The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP033954	Klebsiella pneumoniae strain L39_2 chromosome, complete genome	5473945	448676	481934	5473945	portal,capsid,tRNA,tail,head,protease,integrase,terminase	uncultured_Caudovirales_phage(73.33%)	35	466284:466301	482279:482296
WP_002919147.1|448676_449624_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|449638_450148_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|450276_451401_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|451372_451846_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|451871_452414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|452418_452991_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|452994_453813_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|453809_454067_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|454042_454597_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|460392_460614_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|460907_464018_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|464030_465170_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|465548_466199_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
466284:466301	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|466474_467701_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|467793_468735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|468916_469201_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|469211_469991_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_024194847.1|470114_470309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|470442_470712_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|470704_470893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|470885_471200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|471196_471565_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|471561_471927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|471926_474062_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|474404_474740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|474788_475301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|475564_476731_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|476782_477343_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|477344_478586_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|478582_478918_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|478914_479214_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|479213_479657_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004198610.1|479783_479975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113647.1|479932_480289_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|480272_481934_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
482279:482296	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP033954	Klebsiella pneumoniae strain L39_2 chromosome, complete genome	5473945	1174678	1260011	5473945	portal,capsid,tRNA,coat,tail,transposase,integrase,head,plate,terminase,lysis	Salmonella_phage(69.23%)	100	1188432:1188451	1237112:1237131
WP_002914765.1|1174678_1177306_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
WP_099119228.1|1177377_1177560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000906486.1|1177669_1177855_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_002914359.1|1179376_1179691_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_002914357.1|1179816_1180383_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_002914355.1|1180379_1180808_+	DedA family protein	NA	NA	NA	NA	NA
WP_002914353.1|1180874_1182431_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_002914351.1|1182587_1183103_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_002914345.1|1183155_1183923_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002914344.1|1183901_1185578_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002914342.1|1185714_1187253_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_002914339.1|1187268_1188441_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
1188432:1188451	attL	TTGCACTCATGTTATTCTCC	NA	NA	NA	NA
WP_002914337.1|1188566_1189097_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_002914335.1|1189187_1189523_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_002914333.1|1189512_1190259_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_002914330.1|1190436_1191435_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_004151038.1|1191513_1192581_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_002914328.1|1192573_1193776_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	1.2e-26
WP_002914327.1|1194132_1195095_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
WP_002914325.1|1195105_1197247_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	46.4	2.5e-184
WP_002914321.1|1197219_1197630_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_002914320.1|1197626_1197872_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.1	5.5e-11
WP_004151037.1|1198055_1198487_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004149442.1|1198575_1199928_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_002914293.1|1200071_1200419_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_002914291.1|1200568_1200931_+	YgaC family protein	NA	NA	NA	NA	NA
WP_002914289.1|1201016_1201466_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_004217499.1|1201584_1201770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914287.1|1202194_1202596_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_002914284.1|1202668_1202848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914281.1|1203053_1203956_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
WP_002914279.1|1203936_1204482_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_002914277.1|1204489_1204789_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002914274.1|1204864_1205470_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_004145715.1|1205573_1206482_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151036.1|1206564_1208352_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151035.1|1208615_1210136_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000019473.1|1210867_1211848_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_062955148.1|1211893_1212892_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_004151019.1|1212894_1213524_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1213646_1213889_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1213921_1214431_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1214438_1214639_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1214602_1214941_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1215008_1215242_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1215241_1215469_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1215465_1216317_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1216313_1218698_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_009483812.1|1218927_1219179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|1219178_1220663_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151011.1|1220770_1220959_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1220970_1221204_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1221299_1221983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1221969_1223049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1223048_1224050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1224571_1224841_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1224897_1225941_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1225940_1227704_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1227844_1228678_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1228694_1229747_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1229750_1230404_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1230499_1230964_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1230963_1231167_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1231170_1231386_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1231366_1231876_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1231880_1232264_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1232260_1232689_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_085955118.1|1232618_1232822_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	3.0e-23
