The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041184	Salmonella enterica subsp. enterica serovar Anatum strain CFSAN003959 chromosome, complete genome	4718314	1642320	1651490	4718314	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_000569166.1|1642320_1643268_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_001261696.1|1643962_1644070_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1644129_1644861_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|1645083_1646769_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|1646765_1647485_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1647531_1647999_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1648055_1648586_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1648757_1649216_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1649456_1651490_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 2
NZ_CP041184	Salmonella enterica subsp. enterica serovar Anatum strain CFSAN003959 chromosome, complete genome	4718314	1719579	1725876	4718314		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|1719579_1720983_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1721160_1722054_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1722430_1723516_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|1723515_1724415_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|1724462_1725341_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|1725345_1725876_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 3
NZ_CP041184	Salmonella enterica subsp. enterica serovar Anatum strain CFSAN003959 chromosome, complete genome	4718314	1832028	1843413	4718314	integrase	Stenotrophomonas_phage(25.0%)	12	1831446:1831459	1835030:1835043
1831446:1831459	attL	GCCAGCTTTGCCCC	NA	NA	NA	NA
WP_023244267.1|1832028_1833291_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.3	1.5e-75
WP_023243861.1|1833936_1834227_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	1.8e-08
WP_000598920.1|1834598_1835396_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1835030:1835043	attR	GCCAGCTTTGCCCC	NA	NA	NA	NA
WP_000500830.1|1835876_1836038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243860.1|1836164_1836584_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|1836586_1837855_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|1838309_1838522_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1838532_1838721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|1838980_1840174_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|1840822_1841134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|1841213_1841909_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|1841982_1843413_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 4
NZ_CP041184	Salmonella enterica subsp. enterica serovar Anatum strain CFSAN003959 chromosome, complete genome	4718314	1946666	1953280	4718314	integrase	Pectobacterium_phage(16.67%)	11	1948876:1948898	1960999:1961021
WP_000856224.1|1946666_1946897_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|1947034_1947409_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|1947409_1948285_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|1948301_1948655_+	YebY family protein	NA	NA	NA	NA	NA
1948876:1948898	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|1949026_1950106_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|1950102_1951209_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|1951239_1951470_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|1951523_1952057_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|1952313_1952481_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|1952545_1952734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|1952788_1953280_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
1960999:1961021	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 5
NZ_CP041184	Salmonella enterica subsp. enterica serovar Anatum strain CFSAN003959 chromosome, complete genome	4718314	2560430	2647747	4718314	lysis,tRNA,capsid,portal,holin,protease,tail,integrase,terminase,head	Salmonella_phage(40.74%)	110	2581077:2581093	2647266:2647282
WP_000829543.1|2560430_2560958_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272239.1|2560954_2561062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|2561267_2561714_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579793.1|2561693_2562488_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205341.1|2562588_2563773_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222527.1|2563891_2564239_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487135.1|2564224_2564536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673492.1|2564604_2564856_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|2565051_2565150_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|2565288_2565537_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001532450.1|2565544_2565730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001532438.1|2565850_2566492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|2566721_2566904_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|2566906_2567269_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|2567441_2568080_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617985.1|2568275_2568821_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000908466.1|2568903_2569059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208086.1|2569137_2569386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190263.1|2569640_2570489_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001682351.1|2570557_2571151_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000175797.1|2571295_2572084_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_000234684.1|2572191_2572842_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183699.1|2573035_2573362_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_001618317.1|2573555_2574689_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947459.1|2574770_2575361_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950212.1|2575354_2576152_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000966637.1|2576145_2576958_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001748353.1|2576947_2577922_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000946091.1|2577921_2579556_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|2580237_2580552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929973.1|2580700_2581231_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
