardioides humi strain DCY24 chromosome, complete genome	6220618	4670028	4700482	6220618	holin,integrase,tail,transposase	Bacillus_phage(25.0%)	22	4678396:4678415	4704151:4704170
WP_141006401.1|4670028_4671582_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	33.9	1.1e-72
WP_141006402.1|4671595_4672042_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_141006403.1|4672041_4672482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141006404.1|4673347_4674811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141006405.1|4674807_4675245_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_141006406.1|4675275_4676061_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_141006407.1|4676047_4677817_+	VgrG-related protein	NA	NA	NA	NA	NA
WP_141006408.1|4677816_4678104_+	PaaR repeat-containing protein	NA	NA	NA	NA	NA
4678396:4678415	attL	CGCCGTCGACCGCGGGGTGC	NA	NA	NA	NA
WP_141008018.1|4680565_4681051_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_141008019.1|4682154_4683258_-	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
WP_141006409.1|4683327_4684392_-	acyl-CoA desaturase	NA	A6N231	Microbacterium_phage	51.2	2.0e-89
WP_141006410.1|4684539_4685394_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_141006411.1|4685860_4686853_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0M3LS26	Mannheimia_phage	31.4	3.0e-39
WP_141006412.1|4687694_4688174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141006413.1|4688939_4692293_+	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_141006414.1|4693128_4693386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141006415.1|4693412_4694378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141006416.1|4695323_4695575_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_141006417.1|4695773_4696787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141006418.1|4696690_4697380_-	recombinase family protein	NA	NA	NA	NA	NA
WP_141006419.1|4697853_4698717_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_141006420.1|4698826_4700482_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	30.8	4.1e-57
4704151:4704170	attR	GCACCCCGCGGTCGACGGCG	NA	NA	NA	NA