WP_004150997.1|1232784_1233207_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1233199_1233646_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1233668_1234535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1234629_1235202_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1235198_1235561_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1235547_1236456_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1236448_1237120_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1237121_1239071_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
1237112:1237131	attR	GGAGAATAACATGAGTGCAA	NA	NA	NA	NA
WP_004200602.1|1239080_1240199_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1240250_1241324_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1241472_1242645_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1242654_1243170_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1243222_1243522_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1243536_1243656_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150984.1|1243648_1246279_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_004150983.1|1246275_1246761_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1246757_1247852_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1247918_1248137_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1248164_1248542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1249145_1249628_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_004188817.1|1249738_1250215_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1250204_1250495_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1250561_1250903_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1251050_1252712_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1252798_1253677_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1253801_1254392_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1254511_1255798_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1255817_1256609_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1256772_1258137_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1258396_1258645_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1258663_1259212_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1259243_1260011_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP033954	Klebsiella pneumoniae strain L39_2 chromosome, complete genome	5473945	1366033	1418775	5473945	tail,transposase,integrase,terminase,holin	Salmonella_phage(40.38%)	61	1359368:1359382	1389472:1389486
1359368:1359382	attL	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004151980.1|1366033_1367500_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1367567_1369145_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_062955102.1|1369336_1370587_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
WP_063002073.1|1370529_1370772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197356.1|1370768_1371362_-	MT-A70 family protein	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
WP_062955103.1|1371358_1372021_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
WP_048264082.1|1372017_1372176_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
WP_009485475.1|1372168_1372462_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_062955104.1|1372571_1372820_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
WP_062955105.1|1372868_1373750_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
WP_062955106.1|1373746_1374568_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_004164029.1|1374564_1374864_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004144290.1|1375230_1375812_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004152538.1|1375966_1376200_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1376346_1376556_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1376555_1377323_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|1377319_1378105_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_048328152.1|1378224_1378572_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
WP_062955107.1|1378764_1379175_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
WP_032441402.1|1379158_1379350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441401.1|1379346_1379991_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_072200041.1|1380284_1380752_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
WP_029602865.1|1380751_1381045_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_050491799.1|1381041_1381662_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
WP_032441458.1|1381661_1381865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023339258.1|1381857_1382196_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_004152765.1|1382292_1383777_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|1383776_1384028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418540.1|1384179_1384437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441400.1|1384514_1385099_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
WP_062955142.1|1385095_1386571_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	6.4e-280
WP_004200550.1|1386614_1386986_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
WP_072354015.1|1387035_1387278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004141368.1|1387739_1387946_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_032441398.1|1387960_1389643_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
1389472:1389486	attR	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004152446.1|1389639_1389936_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_032441397.1|1389938_1390619_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
WP_004200546.1|1390633_1391620_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_020953461.1|1391673_1392111_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
WP_062955141.1|1392121_1392463_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
WP_004152441.1|1392513_1392837_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_062955139.1|1392836_1393442_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
WP_062955138.1|1393441_1395919_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
WP_004152438.1|1395918_1396383_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_032447858.1|1396382_1396922_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
WP_062955137.1|1396932_1399467_+	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
WP_062955136.1|1399466_1401377_+	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
WP_062955135.1|1401376_1404133_+	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
WP_062955134.1|1404129_1404324_+	hypothetical protein	NA	Q858F7	Salmonella_phage	67.2	6.5e-15
WP_071787028.1|1404358_1404511_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	2.5e-14
WP_062955133.1|1404609_1404906_-	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
WP_062955131.1|1407733_1407997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123766426.1|1408037_1408865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|1409284_1410265_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_000608644.1|1411133_1412396_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_077265603.1|1413504_1414821_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
WP_062955010.1|1414907_1415312_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
WP_023339240.1|1415298_1415604_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_062955009.1|1415593_1416223_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_062955008.1|1416219_1416720_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
WP_004152009.1|1416906_1418775_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