2581077:2581093	attL	CAGATAGCGCCCTAAAA	NA	NA	NA	NA
WP_021000256.1|2581313_2582357_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001525268.1|2582695_2583166_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000927827.1|2583315_2583588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000758947.1|2583787_2583913_-	lipoprotein	NA	NA	NA	NA	NA
WP_000977725.1|2584290_2584635_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000789471.1|2585856_2586414_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_001535993.1|2587225_2587489_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|2587620_2587833_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001520581.1|2588247_2588769_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_000497451.1|2588959_2589199_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001033398.1|2589688_2590477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000787625.1|2590798_2591005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021000253.1|2591472_2592597_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_012218897.1|2593044_2593257_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.5e-20
WP_000334551.1|2593510_2594182_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	1.1e-80
WP_001520226.1|2594501_2596613_-	type III secretion system effector E3 ubiquitin transferase SspH1	NA	Q9MBL9	Phage_Gifsy-2	46.9	2.1e-26
WP_000457876.1|2598146_2598272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001520426.1|2598534_2598651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031609383.1|2598841_2599042_+	PhoPQ-activated virulence protein PagK	NA	NA	NA	NA	NA
WP_000143179.1|2599138_2599723_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.8	1.7e-87
WP_001521136.1|2599722_2602164_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	61.8	9.5e-87
WP_000178851.1|2602217_2602460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514901.1|2602498_2605861_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.6	0.0e+00
WP_000662740.1|2606467_2607205_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	1.2e-128
WP_001152688.1|2607211_2607910_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.0	1.8e-102
WP_000447370.1|2607919_2608249_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
WP_000372079.1|2608251_2611293_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	65.0	8.0e-293
WP_010989052.1|2611264_2611603_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2611599_2611995_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971845.1|2612045_2612792_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	5.7e-99
WP_000033885.1|2612799_2613201_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000677089.1|2613197_2613776_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083293.1|2613762_2614140_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
WP_000201486.1|2614150_2614510_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2614567_2615596_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2615650_2615998_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189495.1|2616010_2617507_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.9	3.3e-98
WP_000831820.1|2617496_2619077_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	1.2e-188
WP_000201416.1|2619073_2619277_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	70.8	2.1e-16
WP_000623090.1|2619260_2621192_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	2.4e-258
WP_001102153.1|2621163_2621709_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669693.1|2621994_2622396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031607976.1|2622632_2623079_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	9.3e-65
WP_000984587.1|2623096_2623549_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	5.1e-79
WP_001574216.1|2623532_2623862_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110785.1|2624137_2624824_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	99.6	3.6e-132
WP_000798706.1|2625184_2625634_+	lipoprotein	NA	NA	NA	NA	NA
WP_001534733.1|2625769_2625895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047630.1|2626293_2627091_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	4.0e-151
WP_001617856.1|2627080_2627227_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096558.1|2627223_2627835_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_001241019.1|2627837_2628044_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_000929790.1|2628043_2628646_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_014343878.1|2628680_2628929_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2629045_2629279_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000802853.1|2629526_2629853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107251218.1|2629946_2630015_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_000132543.1|2629995_2631213_-	hypothetical protein	NA	J9Q803	Salmonella_phage	53.3	3.1e-118
WP_000974174.1|2631523_2631769_-	hypothetical protein	NA	Q5G8U9	Enterobacteria_phage	88.9	3.0e-33
WP_000065089.1|2631768_2632089_-	hypothetical protein	NA	H6WRY0	Salmonella_phage	65.5	6.7e-25
WP_000113626.1|2632085_2632433_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	100.0	4.5e-59
WP_000800015.1|2632443_2633193_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	99.6	2.5e-139
WP_001520662.1|2633195_2634179_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.7	5.6e-163
WP_010835408.1|2634263_2634638_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_001274939.1|2634597_2634840_-	hypothetical protein	NA	A0A0M4QX15	Salmonella_phage	67.9	5.6e-24
