The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041185	Janthinobacterium sp. SNU WT3 strain SNU WT1 chromosome, complete genome	6314370	532311	542135	6314370		Aeromonas_phage(16.67%)	11	NA	NA
WP_141168887.1|532311_534339_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	41.9	1.9e-125
WP_141168888.1|534344_534920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141168889.1|534955_535384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141168890.1|535404_536058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141172586.1|536171_536585_+	recombinase	NA	Q1MVP6	Enterobacteria_phage	47.2	9.3e-11
WP_141168891.1|536581_539209_+	DNA methylase N-4	NA	W6ATN1	Mycobacterium_phage	59.1	1.8e-296
WP_168208335.1|539205_539613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168208336.1|539609_540566_+	DUF1376 domain-containing protein	NA	A0A1P8DTG2	Proteus_phage	53.1	5.5e-22
WP_141168893.1|540552_541401_+	ATP-binding protein	NA	A0A059WFK9	Vibrio_phage	48.7	1.6e-57
WP_141168894.1|541437_541791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141172587.1|541790_542135_+	DUF1064 domain-containing protein	NA	Q3HQZ9	Burkholderia_phage	74.5	5.3e-44
>prophage 2
NZ_CP041185	Janthinobacterium sp. SNU WT3 strain SNU WT1 chromosome, complete genome	6314370	3671687	3680810	6314370	tRNA	Escherichia_phage(50.0%)	9	NA	NA
WP_141170907.1|3671687_3672734_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.5	1.4e-82
WP_141170908.1|3672766_3673660_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	61.6	9.2e-96
WP_141170909.1|3673696_3674242_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	53.6	2.3e-49
WP_141170910.1|3674290_3675175_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	31.4	4.4e-26
WP_141170911.1|3675239_3676265_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.8	1.1e-79
WP_141172843.1|3676418_3677099_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_141170912.1|3677564_3677831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141170913.1|3678133_3678490_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_141170914.1|3678878_3680810_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	27.1	1.5e-18
>prophage 3
NZ_CP041185	Janthinobacterium sp. SNU WT3 strain SNU WT1 chromosome, complete genome	6314370	5903768	5948778	6314370	tRNA,terminase,head,tail,transposase,plate,portal,capsid,integrase	Burkholderia_phage(34.38%)	55	5905965:5906023	5942618:5942676
WP_141172272.1|5903768_5905814_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.3	2.0e-21
5905965:5906023	attL	CTTGAAAACTAGCGACGGGTTACACTGTTCGTGAGTTCGAATCTCACCGCTTCCGCCAG	NA	NA	NA	NA
WP_141172273.1|5906151_5907210_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	55.0	5.6e-100
WP_046682344.1|5907223_5907475_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	45.3	1.9e-11
WP_141172274.1|5907467_5907665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141172275.1|5907661_5907850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141172276.1|5907900_5909682_-	replication endonuclease	NA	A4JWW0	Burkholderia_virus	42.1	4.4e-89
WP_141172277.1|5909681_5910107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141172278.1|5910106_5910325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141172279.1|5910426_5910831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071079002.1|5910952_5911216_-	ogr/Delta-like zinc finger family protein	NA	A4JWR6	Burkholderia_virus	45.7	2.6e-14
WP_046682347.1|5911212_5911401_-	hypothetical protein	NA	E5E3T9	Burkholderia_phage	58.6	3.0e-09
WP_035820909.1|5911438_5911642_-	hypothetical protein	NA	E5E3U0	Burkholderia_phage	61.0	2.4e-12
WP_092612261.1|5911652_5911856_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_141172280.1|5911936_5912380_+	helix-turn-helix domain-containing protein	NA	K4NXA8	Burkholderia_phage	55.3	1.4e-36
WP_141172281.1|5912534_5913401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141172282.1|5913566_5915219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141172283.1|5915339_5916572_-	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	48.6	2.7e-82
WP_141172284.1|5916568_5917177_-	oxidoreductase	NA	A0A2H4JG54	uncultured_Caudovirales_phage	59.1	7.7e-38
WP_141172285.1|5917192_5919988_-|tail	phage tail protein	tail	A4PE52	Ralstonia_virus	50.9	1.6e-231
WP_141172286.1|5920063_5920177_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	55.6	4.6e-05
WP_058050288.1|5920185_5920494_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	52.1	6.9e-19
WP_046682355.1|5920533_5921043_-|tail	phage major tail tube protein	tail	E5E3U9	Burkholderia_phage	56.2	6.7e-51
WP_141172287.1|5921110_5922286_-|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	68.3	2.9e-150
WP_141172288.1|5922322_5922853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141172289.1|5922852_5924520_-	hypothetical protein	NA	A0A0M3ULH6	Salmonella_phage	65.8	9.8e-51
WP_141173000.1|5924516_5925116_-|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	60.9	1.2e-64
WP_141172290.1|5925129_5926041_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	53.3	4.5e-74
WP_141172291.1|5926037_5926382_-	oxidoreductase	NA	E5E3V5	Burkholderia_phage	52.1	3.6e-24
WP_141173001.1|5926378_5926969_-|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	45.6	7.3e-33
WP_141172292.1|5927117_5927612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141172293.1|5927598_5931681_-	RHS repeat protein	NA	S5W9C6	Leptospira_phage	33.3	5.4e-10
WP_141172294.1|5931816_5932284_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	53.6	3.3e-36
WP_141172295.1|5932280_5932769_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	50.0	3.0e-32
WP_141172296.1|5932752_5933265_-	lysozyme	NA	NA	NA	NA	NA
WP_141172297.1|5933261_5933822_-	hypothetical protein	NA	G0YQI3	Erwinia_phage	52.9	2.1e-45
WP_035820867.1|5933821_5934193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141172298.1|5934257_5934467_-|tail	phage tail protein	tail	D5LGY2	Escherichia_phage	47.8	2.0e-06
WP_141172299.1|5934466_5934970_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	48.5	1.3e-30
WP_141172300.1|5935076_5935793_-|integrase	integrase	integrase	A4PE31	Ralstonia_virus	45.7	2.9e-44
WP_141172301.1|5935792_5936812_-|capsid	phage major capsid protein, P2 family	capsid	E5E3W8	Burkholderia_phage	63.5	1.1e-116
WP_141172302.1|5936861_5937665_-|capsid	GPO family capsid scaffolding protein	capsid	E5FFI7	Burkholderia_phage	50.0	2.3e-58
WP_141172303.1|5937801_5939601_+|terminase	terminase ATPase subunit family protein	terminase	A4JWQ1	Burkholderia_virus	66.8	3.1e-236
WP_141172304.1|5939516_5940662_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	61.8	1.4e-128
WP_070346144.1|5940658_5940874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141172305.1|5941305_5942058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141172306.1|5942054_5942489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141172307.1|5942853_5943648_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
5942618:5942676	attR	CTTGAAAACTAGCGACGGGTTACACTGTTCGTGAGTTCGAATCTCACCGCTTCCGCCAG	NA	NA	NA	NA
WP_141169616.1|5943742_5945000_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	47.3	2.5e-67
WP_141172308.1|5945237_5945630_+	GFA family protein	NA	NA	NA	NA	NA
WP_141172309.1|5945807_5946191_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_141172310.1|5946393_5946759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141172311.1|5947019_5947427_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_141172312.1|5947457_5947928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096234537.1|5948022_5948220_+	DUF3079 domain-containing protein	NA	NA	NA	NA	NA
WP_141172313.1|5948283_5948778_+|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