NZ_CP033954	Klebsiella pneumoniae strain L39_2 chromosome, complete genome	5473945	1751126	1758031	5473945	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_072353998.1|1751126_1751990_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	7.4e-10
WP_094818808.1|1752000_1752774_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.1e-26
WP_002912636.1|1753014_1753908_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1754153_1755515_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1755833_1756556_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_072353997.1|1756552_1758031_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.9e-29
>prophage 5
NZ_CP033954	Klebsiella pneumoniae strain L39_2 chromosome, complete genome	5473945	1803009	1812400	5473945	transposase	Escherichia_phage(37.5%)	8	NA	NA
WP_004180506.1|1803009_1804425_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_039819506.1|1804446_1805817_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
WP_039819536.1|1805971_1807036_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
WP_023278825.1|1807049_1807919_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
WP_004175259.1|1807950_1808841_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_039819508.1|1808855_1809410_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
WP_072353991.1|1809589_1810756_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
WP_000019445.1|1811419_1812400_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 6
NZ_CP033954	Klebsiella pneumoniae strain L39_2 chromosome, complete genome	5473945	2804600	2815488	5473945		Escherichia_phage(87.5%)	10	NA	NA
WP_004151613.1|2804600_2807708_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2807762_2809028_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2809058_2810147_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2810233_2810494_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2810791_2811652_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2811672_2812434_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_023148136.1|2812424_2812658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903955.1|2812695_2813598_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_048260141.1|2813609_2814875_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	3.9e-233
WP_002210516.1|2814867_2815488_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP033954	Klebsiella pneumoniae strain L39_2 chromosome, complete genome	5473945	3042052	3080518	5473945	terminase,integrase	uncultured_Caudovirales_phage(32.65%)	58	3071631:3071645	3077640:3077654
WP_004152576.1|3042052_3042919_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|3042918_3043692_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3043688_3044885_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3044884_3045238_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3045239_3045893_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|3045946_3046513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004173705.1|3046549_3046735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3046787_3047129_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3047128_3048151_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|3048153_3048456_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|3048456_3049056_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|3049055_3051059_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3051048_3051201_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3051236_3051662_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|3051665_3052106_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|3052116_3053262_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3053265_3053706_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3053800_3054187_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3054186_3054693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3054689_3055109_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3055077_3055359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3055398_3056340_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3056351_3056846_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3056849_3058052_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3058103_3058652_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3058707_3060159_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3060396_3061797_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|3061747_3062500_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|3062601_3062922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064754420.1|3063014_3063272_-	hypothetical protein	NA	S5FXQ4	Shigella_phage	70.9	2.3e-23
WP_004153952.1|3063156_3063546_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3063542_3064073_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3064075_3064324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3064729_3065512_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3065508_3065985_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3065981_3066944_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3066945_3068604_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152163.1|3068912_3069206_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
WP_004152162.1|3069180_3069402_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3069499_3070168_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3070338_3070653_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3070645_3070834_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3071003_3071369_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3071361_3071616_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|3071587_3071806_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
3071631:3071645	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|3071802_3072228_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3072224_3072419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3072415_3073243_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3073347_3073866_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3073871_3074582_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3074571_3074796_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3074792_3075005_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|3075001_3075481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|3075659_3075902_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3075882_3077064_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3077260_3077809_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3077640:3077654	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3078007_3079540_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3079756_3080518_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 8
NZ_CP033954	Klebsiella pneumoniae strain L39_2 chromosome, complete genome	5473945	3113451	3144495	5473945	transposase,integrase,holin	Enterobacteria_phage(37.5%)	43	3113233:3113248	3141801:3141816
3113233:3113248	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|3113451_3114123_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3114309_3115137_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3115212_3116478_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3116479_3116899_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|3116978_3118463_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3118462_3118714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152776.1|3119360_3119783_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|3120375_3121080_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000679427.1|3121695_3122043_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|3122206_3122998_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001067855.1|3123979_3124684_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_062955100.1|3124720_3125008_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	95.4	4.4e-36