WP_024133227.1|2634912_2635326_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	78.0	8.9e-46
WP_000106861.1|2635468_2636578_+	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	58.4	1.6e-118
WP_022742800.1|2637250_2637601_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	98.3	6.4e-61
WP_068938196.1|2637727_2640166_+	exonuclease VIII	NA	H6WRX1	Salmonella_phage	68.3	6.7e-258
WP_001126032.1|2640158_2640989_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_001033922.1|2641024_2641345_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	59.2	1.8e-33
WP_023221268.1|2641665_2642169_+	hypothetical protein	NA	A0A075B8H2	Enterobacteria_phage	92.3	6.0e-36
WP_000089141.1|2642218_2642455_+	excisionase	NA	NA	NA	NA	NA
WP_000741325.1|2642444_2643587_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000444509.1|2643700_2644951_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_001249412.1|2645122_2645788_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825957.1|2645784_2646114_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_023227248.1|2646125_2646587_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004540.1|2646640_2647747_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2647266:2647282	attR	TTTTAGGGCGCTATCTG	NA	NA	NA	NA
>prophage 6
NZ_CP041184	Salmonella enterica subsp. enterica serovar Anatum strain CFSAN003959 chromosome, complete genome	4718314	2917151	2926233	4718314	integrase,protease	Ralstonia_phage(16.67%)	9	2915544:2915556	2934729:2934741
2915544:2915556	attL	CTGTTTTACCTTA	NA	NA	NA	NA
WP_024155556.1|2917151_2918393_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_071604632.1|2918359_2918548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243338.1|2918920_2919298_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|2919459_2919657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2919869_2922146_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2922176_2922497_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2922820_2923042_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|2923171_2925118_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|2925114_2926233_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
2934729:2934741	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 7
NZ_CP041184	Salmonella enterica subsp. enterica serovar Anatum strain CFSAN003959 chromosome, complete genome	4718314	3283566	3323398	4718314	coat,portal,protease,tail,integrase,terminase	Salmonella_phage(63.33%)	63	3282987:3283033	3323412:3323458
3282987:3283033	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
WP_024155479.1|3283566_3285489_+	acyltransferase	NA	C6ZR20	Salmonella_phage	99.2	0.0e+00
WP_023972031.1|3285830_3287948_-|tail	tail protein	tail	C6ZR19	Salmonella_phage	97.0	0.0e+00
WP_000868974.1|3288103_3290014_-	hypothetical protein	NA	I1TEJ6	Salmonella_phage	89.7	0.0e+00
WP_044783574.1|3290013_3291351_-	DNA transfer protein	NA	A0A1R3Y5Q4	Salmonella_virus	97.3	5.5e-238
WP_000964903.1|3291393_3292083_-	hypothetical protein	NA	B9UDK9	Salmonella_phage	91.3	8.9e-91
WP_000627698.1|3292085_3292541_-	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	98.7	4.4e-86
WP_000774925.1|3292540_3293242_-	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	98.7	7.5e-77
WP_023972029.1|3293245_3294664_-	Packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	98.3	3.0e-274
WP_001166096.1|3294623_3295124_-	packaged DNA stabilization protein p27	NA	I6RSF6	Salmonella_phage	100.0	2.5e-90
WP_023972028.1|3295107_3295668_-	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.9	1.1e-102
WP_001196938.1|3295708_3297001_-|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_000433852.1|3297000_3297912_-	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_000368906.1|3297925_3300103_-|portal	portal protein p19	portal	A0A0M4RCZ3	Salmonella_phage	98.8	0.0e+00
WP_077909432.1|3300124_3300652_+	HNH endonuclease	NA	A0A0M4R2Z1	Salmonella_phage	100.0	2.7e-95
WP_024155483.1|3300655_3302116_-	hypothetical protein	NA	W6MW26	Pseudomonas_phage	76.0	8.2e-219
WP_038805832.1|3302115_3302574_-|terminase	terminase	terminase	A0A2P1MXF5	Escherichia_phage	65.5	4.7e-48
WP_024155485.1|3302586_3302991_-	hypothetical protein	NA	C6ZR73	Salmonella_phage	97.8	2.6e-66
WP_044783375.1|3302990_3303380_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	96.9	2.8e-73
WP_024155486.1|3303383_3303626_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	3.0e-33
WP_023972169.1|3303848_3304379_-	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	96.6	5.3e-91
WP_089082231.1|3304332_3304539_-	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	87.3	6.4e-21
WP_127908300.1|3304614_3304848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046340463.1|3304765_3305053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046340462.1|3305049_3305280_-	hypothetical protein	NA	M4Q0Z5	Dunaliella_viridis_virus	40.6	9.8e-10
WP_068938201.1|3305276_3305744_-	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	44.4	6.2e-27
WP_024133454.1|3305718_3305946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235452.1|3306390_3307014_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	87.0	8.3e-96
WP_000994515.1|3307010_3307199_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_023210747.1|3307195_3307558_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	97.5	5.0e-61
WP_068938194.1|3307557_3307845_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	100.0	2.9e-51
WP_001286918.1|3307837_3308050_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	98.6	4.7e-35
WP_000950962.1|3308042_3308219_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_001532927.1|3308211_3308553_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_074440803.1|3308555_3308732_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	98.3	5.1e-27
WP_024150884.1|3308713_3308872_-	hypothetical protein	NA	Q8HAF7	Salmonella_phage	94.2	6.0e-27
WP_023210745.1|3308868_3309315_-	recombination protein NinB	NA	I6R0N7	Salmonella_phage	99.3	1.2e-80
WP_024150883.1|3309271_3309568_-	hypothetical protein	NA	E7C9R7	Salmonella_phage	99.0	2.6e-47