WP_004218565.1|3125004_3125544_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|3125540_3125840_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_004232548.1|3126489_3127179_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3127178_3127319_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3127315_3127954_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3127946_3128615_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3128611_3128779_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3128759_3129227_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004218530.1|3129747_3130776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3130983_3131229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3131284_3131587_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3131583_3132432_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3132428_3133289_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3133374_3133596_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3133636_3133864_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3133975_3134674_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|3134696_3134816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201109.1|3134961_3136038_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3136119_3136323_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004135674.1|3136751_3136946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3137034_3137319_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3137334_3138180_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3138176_3138464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3138465_3139146_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3139142_3139571_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3139567_3140230_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004190725.1|3140226_3140541_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
WP_004153574.1|3140437_3141625_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|3141801_3142692_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3141801:3141816	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3142691_3143684_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3143685_3144495_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 9
NZ_CP033954	Klebsiella pneumoniae strain L39_2 chromosome, complete genome	5473945	3272167	3401756	5473945	portal,capsid,tRNA,tail,head,integrase,protease,terminase,lysis,holin	Klebsiella_phage(31.87%)	152	3298970:3298984	3399567:3399581
WP_002901088.1|3272167_3272668_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3272784_3273231_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3273214_3274006_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150777.1|3274107_3275292_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3275323_3276016_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3276161_3276671_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3276657_3277014_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004150780.1|3277003_3277243_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150781.1|3277543_3278557_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150782.1|3278614_3278716_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_099119317.1|3278715_3278790_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3278907_3279033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3279092_3279356_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3279486_3280125_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3280214_3281129_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150784.1|3281790_3282834_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004150785.1|3283136_3284345_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150787.1|3284418_3286203_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3286209_3287100_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3287220_3288729_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|3289039_3289726_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140501.1|3290123_3290303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3290342_3290975_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3291541_3291739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|3291854_3292865_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004150793.1|3292861_3294268_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3294323_3295211_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3295227_3295734_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150794.1|3295760_3296255_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3296345_3296531_-	general stress protein	NA	NA	NA	NA	NA
WP_004140529.1|3297152_3298346_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3298458_3298686_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
3298970:3298984	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
WP_004150797.1|3299122_3299446_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3299438_3299831_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|3299827_3300541_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3300813_3300966_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_023328083.1|3301120_3302617_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
WP_062955111.1|3302685_3315390_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
WP_023328085.1|3315452_3316046_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
WP_047666390.1|3316072_3316495_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
WP_047666389.1|3316536_3317247_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
WP_023328087.1|3317248_3318004_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
WP_023328088.1|3318000_3318339_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
WP_023328089.1|3318338_3321674_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
WP_071836352.1|3321673_3321892_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	90.5	5.4e-34
WP_014228914.1|3321906_3322272_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_023328090.1|3322329_3322791_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_023328091.1|3322822_3323224_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
WP_017880258.1|3323220_3323610_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_023328092.1|3323590_3323929_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_020317538.1|3323925_3324243_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_049010370.1|3324223_3324484_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
WP_023328094.1|3324542_3325829_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
WP_014907815.1|3325906_3326827_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023279520.1|3326863_3328123_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
WP_017898992.1|3328122_3328302_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_021462603.1|3328295_3330017_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
WP_012542168.1|3330016_3330451_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014907818.1|3330699_3331131_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_023297386.1|3331127_3331451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3331402_3331765_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_032749552.1|3332091_3332316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049115059.1|3332354_3332792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|3333741_3334092_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_032432826.1|3334088_3334586_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
WP_016160648.1|3334585_3334801_-|lysis	phage S lysis protein	lysis	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_004147999.1|3335718_3335868_+	small membrane protein	NA	NA	NA	NA	NA
WP_004147997.1|3336605_3336809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025861432.1|3337052_3337655_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_062955112.1|3337671_3338703_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
WP_017898980.1|3338702_3338906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025861428.1|3338902_3339295_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_077255782.1|3339335_3339626_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
WP_025368263.1|3339637_3339871_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
WP_004152765.1|3339949_3341434_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3341433_3341685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954975.1|3342274_3343636_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_062954976.1|3343809_3344523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954989.1|3344874_3345744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062954977.1|3345832_3347224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032443841.1|3347572_3348013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047667474.1|3348026_3348491_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
WP_077265602.1|3348483_3349488_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.0e-31
WP_046622349.1|3349547_3350102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071561166.1|3350104_3350329_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
WP_077257742.1|3350417_3350855_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
WP_040234937.1|3351176_3351491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099143961.1|3351653_3351872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279538.1|3351881_3352076_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3352118_3352463_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_062954978.1|3352604_3354743_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
WP_012542206.1|3354795_3355041_+	excisionase	NA	NA	NA	NA	NA
WP_032418030.1|3355021_3356149_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	4.4e-119
WP_094818795.1|3356266_3356449_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	3.7e-20
WP_049182670.1|3356830_3357592_-	hypothetical protein	NA	Q6J1W3	Lactobacillus_phage	29.4	2.5e-09
WP_094818794.1|3358626_3359352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818793.1|3359403_3360669_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.9	8.1e-207
WP_042934076.1|3360671_3361091_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	1.2e-34
WP_064155591.1|3361169_3361412_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	81.0	1.6e-31
WP_031592310.1|3361411_3361654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094818792.1|3362429_3363182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818791.1|3363192_3365361_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	45.1	6.7e-100
WP_094818790.1|3365438_3368507_-	kinase	NA	A0A286S259	Klebsiella_phage	66.3	0.0e+00
WP_094818789.1|3368503_3368890_-	nitrite transporter	NA	H2BD94	Pseudomonas_phage	35.7	4.0e-16
WP_038433285.1|3368897_3369380_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	67.7	8.5e-56
WP_032420722.1|3369366_3369840_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.5	3.9e-53
WP_094818788.1|3369839_3372536_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.4	4.9e-201
WP_032420719.1|3372516_3372834_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
WP_025714420.1|3372854_3373250_-|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	27.5	1.9e-08
WP_023304948.1|3373292_3373775_-	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
WP_020804325.1|3373782_3374181_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
WP_048291628.1|3374177_3374729_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.3	1.6e-53
WP_020317349.1|3374718_3375012_-	sugar ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_049186541.1|3375004_3375331_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.4	4.0e-33
WP_094818787.1|3375411_3377427_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.2	0.0e+00
WP_020317329.1|3377371_3378871_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.6	1.1e-247
WP_094818786.1|3378867_3379083_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	75.7	6.5e-24
WP_094818785.1|3379079_3381188_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.5	0.0e+00
WP_014228567.1|3381187_3381679_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	84.0	6.4e-67
WP_072002796.1|3381999_3382185_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.1	2.4e-11
WP_108918987.1|3382252_3382513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216876.1|3382739_3382985_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	3.0e-33
WP_116723292.1|3383374_3383563_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.8	6.3e-23
WP_094818783.1|3383513_3383789_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	46.7	8.6e-13
WP_094818782.1|3383785_3384133_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.3	3.0e-39
WP_019704505.1|3384129_3384669_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	5.7e-101
WP_024176410.1|3384665_3384965_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_040210598.1|3385134_3385374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818781.1|3385524_3386103_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	2.2e-50
WP_094818780.1|3386116_3387097_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	67.5	2.7e-133
WP_065519871.1|3387109_3387487_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	3.9e-48
WP_094818779.1|3387496_3388306_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	5.9e-110
WP_094818778.1|3388302_3389217_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	60.6	1.8e-30
WP_023317571.1|3389173_3389386_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	2.2e-16
WP_004213338.1|3389623_3390085_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_024176406.1|3390110_3390320_-	cell division protein	NA	NA	NA	NA	NA
WP_019705289.1|3390414_3391059_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.7	8.2e-38
WP_094818777.1|3391358_3392282_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	62.9	1.5e-104
WP_040186300.1|3392367_3392667_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.8	1.0e-14
WP_094818776.1|3392666_3393452_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	1.3e-61
WP_094818775.1|3393579_3394071_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	53.4	5.1e-32
WP_064151808.1|3394067_3394331_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	78.0	1.1e-30
WP_094818774.1|3394323_3394968_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	42.8	1.1e-39
WP_004141386.1|3394967_3395180_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_038435237.1|3395975_3396194_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	3.0e-08
WP_071562415.1|3396193_3396466_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	40.4	4.4e-09
WP_000089156.1|3396494_3396731_+	excisionase	NA	NA	NA	NA	NA
WP_000741346.1|3396720_3397863_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	82.2	9.1e-173
WP_094818773.1|3397976_3399227_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_004150801.1|3399467_3400118_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3399567:3399581	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
WP_004150802.1|3400134_3400593_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3400649_3401756_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP033954	Klebsiella pneumoniae strain L39_2 chromosome, complete genome	5473945	3617917	3710868	5473945	portal,capsid,tRNA,tail,plate,protease,head,integrase,terminase,lysis	Salmonella_phage(56.9%)	94	3673443:3673461	3710943:3710961