WP_100097535.1|3309570_3309831_-	hypothetical protein	NA	Q8HAG0	Salmonella_phage	98.8	9.9e-43
WP_077909433.1|3309830_3310040_-	hypothetical protein	NA	A0A1R3Y5S8	Salmonella_virus	98.6	7.0e-31
WP_006819448.1|3310049_3310322_-	DUF4752 family protein	NA	A0A220NQX8	Salmonella_phage	100.0	4.2e-44
WP_023210742.1|3310396_3311833_-	AAA family ATPase	NA	E7C9R5	Salmonella_phage	98.5	1.7e-272
WP_006789497.1|3311822_3312722_-	hypothetical protein	NA	A0A220NQX5	Salmonella_phage	99.3	1.5e-154
WP_001125981.1|3312714_3312861_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_023210741.1|3312895_3313174_-	hypothetical protein	NA	A0A220NRS4	Escherichia_phage	92.4	3.8e-40
WP_000276884.1|3313280_3313466_-	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_017441421.1|3313546_3314197_+	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	99.5	2.1e-121
WP_023210740.1|3314535_3314871_+	hypothetical protein	NA	Q5G8T5	Enterobacteria_phage	87.9	1.7e-47
WP_023210739.1|3314949_3315144_+	antirestriction protein	NA	E7C9Q6	Salmonella_phage	98.4	5.5e-30
WP_001748038.1|3315761_3316040_+	hypothetical protein	NA	C6ZR42	Salmonella_phage	100.0	1.3e-45
WP_020838488.1|3316357_3316519_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	E7C9Q3	Salmonella_phage	100.0	4.9e-24
WP_000361564.1|3316511_3316625_+	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
WP_001552364.1|3316621_3316810_+	hypothetical protein	NA	C6ZR38	Salmonella_phage	100.0	1.3e-28
WP_068938193.1|3316818_3317526_+	recombinase	NA	K7PKU3	Enterobacteria_phage	96.6	7.4e-133
WP_024155543.1|3317526_3318033_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	97.0	2.1e-89
WP_024155542.1|3318041_3318590_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	98.4	1.2e-103
WP_001111322.1|3318605_3318899_+	DUF2856 family protein	NA	I6R984	Salmonella_phage	96.9	2.7e-49
WP_071604629.1|3318909_3319077_+	DUF2737 family protein	NA	A0A1V0E5L8	Salmonella_phage	96.4	5.0e-24
WP_068938192.1|3319073_3319328_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	94.0	3.2e-38
WP_068938191.1|3319314_3319842_+	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	67.2	2.4e-75
WP_001229203.1|3319843_3320359_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	100.0	2.4e-101
WP_024155535.1|3321209_3321395_+	hypothetical protein	NA	A0A1V0E5M0	Salmonella_phage	95.1	4.1e-27
WP_024155534.1|3321525_3321792_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	96.6	2.4e-44
WP_068938189.1|3322234_3323398_+|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	97.9	3.0e-224
3323412:3323458	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
>prophage 8
NZ_CP041184	Salmonella enterica subsp. enterica serovar Anatum strain CFSAN003959 chromosome, complete genome	4718314	4310926	4355704	4718314	plate,tail,tRNA	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|4310926_4311925_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|4312012_4313323_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4313569_4314085_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4314184_4314394_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4314415_4314529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|4314525_4315851_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4316029_4316638_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4316746_4317115_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4317285_4319706_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4319804_4320677_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4320690_4321188_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|4321368_4322286_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|4322449_4323808_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4323896_4325006_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4325367_4326558_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|4326689_4328234_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|4328248_4329139_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|4329304_4329715_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|4329857_4331954_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|4331953_4332691_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4332687_4333356_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4333389_4333632_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|4334075_4335725_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4336069_4337419_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4337549_4337897_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|4338472_4338760_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|4338762_4339368_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|4339380_4339695_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4339854_4340310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|4340306_4340504_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|4340493_4341921_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_000907495.1|4341920_4342445_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|4342496_4342814_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4342773_4342902_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|4342998_4345353_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|4345352_4346306_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|4346305_4346515_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|4346502_4347546_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|4347555_4348278_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4348605_4348968_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|4348964_4349894_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|4349893_4351441_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|4351604_4351964_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|4351954_4353070_+	bacteriophage protein	NA	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|4353062_4353695_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|4353697_4355179_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_001177097.1|4355188_4355704_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