WP_002898139.1|3617917_3619210_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3619300_3620644_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3620652_3621264_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3621386_3625640_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3625775_3626270_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|3626775_3627771_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|3627885_3629652_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3629652_3631374_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3631418_3632120_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3632473_3632692_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3632812_3635092_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3635122_3635440_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3635765_3635987_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3636063_3638004_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3638000_3639116_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3639262_3640921_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3641340_3642036_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3642151_3643051_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3643194_3644847_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3644857_3645826_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3646037_3646472_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3646623_3648342_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3648380_3649382_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3649392_3650835_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3650922_3651936_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3651932_3652763_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3652794_3653934_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3654811_3655327_+	lipoprotein	NA	NA	NA	NA	NA
WP_032419144.1|3655553_3656282_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3656302_3657034_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3657040_3657757_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3657756_3658425_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3658608_3659340_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3659382_3660855_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3660851_3661568_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3661646_3662774_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3662815_3663304_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3663361_3664207_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3664203_3665157_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3665167_3666301_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3666464_3667577_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3667925_3668405_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3668493_3669396_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3670217_3670505_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3670707_3670971_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3670977_3671361_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3671627_3673313_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3673443:3673461	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3673532_3673751_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3673842_3674943_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3674939_3675425_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3675421_3678049_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3678041_3678161_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3678175_3678475_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3678527_3679043_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3679052_3680225_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3680363_3681440_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3681469_3681673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3681669_3682401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3682404_3685356_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3685357_3685957_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3685949_3686858_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_032441567.1|3686844_3687207_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896177.1|3687203_3687776_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3687870_3688563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3688559_3689006_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3688998_3689430_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|3689525_3689954_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3689950_3690334_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3690338_3690848_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3690828_3691044_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3691047_3691251_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3691250_3691715_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3691810_3692461_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3692464_3693523_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3693539_3694373_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3694515_3696282_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3696281_3697307_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3697368_3699111_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3699386_3700064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001316229.1|3700178_3700484_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3700422_3700611_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3700764_3703179_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3703175_3704033_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3704029_3704257_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3704256_3704490_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3704557_3704899_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3704862_3705063_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3705070_3705580_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3705612_3705834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3705979_3706858_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3706869_3707814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|3707912_3709397_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3709396_3709648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151720.1|3709815_3710868_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3710943:3710961	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 11
NZ_CP033954	Klebsiella pneumoniae strain L39_2 chromosome, complete genome	5473945	4362652	4374305	5473945	integrase	Enterobacteria_phage(70.0%)	13	4363102:4363116	4386158:4386172
WP_004144574.1|4362652_4363756_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4363102:4363116	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4363766_4365020_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4365372_4366563_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4366550_4367501_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4367500_4367926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152202.1|4368493_4369060_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|4369077_4369323_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_062956184.1|4369319_4370057_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
WP_002889915.1|4370598_4370865_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4370861_4371419_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4371415_4371643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4371639_4371960_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4371971_4374305_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4386158:4386172	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 12
NZ_CP033954	Klebsiella pneumoniae strain L39_2 chromosome, complete genome	5473945	4843742	4853267	5473945	transposase	Enterobacteria_phage(83.33%)	10	NA	NA
WP_004152207.1|4843742_4846076_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4846090_4846411_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4846407_4846635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153681.1|4846631_4847180_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152204.1|4848003_4848741_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4848737_4848983_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4849000_4849567_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152201.1|4850307_4851387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152200.1|4851387_4851924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|4852286_4853267_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 1
NZ_CP033955	Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence	198087	15236	47711	198087	transposase,integrase	Salmonella_phage(25.0%)	27	NA	NA
WP_004213558.1|15236_16166_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.6e-72
WP_004213560.1|16310_17090_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	6.0e-51
WP_077250520.1|17086_17899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818817.1|18452_18842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|18825_19056_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|19052_19469_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004206609.1|19542_21105_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361404.1|21089_22112_+	helicase UvrD	NA	NA	NA	NA	NA
WP_000427619.1|23645_24650_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000405672.1|24740_25175_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004213585.1|25260_27666_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
WP_000118563.1|27662_28739_+	signal peptidase II	NA	NA	NA	NA	NA
WP_004213590.1|28868_29426_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	2.6e-48
WP_004213592.1|29428_32398_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.3	0.0e+00
WP_000427619.1|32476_33481_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004213594.1|33766_34261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213850.1|34494_35418_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
WP_048333570.1|35484_35955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048333569.1|37498_37942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040217257.1|37962_38751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108970992.1|39201_40125_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.2	1.6e-164
WP_108970991.1|40128_40371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011251286.1|40316_40736_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011251285.1|40732_41044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004212794.1|45030_45525_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	38.6	5.9e-20
WP_004212796.1|45861_46260_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000427619.1|46706_47711_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP033955	Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence	198087	133933	197358	198087	transposase,protease,integrase	Caulobacter_phage(15.0%)	58	139642:139657	193336:193351
WP_004225018.1|133933_134929_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
WP_004210218.1|135134_136148_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
WP_004210220.1|136260_136788_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_077250518.1|136801_139759_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.8	2.3e-50
139642:139657	attL	GCAGCAGAGAATGACA	NA	NA	NA	NA
WP_004144375.1|140600_141461_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
WP_011251321.1|143192_143828_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_011251320.1|144164_145406_-	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	27.2	2.2e-10
WP_000301240.1|145490_146066_-	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	9.6e-30
WP_004026609.1|146152_146731_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_004026607.1|146769_147810_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
WP_004026604.1|147833_148289_-	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_011251319.1|148311_149463_-	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_004196925.1|149459_150044_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.4	2.0e-11
WP_011251317.1|150354_151413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181731.1|151424_152567_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.5	3.7e-33
WP_004181732.1|152559_153333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026596.1|153334_154414_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	1.7e-40
WP_011251315.1|154413_155370_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_011251314.1|155380_156604_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_004196888.1|156606_157065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011251313.1|157544_158183_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026586.1|158207_158849_+	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
WP_004210266.1|158849_159488_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026583.1|159580_160621_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011251311.1|160620_162354_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_004196935.1|162381_163881_+	kinase	NA	NA	NA	NA	NA
WP_032720951.1|164259_164742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118061.1|165017_165422_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_004118062.1|165969_166248_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004181742.1|166341_166554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011251308.1|167020_167347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011251307.1|167584_169084_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	31.1	1.8e-35
WP_004210292.1|169064_170330_-	MSMEG_0569 family flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011154627.1|170347_170638_-	MSMEG_0570 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_004210297.1|170649_171612_-	sll0787 family AIR synthase-like protein	NA	NA	NA	NA	NA
WP_004210298.1|171608_172172_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004210300.1|172182_173292_-	MSMEG_0568 family radical SAM protein	NA	NA	NA	NA	NA
WP_004902273.1|173251_174253_-	Nit6803 family nitriliase	NA	NA	NA	NA	NA
WP_004210304.1|174266_174749_-	MSMEG_0572 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_004210305.1|175115_176516_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004118067.1|176891_177095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186895.1|177124_177439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026565.1|177681_178134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029884537.1|181406_182483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213836.1|183625_183880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213833.1|184057_185194_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004213829.1|185259_185577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|185728_186052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011251302.1|186803_187763_-	DNA replication protein	NA	NA	NA	NA	NA
WP_004186937.1|187805_188213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213821.1|188222_188666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213807.1|189929_190898_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
WP_004902302.1|191225_192818_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_004189161.1|192848_193199_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004215130.1|193195_193636_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
193336:193351	attR	TGTCATTCTCTGCTGC	NA	NA	NA	NA
WP_004902307.1|193832_194015_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
WP_004117790.1|195220_196192_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_004211841.1|196191_197358_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
>prophage 1
NZ_CP033956	Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence	133772	1796	50618	133772	protease,transposase	Escherichia_phage(47.62%)	55	NA	NA
WP_000616807.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|2542_2800_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000439434.1|2801_3134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|4444_5149_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013188475.1|5659_6535_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_012579081.1|6614_7538_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_001067855.1|9288_9993_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|11103_11808_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000957857.1|12485_12674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441864.1|12765_13302_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
WP_000027057.1|13484_14345_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|14514_15270_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_001067855.1|15719_16424_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071557810.1|16414_16555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333089.1|18365_18647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361389.1|18769_19120_-	protein stbB	NA	NA	NA	NA	NA
WP_000959884.1|19122_20085_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_032146011.1|20231_20525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072109530.1|20465_20645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085883.1|20601_21285_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
WP_001104881.1|21285_21507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274503.1|21520_21955_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_011161242.1|22654_23227_+	YubH family protein	NA	NA	NA	NA	NA
WP_001198928.1|23199_23625_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271762.1|23671_24094_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027493.1|24090_24282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012372796.1|24595_26263_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.3	1.7e-164
WP_015059006.1|27142_27400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|27662_27893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170695.1|27944_29306_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_015059007.1|29352_29916_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	6.1e-21
WP_021537720.1|29915_30164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072206670.1|30067_30283_+	transporter	NA	NA	NA	NA	NA
WP_012881134.1|30457_30694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290834.1|30758_31286_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
WP_000006003.1|31343_31577_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000845953.1|33729_34164_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276217.1|34160_34880_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001312861.1|35159_35318_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001309236.1|35540_35759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012881134.1|35933_36170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272251.1|36232_36529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234445.1|36639_37461_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.4e-44
WP_015059008.1|37757_38405_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000124981.1|38681_39065_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_001067855.1|39345_40050_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002903955.1|41683_42586_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_023148136.1|42623_42857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210513.1|42847_43609_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|43629_44490_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_099093179.1|44410_44650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138014.1|44730_47697_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|47700_48261_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_013213990.1|49803_50082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013213989.1|50192_50618_+	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
>prophage 2
NZ_CP033956	Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence	133772	93443	104602	133772		Escherichia_phage(50.0%)	11	NA	NA
WP_004118283.1|93443_94310_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_011977818.1|95419_96625_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_086523286.1|96621_97599_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
WP_013214011.1|97680_98952_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
WP_001568036.1|98951_99383_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_009483812.1|99541_99793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|99792_101277_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152353.1|101525_102497_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_013214012.1|102499_103171_+	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|103233_103464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|103900_104602_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
>prophage 1
NZ_CP033957	Klebsiella pneumoniae strain L39_2 plasmid p4_L39, complete sequence	87095	288	29111	87095	transposase,integrase	Escherichia_phage(33.33%)	34	23565:23580	31106:31121
WP_000427619.1|288_1293_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|1474_1651_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|1980_2796_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|2882_3185_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_071881958.1|3078_3330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|3360_4854_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|5064_5289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|5285_6023_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001550559.1|6129_6621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|6654_7359_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001239317.1|7438_7939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001011939.1|8088_8730_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001067855.1|8873_9578_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_087758686.1|9568_9724_+	replication initiator protein	NA	NA	NA	NA	NA
WP_000470728.1|9755_10433_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|10511_11711_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|11742_12627_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|12764_13157_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_040212993.1|14918_16022_+	peptidoglycan synthetase FtsI	NA	NA	NA	NA	NA
WP_012477595.1|16086_16944_+	class A beta-lactamase LAP-2	NA	Q1MVP3	Enterobacteria_phage	61.1	2.0e-92
WP_001516695.1|18540_19197_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001493761.1|19976_21368_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|21404_21977_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|22113_22704_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_077256884.1|22754_23330_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	59.3	1.6e-45
WP_000780222.1|23476_23758_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
23565:23580	attL	TCCAGGCGGGAAATAA	NA	NA	NA	NA
WP_000493286.1|23738_24068_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_032440552.1|24303_24945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015344981.1|25084_25369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440553.1|25440_25650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440554.1|25642_26701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440555.1|27485_27734_+	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	51.5	1.6e-10
WP_032440556.1|27818_28304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086556681.1|28433_29111_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	8.7e-22
31106:31121	attR	TCCAGGCGGGAAATAA	NA	NA	NA	NA
>prophage 2
NZ_CP033957	Klebsiella pneumoniae strain L39_2 plasmid p4_L39, complete sequence	87095	76743	85487	87095	transposase,integrase	Escherichia_phage(22.22%)	10	81176:81235	84720:85539
WP_004152765.1|76743_78228_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_045325066.1|78305_78731_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.3	3.7e-31
WP_108970993.1|78730_79510_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	51.0	3.7e-69
WP_053897648.1|79657_81214_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.1e-83
81176:81235	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|81238_81943_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_094818827.1|81976_82501_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.4	1.2e-31
WP_015344971.1|82640_82925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845048.1|82893_83907_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|84062_84536_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001067855.1|84782_85487_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
84720:85539	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
